ID: 1120860533

View in Genome Browser
Species Human (GRCh38)
Location 14:89251249-89251271
Sequence GTACTTGCATGGGTGTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 232}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120860533_1120860537 -2 Left 1120860533 14:89251249-89251271 CCACAGCACACCCATGCAAGTAC 0: 1
1: 0
2: 1
3: 16
4: 232
Right 1120860537 14:89251270-89251292 ACTGTCCCGGAATTCACCCTAGG 0: 1
1: 0
2: 0
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120860533 Original CRISPR GTACTTGCATGGGTGTGCTG TGG (reversed) Intronic
900119611 1:1042893-1042915 CCACATGCATGGGTGTCCTGGGG + Intronic
900581101 1:3409923-3409945 GTATGTGCATGTGTGTGGTGTGG + Intronic
900665367 1:3811464-3811486 GGCCTTGCATGGTTGTGGTGAGG + Intergenic
900809625 1:4791895-4791917 CTAGTTCCATGGGTGAGCTGAGG - Exonic
901278764 1:8014524-8014546 GTGGTTGCATGGGTGTTCTCGGG - Intronic
901393445 1:8963366-8963388 GTGTTTGCATGGGAGTGTTGAGG - Intronic
904936323 1:34132190-34132212 GTCCATGGAGGGGTGTGCTGGGG - Intronic
905741091 1:40372493-40372515 CTACTTGGATGGGTTTTCTGAGG + Intronic
908401967 1:63779828-63779850 GTCCATGCCTGGGTGTTCTGGGG - Intronic
908746444 1:67381453-67381475 TAACTTTCATGGGAGTGCTGGGG - Intronic
909252700 1:73379311-73379333 GTTCTTGCATTAGTCTGCTGAGG + Intergenic
909624417 1:77699921-77699943 GTTCTTGCATTAGTTTGCTGAGG - Intronic
910025026 1:82639688-82639710 TTTCTTGCATTGGTTTGCTGAGG - Intergenic
910167541 1:84343583-84343605 GTTCTTGCATTAGTTTGCTGAGG - Intronic
912319159 1:108693511-108693533 GTGCTGGCTTGGCTGTGCTGGGG + Intronic
913059337 1:115190446-115190468 CTCCTTGGATGGGTCTGCTGGGG + Intergenic
915991104 1:160517732-160517754 GTTCTTGTATGAGTTTGCTGAGG - Intronic
917237295 1:172907958-172907980 GTTCCTGCATGAGTTTGCTGAGG + Intergenic
918182589 1:182097226-182097248 GAACCTGCTTGGGTGTGCTCAGG + Intergenic
919781301 1:201222834-201222856 GTACCTGCAGGGGTGTGGGGAGG + Intronic
923377949 1:233384711-233384733 GTGTTTGCATGTGTGTGTTGGGG + Exonic
923480357 1:234377795-234377817 GTGCGTGCATGGGTCTGCAGAGG + Intronic
924608289 1:245553590-245553612 GTACTTTCATCGGTGTGCTTAGG - Intronic
924862898 1:247944570-247944592 GTTCTTGCATTAGTTTGCTGAGG + Intronic
1063084289 10:2801087-2801109 GTTCTTGCATTAGTCTGCTGAGG - Intergenic
1064543167 10:16425641-16425663 GTGCATGCATGGGTGTGTGGAGG - Intergenic
1064879608 10:20036116-20036138 GGACCTGTATGTGTGTGCTGTGG + Intronic
1066228757 10:33411393-33411415 GTTCCTGCATTAGTGTGCTGAGG + Intergenic
1067062892 10:43087042-43087064 GTTCTACCATGGGTGTGCAGCGG + Intronic
1067469991 10:46528986-46529008 GGACATGCTTGGGTGGGCTGTGG + Intergenic
1067705425 10:48603664-48603686 GAACTTGCATGGCTCTGCTGAGG - Intronic
1068763832 10:60741084-60741106 GTACTTGAAAGAGTGTGCTAGGG - Intergenic
1069900383 10:71703460-71703482 GTACCTGCCTGGCTGTGCTGTGG + Intronic
1070356007 10:75640893-75640915 CCACTTGCATTGATGTGCTGAGG + Intronic
1070366552 10:75742474-75742496 ACACTTGAATAGGTGTGCTGTGG + Intronic
