ID: 1120862456

View in Genome Browser
Species Human (GRCh38)
Location 14:89267067-89267089
Sequence CTGTAGGGAAGAAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1322
Summary {0: 1, 1: 0, 2: 10, 3: 122, 4: 1189}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120862456_1120862461 -9 Left 1120862456 14:89267067-89267089 CCTTCTTCCCTTCTTCCCTACAG 0: 1
1: 0
2: 10
3: 122
4: 1189
Right 1120862461 14:89267081-89267103 TCCCTACAGGAAAAAAGACAGGG 0: 1
1: 0
2: 2
3: 37
4: 320
1120862456_1120862466 25 Left 1120862456 14:89267067-89267089 CCTTCTTCCCTTCTTCCCTACAG 0: 1
1: 0
2: 10
3: 122
4: 1189
Right 1120862466 14:89267115-89267137 ATGTGTTTCAAGCAGTTGAGGGG 0: 1
1: 0
2: 3
3: 14
4: 174
1120862456_1120862460 -10 Left 1120862456 14:89267067-89267089 CCTTCTTCCCTTCTTCCCTACAG 0: 1
1: 0
2: 10
3: 122
4: 1189
Right 1120862460 14:89267080-89267102 TTCCCTACAGGAAAAAAGACAGG 0: 1
1: 0
2: 5
3: 19
4: 296
1120862456_1120862465 24 Left 1120862456 14:89267067-89267089 CCTTCTTCCCTTCTTCCCTACAG 0: 1
1: 0
2: 10
3: 122
4: 1189
Right 1120862465 14:89267114-89267136 AATGTGTTTCAAGCAGTTGAGGG 0: 1
1: 0
2: 1
3: 15
4: 209
1120862456_1120862464 23 Left 1120862456 14:89267067-89267089 CCTTCTTCCCTTCTTCCCTACAG 0: 1
1: 0
2: 10
3: 122
4: 1189
Right 1120862464 14:89267113-89267135 AAATGTGTTTCAAGCAGTTGAGG 0: 1
1: 1
2: 1
3: 32
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120862456 Original CRISPR CTGTAGGGAAGAAGGGAAGA AGG (reversed) Intronic
900148265 1:1167603-1167625 CTGTCCGGCAGGAGGGAAGATGG - Intergenic
900391504 1:2435959-2435981 GAGGAGGGAAGAAGGGAGGAGGG - Intronic
900391625 1:2436320-2436342 GTGGAGGGAGGAAGGGAGGAGGG - Intronic
900391645 1:2436373-2436395 GTGGAGGGAGGAAGGGAGGAGGG - Intronic
900391668 1:2436440-2436462 GTGGAGGGAGGAAGGGAGGAAGG - Intronic
900391702 1:2436539-2436561 GTGGAGGGAGGAAGGGAGGAGGG - Intronic
900391718 1:2436583-2436605 TTGGAGGGAGGAAGGGAGGAGGG - Intronic
900433313 1:2612936-2612958 CTGAATGGAAGGAGGGAACAGGG + Intronic
900512327 1:3066617-3066639 CCCTAGGGAAGAAGGGCAGGAGG - Intergenic
900767203 1:4513441-4513463 CTGAAGGGAAGTGGGGCAGATGG - Intergenic
900926747 1:5710750-5710772 AGGAAGGGAAGGAGGGAAGAGGG + Intergenic
900993296 1:6107634-6107656 ATGGAGGGATGAAGGGATGATGG + Intronic
900993567 1:6108715-6108737 ATGAAGGGAAGGAGGGATGATGG + Intronic
901267589 1:7923485-7923507 CTCTAGGGAAGGAAGGAGGATGG - Intronic
901419753 1:9143004-9143026 CAGGAGGGAGGGAGGGAAGAAGG - Intergenic
901491436 1:9598290-9598312 CTGTTGGGCAGAGGGGAAGCAGG + Intronic
902053405 1:13581720-13581742 CTGAGGGGAAGAGGGAAAGAAGG - Intergenic
902070247 1:13728498-13728520 CTGTGGGGAAGAAGGGAGGGAGG + Intronic
902439184 1:16418159-16418181 CTGTGGGGGAGAAGAGGAGAGGG - Intronic
902632940 1:17716464-17716486 GTGAAGGGAGGCAGGGAAGAAGG + Intergenic
902665631 1:17935745-17935767 AGGGAGGGAAGAAGGCAAGAAGG - Intergenic