1072359961 10:94649816-94649838 GTTCTTGCATTAGTTTGCTGAGG + Intergenic
1072856792 10:98955835-98955857 GTTCCTGCATCAGTGTGCTGAGG - Intronic
1074645913 10:115451986-115452008 GTACCTGCATTGGTTTGCTAAGG - Intronic
1076293444 10:129365601-129365623 GTAATTGCATGGCTGTCCCGGGG - Intergenic
1076410815 10:130248517-130248539 AGACTTGCACGTGTGTGCTGTGG - Intergenic
1077071898 11:678481-678503 GTCCATTCATGTGTGTGCTGTGG - Intronic
1077734420 11:4773901-4773923 GTTCCTGCATGAGTTTGCTGAGG + Intronic
1078918586 11:15804947-15804969 GTATGTGCATGTGTGTGTTGGGG - Intergenic
1080140740 11:28916909-28916931 GTTCTTGCATTAGTTTGCTGAGG - Intergenic
1086741466 11:90374682-90374704 GTTCCTGCATTGGTTTGCTGAGG + Intergenic
1087414732 11:97839762-97839784 GTTCTTGCATTAGTTTGCTGAGG - Intergenic
1087561708 11:99798221-99798243 GTTCTTGCATTGGTTTGCTTAGG + Intronic
1088020637 11:105114054-105114076 GTTCTTGCATTAGTCTGCTGAGG - Intergenic
1088442774 11:109889963-109889985 GTACTTGTGTGTGTGTGGTGTGG - Intergenic
1089174747 11:116540353-116540375 GTACTGGGATGTGTGTGATGGGG - Intergenic
1089360145 11:117880195-117880217 TTACTTGCCTGGGTCTCCTGGGG - Intergenic
1092325060 12:7522160-7522182 GTTCTTGCATTAGTTTGCTGAGG + Intergenic
1093099160 12:15006389-15006411 GTTCTTGCATGAGTTTCCTGAGG - Intergenic
1093215101 12:16352784-16352806 GTACTTTCATGGGTGTAATAGGG - Intronic
1093253110 12:16832706-16832728 GCACATGCATGTGTGTGTTGGGG + Intergenic
1094299316 12:28943930-28943952 GTTCTTGCATTAGTTTGCTGAGG + Intergenic
1096708700 12:53439830-53439852 GTTCCTGCATGAGTTTGCTGAGG - Intergenic
1096813007 12:54183585-54183607 ATGCTTGGCTGGGTGTGCTGTGG - Intronic
1096910158 12:54975334-54975356 GTAATTGCATTGATGAGCTGAGG - Intronic
1099593050 12:84621040-84621062 GTTCTTGCATTAGTTTGCTGAGG - Intergenic
1103195847 12:119043268-119043290 GTTCTTGCGTGAGTTTGCTGAGG - Intronic
1103203874 12:119112681-119112703 GTTCTTGCATTGGTTTGCAGAGG - Intronic
1104914661 12:132258448-132258470 GAACCTGCATGAGTGTGCAGCGG + Intronic
1104962304 12:132494005-132494027 GTGCTGGGCTGGGTGTGCTGGGG + Intronic
1106893466 13:34271720-34271742 GTTCCTGCATTGGTTTGCTGAGG + Intergenic
1107631262 13:42344796-42344818 GTAGTTCCATGGGAGAGCTGTGG + Intergenic
1107734694 13:43386285-43386307 GTCCTTACAGGGATGTGCTGAGG + Intronic
1108110399 13:47065402-47065424 GTACTTGCTTGGGTGTGTTGTGG + Intergenic
1109015174 13:57000768-57000790 GTTCCTGCATGAGTTTGCTGAGG + Intergenic
1109034837 13:57242949-57242971 ATACTTGCATGAGTGTGGTGAGG + Intergenic
1109306080 13:60643459-60643481 GTTCCTGCATTGGTTTGCTGAGG + Intergenic
1110929485 13:81196756-81196778 GTACGTGCATGTGTATGCTTGGG + Intergenic
1111192641 13:84830658-84830680 GTTCTTGCATTTGTTTGCTGAGG - Intergenic
1112943156 13:104891472-104891494 GTTCTTGCATTAGTTTGCTGAGG - Intergenic
1113867651 13:113538117-113538139 GTGCATGCATGTGTGTGCTTTGG + Intronic
1113969981 13:114181340-114181362 GTCCTGGCAGGGGTATGCTGAGG + Intergenic