902692591 1:18119128-18119150 GGGAAGGGAAGAAGGGAGGAAGG - Intronic
903002398 1:20275569-20275591 CTGAGGGGAGGAGGGGAAGAGGG + Intergenic
903033595 1:20480473-20480495 CTGTTGGGAAGCAGGGAGTATGG - Intergenic
903130968 1:21279333-21279355 CTGCAGGGAAGGAGGCAGGAGGG + Intronic
903185057 1:21624178-21624200 CTGTAGGGAGGAGGGAAGGAGGG + Intronic
903359943 1:22770744-22770766 CTGCAGGAAGGAAGGGATGAAGG + Intronic
903576493 1:24342671-24342693 CTGCAGGGGAGAAGGAGAGAGGG - Intronic
903610614 1:24608997-24609019 TTGGAGGGAAGAAGGGGAGATGG + Exonic
903764163 1:25722780-25722802 ATGTGGGGCAGAAGAGAAGATGG + Intronic
903799453 1:25955660-25955682 AGGGAGGGAGGAAGGGAAGAGGG + Intergenic
903840036 1:26232577-26232599 CTGAAAGAAAGAAGGAAAGAAGG - Intergenic
903974483 1:27140279-27140301 CTGTACTGAAGATGGAAAGATGG - Intronic
904311583 1:29632781-29632803 CTGGAGGGCTGAGGGGAAGAGGG - Intergenic
904424831 1:30416544-30416566 CTGTGGGGAAGATGGGGAGCAGG + Intergenic
904573074 1:31482525-31482547 CTGTGGGGAATAAGGGAGAAAGG + Intergenic
904591777 1:31619028-31619050 CTGAAGGGAGGAAGGAAAGGAGG - Exonic
904676545 1:32202150-32202172 CTGTAGAGAGGAAGGCAAGGGGG + Intronic
905199707 1:36307407-36307429 CGGGAGGGAAGGAGGGAGGAAGG + Intronic
905203037 1:36326651-36326673 CTGTGGGCAAGAAGGGGAGCAGG + Intronic
905481928 1:38267802-38267824 ATGGAGGGAGGAAGGGAAGGAGG - Intergenic
906065600 1:42978258-42978280 CTGTTGGGAAGAAGGAAGGAAGG - Intergenic
906324587 1:44837182-44837204 AGGAAAGGAAGAAGGGAAGAAGG - Intronic
906382757 1:45343189-45343211 ACGTAGGGAAAAACGGAAGAGGG + Exonic
906558917 1:46739566-46739588 AAGGAGGGAAGGAGGGAAGAAGG - Intergenic
906580238 1:46930012-46930034 CAGGTGGGAAGAAGGGAAGGTGG + Exonic
906603487 1:47148878-47148900 CAGGTGGGAAGAAGGGAAGGTGG - Exonic
906637818 1:47421381-47421403 CTGTAGGGAAGCAGGGAAGGTGG + Intergenic
906659376 1:47571700-47571722 ATGGAGGGAGGGAGGGAAGAAGG - Intergenic
907424846 1:54373146-54373168 CTGGAGGGGAAGAGGGAAGAAGG - Intronic
907756399 1:57314834-57314856 CAGACGGGAAGAAGGGAAGGAGG + Intronic
907789272 1:57646017-57646039 CTAAAGGGAAGAACTGAAGAAGG + Intronic
907981763 1:59489360-59489382 GTAGAGGGAAGAGGGGAAGAGGG - Intronic
908032052 1:60011424-60011446 AGGGAGGGAAGAAGGGAGGAAGG - Intronic
908190383 1:61697341-61697363 AGGAAGGGAAGAAGGAAAGAAGG - Intronic
908218768 1:61982046-61982068 CTGCAGGGGAGAAGGGAGGGAGG + Intronic
908262433 1:62349480-62349502 TTGTGGGGGAGAAGTGAAGAGGG + Intergenic
908462314 1:64357414-64357436 CTGGAGGGAATAAAGGAAGAAGG - Intergenic
908815100 1:68023630-68023652 CTGTAAGGAAGGAGGAACGAAGG + Intergenic
908843426 1:68300787-68300809 ATGGAGGAAAGAAGGGAAGGAGG - Intergenic
908858792 1:68459858-68459880 AGGAAGGGAAGAAGGGAGGAAGG - Intergenic
908858795 1:68459866-68459888 AGGAAGGGAGGAAGGGAAGAAGG - Intergenic
909893607 1:81037730-81037752 CTATAGGGAAAAATGGAACAAGG - Intergenic
910274270 1:85431538-85431560 AAGGAGGGAAGAAGGAAAGAAGG - Intronic
910410385 1:86937251-86937273 CTGGAAGGAAGGAGGGAGGAAGG - Intronic
910535693 1:88295114-88295136 CTGAAGGAAAGAAGGAAGGAAGG - Intergenic
910799380 1:91130535-91130557 ATGTAGGGAAGAGGGAAAGAGGG - Intergenic
910867124 1:91798851-91798873 CTGTAGGGAATAAGGGAAATAGG + Intronic
911250550 1:95571657-95571679 CAAAAGGGAAGAAGGGCAGAAGG - Intergenic
911708590 1:101043040-101043062 AGGGAGGGAAGAAGGGAGGAAGG - Intergenic
912184939 1:107264112-107264134 CTACAGGCAAGAAGGAAAGATGG - Intronic
912261944 1:108119615-108119637 TTGAAGGGAAGAAGGGGAGGAGG - Intergenic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912967361 1:114248308-114248330 GTCTGGGGAAGAAGGAAAGAAGG - Intergenic
913361579 1:117986839-117986861 CTTCAGGGAAGAAGAGCAGAGGG - Intronic
913502038 1:119480335-119480357 AGGGAGGGAAGGAGGGAAGAAGG + Intergenic
913502039 1:119480343-119480365 AAGGAGGGAAGAAGGAAAGAAGG + Intergenic
913555559 1:119963149-119963171 AGGAAGGGAAGAAGGGAAGAAGG + Intronic
913708728 1:121456384-121456406 ATGGAGGGAAAAAGGGATGAAGG + Intergenic
914000910 1:143693458-143693480 CTTCAGGGAAGAAGGGCAGGGGG - Intergenic
914197857 1:145459194-145459216 AAGGAGGGAAGAAGGGAAGGAGG + Intergenic
914476960 1:148032318-148032340 AAGGAGGGAAGAAGGGAAGGAGG + Intergenic
914513765 1:148356065-148356087 CTTTGGGGAAGAAGGGCAGGGGG - Intergenic
914876683 1:151517477-151517499 TTGGTGGGAGGAAGGGAAGAAGG + Intronic
914963102 1:152224331-152224353 CTGTAAGGAAGTCAGGAAGAAGG - Intergenic
915393090 1:155562191-155562213 GTGCAGGGAAGTGGGGAAGAGGG + Exonic
915459460 1:156061168-156061190 CTGTAAGGAAGCAGAGAGGACGG - Exonic
915977275 1:160399854-160399876 CCTTAGGGAAGAAGGGGAGGAGG - Intergenic
916228453 1:162514596-162514618 TTGTAGGAAGGAAGGAAAGAAGG + Intronic
916385994 1:164270990-164271012 CTGTATCCAAGGAGGGAAGAGGG - Intergenic
916417360 1:164604934-164604956 CTCTATGGAATAAAGGAAGATGG - Intronic
916510323 1:165467504-165467526 CTGAAGGGAGGAGGGAAAGAGGG + Intergenic
916816316 1:168356614-168356636 AGGGAGGGAAGAAGGAAAGAAGG - Intergenic
917149912 1:171932087-171932109 AGGAAGGGAAGAAGGGAGGAAGG - Intronic
917149915 1:171932095-171932117 AGGAAGGGAGGAAGGGAAGAAGG - Intronic
917234160 1:172872862-172872884 GGGGAGGGAAGGAGGGAAGAAGG - Intergenic
917509969 1:175661805-175661827 TTGGAGGGAAGAAGAGAAAAGGG - Intronic
917662430 1:177190486-177190508 CTGTTTTGGAGAAGGGAAGAAGG - Intronic
917806569 1:178618948-178618970 AGGGAGGGAAGAAGGGAGGAAGG + Intergenic
917908854 1:179618911-179618933 CTATTGGGATGAGGGGAAGAAGG - Intronic
918502853 1:185217600-185217622 CTCTAGAGAGGAAGGGAGGAAGG - Intronic
918920912 1:190708706-190708728 AGGTAGGGAAGAAGGGAGGGGGG - Intergenic
919348021 1:196411117-196411139 AGGTAGGAAAGAAGGGAGGAAGG - Intronic
919613137 1:199771979-199772001 AGGAAGGGAAGAAGGGAAGAAGG + Intergenic