1116546974 14:46180933-46180955 GTTTTTGAATAGGTGTGCTGTGG + Intergenic
1116612342 14:47091922-47091944 GTACTTGTGTGTGTGTGGTGGGG - Intronic
1117310481 14:54517886-54517908 GTTCTTGCATTAGTTTGCTGAGG + Intronic
1118034450 14:61851172-61851194 GTACCTGCATTAGTTTGCTGAGG + Intergenic
1118644809 14:67827751-67827773 GTTCTTGCATTAGTTTGCTGAGG + Intronic
1118765650 14:68907839-68907861 GTCCCTGCTTGGGTATGCTGGGG - Intronic
1118817862 14:69325458-69325480 GTGCTTGCCTTGGTGTTCTGGGG - Intronic
1120140723 14:80926972-80926994 GTACTAGCATGGCTCTGATGGGG - Intronic
1120730491 14:87995602-87995624 GAACTTGCATGGGGGTGGAGAGG - Intergenic
1120839094 14:89067592-89067614 GTGCTTGCATTGGTTTGCTAGGG - Intergenic
1120860533 14:89251249-89251271 GTACTTGCATGGGTGTGCTGTGG - Intronic
1121398435 14:93648823-93648845 GTGCTTGCATCTCTGTGCTGTGG - Intronic
1121680432 14:95788786-95788808 GCACTTCTATGGGTGTGATGGGG + Intergenic
1121941736 14:98077117-98077139 GTGCATGCATGTGTGTGCTTTGG - Intergenic
1122817926 14:104322957-104322979 ATGCTCGCATGCGTGTGCTGTGG + Intergenic
1122824933 14:104365087-104365109 GTCCTCACATGGTTGTGCTGTGG - Intergenic
1123040615 14:105488799-105488821 GTACATGCGCGTGTGTGCTGGGG + Intronic
1124428373 15:29583368-29583390 GTTCTTGCATTAGTTTGCTGAGG - Intergenic
1124857108 15:33399705-33399727 GTTCTTGCCTGGGGGTGTTGAGG - Intronic
1125714943 15:41814291-41814313 GTACTTCTATGGCTGTGATGGGG - Intronic
1126329243 15:47514087-47514109 TTACTTGCATGAGTGAGATGTGG + Intronic
1127742488 15:61925190-61925212 CTATTTGCATGCGTGTGTTGTGG - Intronic
1130834861 15:87640276-87640298 GTGCCTGTATGTGTGTGCTGGGG + Intergenic
1131766215 15:95678280-95678302 GTACTCTCTTGGGTGTGCAGTGG + Intergenic
1133181741 16:4059996-4060018 GTAGCAGCATGGGTGAGCTGAGG - Intronic
1136653485 16:31693741-31693763 GTGTGTGCATGTGTGTGCTGTGG - Intergenic
1140655784 16:77137905-77137927 GTACCTGCATTAGTTTGCTGAGG + Intergenic
1142760791 17:2041002-2041024 GTTAATGAATGGGTGTGCTGGGG + Intronic
1148784453 17:50139212-50139234 GTGCGTGCATGTGTGTGTTGAGG - Intronic
1149455051 17:56780994-56781016 GTACTTACAGGGTTGTGATGAGG - Intergenic
1149485642 17:57040705-57040727 ATACTTGGCTGGCTGTGCTGTGG - Intergenic
1150521668 17:65873596-65873618 GAACTTACTTAGGTGTGCTGGGG - Intronic
1152089428 17:78238616-78238638 GCATGTGCATGTGTGTGCTGGGG + Intronic
1152296555 17:79470519-79470541 TTAGATGCATGTGTGTGCTGAGG - Intronic
1153701247 18:7695429-7695451 TTGCTTACATGGGTTTGCTGGGG + Intronic
1156550927 18:38015770-38015792 GTTCTTGCATTAGTTTGCTGAGG + Intergenic
1157970086 18:52257250-52257272 GTACCTGGCTGGGTATGCTGTGG + Intergenic
1160172013 18:76562983-76563005 GTTCTGGCTTGGGTGAGCTGGGG + Intergenic
1161332067 19:3693156-3693178 GTGCTTTCCTGCGTGTGCTGTGG - Intronic
1164433755 19:28210372-28210394 GGGCTTGCATGGCAGTGCTGAGG - Intergenic
1166222915 19:41377047-41377069 GTACGTGTATGTGTGTGCTGGGG + Intronic
1167037336 19:47002087-47002109 AAACTTGCATGGCTGGGCTGTGG + Exonic
1168178152 19:54640534-54640556 GTTCCTGCATTGGTTTGCTGAGG + Intronic