919710297 1:200720950-200720972 AGGAAGGGAGGAAGGGAAGAAGG - Intergenic
919739939 1:200975317-200975339 GGGTAGGGAAGAAGGGAGGATGG + Intronic
920355160 1:205366587-205366609 CTGAAAGGAAAAAGGGAGGATGG - Intergenic
920604115 1:207363347-207363369 GTGTAGGGAAGGAGGCAAGGAGG - Intergenic
920684934 1:208102171-208102193 CTGGAGGGAGGGAGGGAAGCTGG - Intronic
920746904 1:208637615-208637637 CCATAGGGGAGAAGGGAAGTGGG - Intergenic
921026930 1:211293169-211293191 CTGTAGGAATGAAGGAAGGATGG - Intronic
921672220 1:217938245-217938267 CTGTTTGGAAGAGGGGAAAAAGG - Intergenic
922004917 1:221520511-221520533 CTTTAGGGAAGAAAGAAGGAAGG - Intergenic
922070636 1:222189285-222189307 AAGAAGGAAAGAAGGGAAGAAGG + Intergenic
922070638 1:222189301-222189323 AAGAAGGGAAGAAGAGAAGAAGG + Intergenic
922070640 1:222189309-222189331 AAGAAGAGAAGAAGGGAAGAAGG + Intergenic
922093967 1:222425085-222425107 CTGTAGGCTAGAAGAGAAGGAGG - Intergenic
922341687 1:224661926-224661948 CTGGCGGGAAGCAGGGAAGGTGG + Intronic
922907754 1:229187711-229187733 CTGTAGGGATGAAGAGAAGTAGG - Intergenic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
922946790 1:229523247-229523269 CTGGAGGAAAGGAGGGAGGATGG - Intronic
923210510 1:231799900-231799922 AGGAAGGGAAGAAGGGAGGAAGG - Intronic
923349710 1:233092172-233092194 GTGTTGAGAAGAATGGAAGAGGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923480647 1:234379986-234380008 CTGTAACAAAGAAGGGAAGCAGG + Intronic
923512866 1:234667729-234667751 CTGATGGAAAGAAGAGAAGAGGG - Intergenic
923784464 1:237054188-237054210 AGGGAGGAAAGAAGGGAAGAAGG - Intronic
924287273 1:242500675-242500697 GGGAAGGGAAGAAGAGAAGAAGG + Intronic
924638156 1:245808382-245808404 TTGAAAGGAAAAAGGGAAGAGGG + Intronic
1063494477 10:6494269-6494291 CTGTTGGCAGGAAGCGAAGAGGG - Intronic
1064138270 10:12768934-12768956 CTGTAGTGAAGACAGGAACACGG + Intronic
1064868848 10:19914120-19914142 AGGTAGGGAGGAAGGAAAGAAGG + Intronic
1064871571 10:19943660-19943682 CTTTAGGGTACAAGGGAAAAGGG - Intronic
1065169843 10:23015835-23015857 TTGTAGAAAAGAAGGTAAGAAGG - Intronic
1065203072 10:23331681-23331703 GGGAAGGGAAGAAGGGAAGGGGG + Intronic
1065264465 10:23960234-23960256 CTGCAGGGGAGAAGGGAAGGAGG + Intronic
1065838047 10:29677165-29677187 CTGAAGGCAAAAAGGGAAGGGGG - Intronic
1065885374 10:30072143-30072165 GGGAAGGGAAGAAGGGAGGAGGG + Intronic
1066021063 10:31302715-31302737 AGGGAGGGAAGAAGGGAGGATGG - Intergenic
1066059566 10:31709775-31709797 CTGTCTGTAAGAAGGGATGAAGG - Intergenic
1066136035 10:32446934-32446956 AGGGAGGGAGGAAGGGAAGAGGG - Intronic
1066359866 10:34719673-34719695 TTGGAGGGGAGAAGGAAAGAGGG - Intronic
1066423164 10:35280375-35280397 AAGAAGGGAAGAAAGGAAGAAGG + Intronic
1066444469 10:35469450-35469472 GGGGAGGGAAGAAGGGAAAACGG + Intronic
1066752376 10:38671105-38671127 GGGAAGGGAAGAAGGGAAAAAGG + Intergenic