1168193551 19:54757057-54757079 GTACGTCCCTGTGTGTGCTGGGG - Intronic
925087010 2:1116428-1116450 GCTCTTGCATGGGGGTGCTCTGG + Intronic
926233697 2:11023740-11023762 GGTCTTGCATGGGGGTTCTGCGG + Intergenic
926515031 2:13832856-13832878 GTTCTTGCATTAGTTTGCTGAGG - Intergenic
927669213 2:25054596-25054618 TTACTTGCATGGGTCAGGTGCGG - Intronic
927720163 2:25377333-25377355 GTACATGCAGGGCTGTGCAGGGG + Exonic
928165022 2:28964751-28964773 GTTCCTGCATTGGTTTGCTGAGG + Intronic
928507175 2:31965699-31965721 GTTCTTGCATTAGTTTGCTGAGG - Intronic
928693564 2:33825330-33825352 GTTCTTGCATTGGTTCGCTGAGG + Intergenic
931021410 2:58048118-58048140 AAAGTTGCATGGCTGTGCTGTGG + Intronic
932188497 2:69718644-69718666 GTGTATGCATGTGTGTGCTGTGG - Intronic
932908355 2:75779092-75779114 GTTCTTGCATTAGTTTGCTGAGG - Intergenic
933423952 2:82086573-82086595 GTCCAGGCATAGGTGTGCTGTGG - Intergenic
934989638 2:98912308-98912330 CTGCCTGCCTGGGTGTGCTGGGG + Intronic
935841692 2:107119325-107119347 TTAATTGCATGGGTGTGAAGTGG + Intergenic
936474222 2:112825410-112825432 GTACTTGCTTGGGTGTGGGGAGG + Intergenic
936488810 2:112951951-112951973 GTTCTTGCATTAGTTTGCTGAGG + Intergenic
936605272 2:113945906-113945928 GTTCTTGCACTGGTTTGCTGAGG + Intronic
937402585 2:121597767-121597789 GTACTTGCACTGGTGTGGTGTGG + Intronic
939022388 2:136974461-136974483 GTTCCTGCATTGGTTTGCTGAGG + Intronic
939100774 2:137892199-137892221 GTTGTTGCATGGGATTGCTGAGG - Intergenic
939649119 2:144740283-144740305 GTTCTTGCATTAGTTTGCTGAGG + Intergenic
940078673 2:149774118-149774140 GTTCTTGCATTAGTTTGCTGAGG + Intergenic
940865942 2:158817915-158817937 ATCCTGGCATGGATGTGCTGTGG + Intronic
942374065 2:175317941-175317963 GCATGTGCATGTGTGTGCTGAGG + Intergenic
942648789 2:178145179-178145201 GTTCTAGCATTGCTGTGCTGAGG + Intergenic
946491288 2:220151723-220151745 AGACTTGCATGGGTGGGGTGGGG + Intergenic
947100687 2:226618164-226618186 GTGCTTGTGTGAGTGTGCTGGGG - Intergenic
948075306 2:235161272-235161294 GTGGTTCCATGGGTGTGGTGGGG - Intergenic
948264018 2:236624584-236624606 GTGTTTGCATGGATCTGCTGAGG - Intergenic
1169526652 20:6435168-6435190 GTGCGTGGATGGGTGTGGTGGGG + Intergenic
1169604135 20:7296247-7296269 GTTCTTGCATTAGTTTGCTGAGG + Intergenic
1170909310 20:20548791-20548813 GTAATTACAGGTGTGTGCTGAGG - Intronic
1171507332 20:25648303-25648325 GTCCTTGCATAGGGGTGATGGGG - Intergenic
1172531055 20:35631684-35631706 TCACCTGGATGGGTGTGCTGGGG + Exonic
1175414187 20:58790753-58790775 GTACCTGCAGTGCTGTGCTGTGG - Intergenic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
1176035566 20:63034854-63034876 GACCTTGCATGCGTGTCCTGCGG - Intergenic
1177304678 21:19298018-19298040 GTTCTTGCATTGGTTTGCTGAGG - Intergenic
1178133979 21:29605328-29605350 GTTCCTGCATGAGTTTGCTGAGG + Intronic
1181807509 22:25383907-25383929 GTACCTGCAGGGGTGGGATGCGG - Intronic
1182584713 22:31338156-31338178 GTACTGGCCTGGGTGTGGTGGGG - Intronic