1066964649 10:42251941-42251963 GGGAAGGGAAGAAGGGAAAAAGG - Intergenic
1067191052 10:44068727-44068749 CTTTAGGGAAGAAGGACACAGGG + Intergenic
1067284949 10:44900993-44901015 GTGTTAGGAAGATGGGAAGAGGG - Intergenic
1068543132 10:58318673-58318695 CTGGAGAGAGGAAAGGAAGAAGG - Intergenic
1069457069 10:68561404-68561426 GATCAGGGAAGAAGGGAAGAGGG + Intronic
1069601447 10:69710801-69710823 CTGGAGGGGAGAAGGGCAGGGGG - Intergenic
1069659851 10:70116500-70116522 CTGTTGGGAAGAAAGGGGGAAGG + Intronic
1070150702 10:73803132-73803154 CTGAAGGGAAGAAGAGGGGAAGG + Intronic
1070597904 10:77845589-77845611 ATGGAGGGAAGGAGGGAAGAAGG + Intronic
1070603669 10:77883280-77883302 AGGTAGGGAAGAATGGAGGATGG + Intronic
1070681326 10:78451408-78451430 CTACAGGGAAGAAGGAGAGAGGG - Intergenic
1070694116 10:78549097-78549119 CTGAGAGGTAGAAGGGAAGAAGG + Intergenic
1070789292 10:79180098-79180120 GTGGAGAGAACAAGGGAAGAGGG + Intronic
1071004320 10:80864882-80864904 CAGGAGGGAAGAAGGCAAAATGG - Intergenic
1071141263 10:82511754-82511776 CTGTAGTGAACAAGGGAAAGGGG + Intronic
1071250937 10:83818944-83818966 TTGGAGGAGAGAAGGGAAGAAGG - Intergenic
1071396490 10:85228746-85228768 CTTAATGGAAGAAGGGAACAAGG - Intergenic
1071685365 10:87749274-87749296 CTTTAGGATAGAAGGGAAGGAGG - Intergenic
1071720941 10:88145606-88145628 AGGGAGGGAAGAAGGGAAAAAGG - Intergenic
1071856104 10:89626047-89626069 CTGTAGGCATGAAGGGGAGAAGG - Intronic
1071966680 10:90858519-90858541 CTTATGGGAAGAAGCGAAGATGG + Intergenic
1071968180 10:90874075-90874097 TTTGAGGGAGGAAGGGAAGAAGG + Intronic
1072591915 10:96833754-96833776 CTGTCGGGAAGGAGGGAATGAGG - Intronic
1073074918 10:100817752-100817774 CTCTAGGGCAGAAGGGACTATGG - Intronic
1073075940 10:100825980-100826002 CTGCAGGGAGGTGGGGAAGAGGG + Intronic
1073169332 10:101490196-101490218 AGGGAGGGAAGAAGGGAGGAAGG - Intronic
1073218094 10:101847798-101847820 CAGCAGGGAAGGAGAGAAGAGGG + Intronic
1073349721 10:102810961-102810983 ATGAAGGGAGGGAGGGAAGAAGG - Intronic
1073459502 10:103658541-103658563 GTGGAGGGGAGAAAGGAAGAGGG - Intronic
1073583154 10:104685821-104685843 TTGTGGGGACAAAGGGAAGAGGG - Intronic
1073603029 10:104865225-104865247 CTGTGTGAAAGAAGGAAAGAAGG + Intronic
1073662650 10:105493877-105493899 AGGAAGGGAAGGAGGGAAGAAGG + Intergenic
1073666508 10:105540189-105540211 TTGAAAGGAAGAAGGAAAGAAGG - Intergenic
1074195413 10:111180279-111180301 AGGAAGGGAAGAAGGAAAGAAGG - Intergenic
1074210654 10:111331050-111331072 AGGAAGGGAAGAAGGGAAGAAGG - Intergenic
1074210656 10:111331058-111331080 CAGGAGGTAGGAAGGGAAGAAGG - Intergenic
1074326398 10:112455357-112455379 AAGAAGGGAAGAAGGGAAGGGGG - Intronic
1074326403 10:112455365-112455387 AAGGAGGGAAGAAGGGAAGAAGG - Intronic
1074326405 10:112455373-112455395 AAGGAGGGAAGGAGGGAAGAAGG - Intronic
1074326426 10:112455420-112455442 AAGGAGGGAAGAAGGGAAGGGGG - Intronic