1183693118 22:39402454-39402476 GCATTTGCAAGGGTATGCTGGGG + Intronic
950462733 3:13135057-13135079 GTGCATGCAGGGGTCTGCTGAGG + Intergenic
952043222 3:29285220-29285242 GTACTTGCCGGGGTGGGGTGGGG + Intronic
953996330 3:47522770-47522792 GTACTTACAAGGGTGTGCTCAGG - Intergenic
954455239 3:50594575-50594597 GTAGTTGCAATGGTGAGCTGAGG + Intergenic
954569546 3:51629184-51629206 CTCCTTGCATGGGTATGGTGGGG + Intronic
956854201 3:73259867-73259889 GTACATGGGTGGGTGTGTTGGGG + Intergenic
958888194 3:99752695-99752717 GTACATGCATGTGTGTGTGGGGG - Intronic
959778416 3:110199298-110199320 CTGCTTGCATGTGTGTGCTCAGG + Intergenic
961519389 3:127457919-127457941 GCACGTGCATGTGTGTGTTGGGG - Intergenic
962236248 3:133710079-133710101 GTACTTGGATGGGAGAGATGAGG - Intergenic
962258057 3:133885619-133885641 GGCCTTCCATGGGTGTTCTGCGG - Intronic
962603479 3:137012484-137012506 GTACTTGTGTGTGTGTGTTGTGG + Intergenic
963339069 3:144012472-144012494 GTACTTGCAATGGTTTCCTGGGG - Intronic
964292496 3:155196813-155196835 GTACTTGCATGGCTAGGCTGAGG - Intergenic
966455083 3:180105713-180105735 GTCCTTGCATTAGTTTGCTGAGG - Intergenic
967767460 3:193296843-193296865 GTTCTTGCATTAGTTTGCTGAGG - Intronic
970146089 4:13037615-13037637 GTTCTTGCATGAGTTTGTTGAGG - Intergenic
971038428 4:22721930-22721952 ATACTTCAATGGCTGTGCTGGGG - Intergenic
973543623 4:51958734-51958756 GTTGTTGCAGGGGGGTGCTGGGG + Intergenic
976548824 4:86370662-86370684 CTACTTGCATGACTGTGTTGAGG - Intronic
976687091 4:87825949-87825971 GTTCCTGCATTGGTTTGCTGGGG + Intronic
981612700 4:146612562-146612584 GTTCTTGCATTAGTGTGCTAAGG - Intergenic
983473169 4:168182051-168182073 GTACTTGCATAAGTCTGATGTGG - Intronic
983755873 4:171335043-171335065 GTTCCTGCATGGGTTTGCTAAGG - Intergenic
984854490 4:184182736-184182758 GTCCTTGCATTTGTTTGCTGAGG - Intronic
987873601 5:23650545-23650567 TTAATTGGATGGATGTGCTGGGG - Intergenic
989129866 5:38096581-38096603 GTGCATGCATGTGTGTGCTGGGG + Intergenic
989681720 5:44037320-44037342 GTTCCTGCATTGGTTTGCTGAGG + Intergenic
995622659 5:114043809-114043831 GTTCTTGCATGAGTTTGCTAAGG - Intergenic
995835288 5:116394695-116394717 GAACTAGCTGGGGTGTGCTGGGG + Intronic
995900699 5:117062920-117062942 GTTCTTGCATTAGTTTGCTGAGG - Intergenic
995939735 5:117567316-117567338 GTTCCTGCATGAGTTTGCTGAGG - Intergenic
996900866 5:128539248-128539270 GTCCGTGCAGGGGTGTGCTCTGG + Intronic
997146004 5:131433855-131433877 GTAGTTGTATTGGTGTGGTGTGG - Intronic
997310496 5:132876201-132876223 GTACTGGGATGGGTGGGGTGGGG - Exonic
997370222 5:133354869-133354891 GTACATGCATGTGTGGGATGAGG + Intronic
997820337 5:137060327-137060349 GTTCTTGCATGAGTTTGCTTAGG - Intronic
997943142 5:138176605-138176627 GTGCTTGCTTGGGGGTGGTGAGG + Intronic
1001239739 5:170059177-170059199 CTACTTGCTGGGGTGGGCTGGGG - Intronic
1001660412 5:173387409-173387431 GTTCTTGCATTGGTTTGCTGAGG + Intergenic
1003902076 6:10663638-10663660 GTTCTTGCATTAGTTTGCTGTGG + Intergenic
1004012536 6:11703132-11703154 GCACTTGCATGGCTGGGCAGTGG + Intergenic
1005092672 6:22074680-22074702 GTTCTTGCATTAGTTTGCTGAGG - Intergenic
1005238563 6:23795536-23795558 GTTCCTGCATTAGTGTGCTGAGG - Intergenic
1007380411 6:41486828-41486850 GCAAGTGCATGTGTGTGCTGGGG + Intergenic
1008852208 6:56036005-56036027 GTTCTTGCATTAGTTTGCTGAGG + Intergenic
1009870952 6:69451574-69451596 GTACCTGCAGGCCTGTGCTGAGG + Intergenic
1010868630 6:81010873-81010895 TTGCTGGAATGGGTGTGCTGGGG + Intergenic
1011783196 6:90813554-90813576 GTTCTTGCATTAGTTTGCTGAGG + Intergenic
1012861022 6:104559622-104559644 GTGCATGCATGGGAGGGCTGAGG - Intergenic
1014397697 6:120946358-120946380 GTGCTTGCATGTGTGTGGTTGGG - Intergenic
1015000210 6:128205141-128205163 GTTCTTGCATTAGTTTGCTGAGG - Intronic
1016708191 6:147138259-147138281 GTACTTGCATTGGTTGGCTGGGG - Intergenic
1018788175 6:167124935-167124957 GTATTTGCATGTGTGTGCATGGG - Intronic
1022772100 7:33485022-33485044 GTTCTTGCATTAGTTTGCTGAGG - Intronic
1026618533 7:71929399-71929421 GTTCTTGCATTAGTTTGCTGAGG + Intronic
1028910466 7:96202146-96202168 TTACTAGCATGGGTATGCTTTGG + Intronic
1029184061 7:98725992-98726014 CTACTTGCAAGGGTGAGGTGGGG + Intergenic
1029791414 7:102846791-102846813 GTGCTTGCATAGGTGGCCTGTGG - Intronic
1032999141 7:137483708-137483730 GTTCTTGCATAAGTTTGCTGAGG + Intronic
1038845109 8:31221939-31221961 GTTCCTGCGTGGGTTTGCTGAGG - Intergenic
1041484839 8:58363828-58363850 GTTCTTGCATTAGTTTGCTGAGG + Intergenic
1042276555 8:67011237-67011259 GTACTTACATAGGGGTGCGGTGG + Intronic
1043846237 8:85167293-85167315 GTACCTGCATTAGTTTGCTGAGG - Intergenic
1045330704 8:101153512-101153534 ATAGTTGCAGGGGTGGGCTGAGG - Intergenic
1046632392 8:116634001-116634023 GCAGTTGCGTGGGTGTTCTGGGG - Intergenic
1047248241 8:123162436-123162458 ATGGTTGCCTGGGTGTGCTGGGG - Intergenic
1048931220 8:139316726-139316748 GTTGTTGCATGTGTGAGCTGAGG - Intergenic
1050095156 9:2057199-2057221 GTACTAGCATGGCTGGGCTCTGG + Intronic
1053410685 9:37914470-37914492 GCACGTGCATGTGTATGCTGGGG + Intronic
1056782704 9:89563257-89563279 GCACGTGCATAGGTGTGCTGAGG - Intergenic
1057221181 9:93258857-93258879 GTCCTTGCATGCAAGTGCTGTGG + Intronic
1059600860 9:115777091-115777113 GTTCCTGCATTAGTGTGCTGAGG - Intergenic
1061172642 9:128969442-128969464 GTCCTTGCATAAGTGTGCTTTGG + Exonic
1061202830 9:129147328-129147350 GTCCTGGCAGGGGTGTGGTGTGG + Intronic
1186408815 X:9327674-9327696 GTGCATGCATGCATGTGCTGTGG - Intergenic
1188634476 X:32411744-32411766 GTACTTGCCTGGGCTTCCTGAGG + Exonic
1189861912 X:45281236-45281258 GTTCTTGCATTGGTTTGCTTAGG + Intergenic
1193820923 X:86163698-86163720 GTTCTTGCATTGGTTTGCTGAGG + Intronic
1195093330 X:101484358-101484380 GTTGTTCCATGGGTGTGGTGAGG + Intronic
1196852259 X:119948588-119948610 GAACTTGCAGGTGTGTTCTGAGG + Intergenic
1199068220 X:143445194-143445216 GTTCCTGCATTAGTGTGCTGAGG + Intergenic
1201292249 Y:12432228-12432250 GTTCTTGCATAAGTTTGCTGAGG + Intergenic
1201743125 Y:17344455-17344477 GTACTTGGATTGGATTGCTGGGG + Intergenic