1074326431 10:112455428-112455450 AAGGAGGGAAGGAGGGAAGAAGG - Intronic
1074615876 10:115067790-115067812 AAGGAGGGAAGAAAGGAAGAAGG + Intergenic
1074749134 10:116567011-116567033 AGGGAGGGAGGAAGGGAAGAAGG - Intronic
1074813752 10:117129600-117129622 CTGAAGGGAAGAAGTTAAAAGGG + Intronic
1074866548 10:117547276-117547298 CTGTTTAGAAGGAGGGAAGAGGG + Intronic
1074908566 10:117886663-117886685 CTGTGTGGAAGAAGGAAAAAAGG - Intergenic
1075947794 10:126453346-126453368 CCAAAGTGAAGAAGGGAAGAAGG + Intronic
1076454345 10:130579044-130579066 CTGGAGGGAAGCAGGAAAGAGGG - Intergenic
1076513033 10:131025662-131025684 CTGGAGGGAAGAAAGCATGAGGG + Intergenic
1076558765 10:131347277-131347299 ATGAAGGATAGAAGGGAAGAAGG - Intergenic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077269590 11:1669224-1669246 CTGTGGGGCACACGGGAAGAGGG + Intergenic
1077498090 11:2896428-2896450 CTGGAGGCAGGAAGGGACGATGG - Intronic
1078029042 11:7729752-7729774 AGGAAGGGAGGAAGGGAAGAAGG + Intergenic
1078096023 11:8297877-8297899 TTGAAGGGAATAAGGGGAGAAGG + Intergenic
1078337108 11:10473365-10473387 CTTTAGGGAGGAAGGGCAGCTGG + Intronic
1078552556 11:12290494-12290516 GTGCAAGGAGGAAGGGAAGAAGG + Intronic
1078615095 11:12857437-12857459 GTGTAAGGCAGAAAGGAAGACGG + Intronic
1078633988 11:13031712-13031734 TTATAAGGAAGAAGGGAAAAAGG - Intergenic
1078689261 11:13562612-13562634 CAGTGGGGAAGTAGGGAAGTGGG - Intergenic
1079069579 11:17332400-17332422 TACTAAGGAAGAAGGGAAGAGGG + Intronic
1079282170 11:19097378-19097400 ATGTAGGGAACAGGGGAAGAAGG + Intergenic
1079321060 11:19451731-19451753 TAGCAGGAAAGAAGGGAAGAGGG + Intronic
1079614812 11:22479214-22479236 ATGGAGGGTAGAAGGAAAGATGG + Intergenic
1079928223 11:26523103-26523125 CAGTAGAGAAGAAATGAAGAAGG + Intronic
1080156514 11:29117804-29117826 AAGGAGGGACGAAGGGAAGAAGG + Intergenic
1080156516 11:29117812-29117834 ACGAAGGGAAGAAGGGACGAAGG + Intergenic
1080156518 11:29117820-29117842 AAGAAGGGACGAAGGGAAGAAGG + Intergenic
1080545098 11:33309269-33309291 AAGGAGGGAAGGAGGGAAGAAGG - Intronic
1081166848 11:39818360-39818382 CTGAAGTGAAGAAGGGACAAAGG - Intergenic
1081745772 11:45471383-45471405 GTGGAGGGAAGAGGGGAAGGTGG - Intergenic
1082728246 11:56763590-56763612 CAGAAGGAAAGAAGGGAGGAAGG - Intergenic
1082791269 11:57348084-57348106 CTGATGGGGGGAAGGGAAGAGGG + Intronic
1082803972 11:57435232-57435254 CTGGAGGGTGGAAGGGAAGCAGG - Intergenic
1083299175 11:61731266-61731288 CTGTAGGCAGGAAGGGCAGGAGG + Intronic
1083413876 11:62512849-62512871 CTGTTAGGAAGAAGGAAGGAAGG + Intronic
1083651596 11:64207704-64207726 CAGAAGGGAGGGAGGGAAGAGGG - Intronic
1083831209 11:65234951-65234973 CAGAAGGGAGGAAAGGAAGAAGG - Intergenic
1083850024 11:65359943-65359965 CTGTAGGGAGGCAGGGGAGAAGG - Intergenic
1083854152 11:65384112-65384134 CTGTAGGGAAGTGGGAATGAGGG - Intergenic
1084110838 11:67013407-67013429 CTGCAGGGAGAAAGGGGAGAAGG - Intronic
1085002941 11:73057526-73057548 CAGAAGGGAAGAAGAGAGGAAGG + Intronic
1085127999 11:74014999-74015021 GTCTAGGCTAGAAGGGAAGAAGG + Intronic
1085446341 11:76603567-76603589 AGGAAGGGAGGAAGGGAAGAAGG + Intergenic
1085540537 11:77264441-77264463 TTAAAGGCAAGAAGGGAAGAAGG + Intronic
1085705579 11:78784365-78784387 CTGTAGGATATAAGGGAAGGGGG - Intronic
1086295152 11:85358104-85358126 CAGAAGGGAAGAAGAGAAGAAGG + Intronic
1086345372 11:85890694-85890716 CTGAAGGGAAGAGGGAAACATGG - Intronic
1086803878 11:91214743-91214765 AGGGAGGGAAGGAGGGAAGAAGG + Intergenic
1087002084 11:93431380-93431402 CTGGAGCTTAGAAGGGAAGAGGG + Intronic
1087237362 11:95734848-95734870 AGGAAGGGAAGAAGGGAGGAAGG + Intergenic
1087346535 11:96978717-96978739 CTGTTGGGAAAAAGGGAAGGTGG - Intergenic
1087417015 11:97870285-97870307 CAATAGGGAGGAAGGAAAGAAGG - Intergenic
1088063376 11:105685112-105685134 CTTTAGGAAGGAAGGAAAGAAGG + Intronic
1088108570 11:106233640-106233662 CTGTAGAGCAGAAAAGAAGATGG - Intergenic
1088217595 11:107529947-107529969 CTGTAGGGAACTAGAGAAGTAGG + Intronic
1088544886 11:110949155-110949177 ATGGAGGAAAGAAGGAAAGAGGG - Intergenic
1088824576 11:113483019-113483041 ATGTATGGATGCAGGGAAGAGGG - Intergenic
1088889922 11:114036317-114036339 CTGGAGGCCAGAAGGGGAGAAGG - Intergenic
1089032800 11:115350382-115350404 TTAAAGGGAAGGAGGGAAGAAGG + Intronic
1089548588 11:119251154-119251176 AGGTAGGGAGTAAGGGAAGAAGG - Intronic
1089733734 11:120535387-120535409 AGGGAGGGAAGGAGGGAAGAAGG + Intronic
1090089407 11:123681655-123681677 CTGTAGAGAACAAGGGATGGGGG + Intergenic
1090234965 11:125140351-125140373 CTGAAAGGAAGTAGGGAAGTGGG - Intergenic
1090235090 11:125141083-125141105 CTGGAAGGAAGTAGGGAAGTGGG + Intergenic
1090263296 11:125338193-125338215 GAGTAGGGAAGATGGGCAGAGGG - Intronic
1090440773 11:126723757-126723779 GAGAAGGGAAGAAGGAAAGATGG + Intronic
1090488023 11:127132217-127132239 AGGAAGGGAGGAAGGGAAGAAGG - Intergenic
1090552906 11:127842316-127842338 GTTTAGGGAGAAAGGGAAGAAGG - Intergenic
1090562572 11:127948211-127948233 CAGGAGAGAAAAAGGGAAGAAGG - Intergenic
1090617226 11:128526144-128526166 CAGGAGGGAAGAAGGGAGGGTGG + Intronic
1090623637 11:128585758-128585780 TTTTAGAGATGAAGGGAAGAAGG + Intronic
1090964407 11:131585440-131585462 CTGCAGGAAAGGAGGGTAGAGGG + Intronic
1091152386 11:133341007-133341029 CTGTGAAGAAGAAGAGAAGAAGG - Intronic
1091154426 11:133360610-133360632 GAGGAGGGAAGAAGGGAGGAGGG + Intronic
1091410547 12:236502-236524 CTGGAGGGAGGAAGGGAAGAGGG - Intronic
1091423001 12:359780-359802 AGGAAGGGATGAAGGGAAGAAGG + Intronic
1091423005 12:359788-359810 ATGAAGGGAAGAAGGGAGGGAGG + Intronic
1091751324 12:3022856-3022878 CTGAAGGGGAGTGGGGAAGAGGG - Intronic
1091893416 12:4081404-4081426 TAGTAAGGAAGAAGGGAAAATGG + Intergenic
1092045525 12:5430026-5430048 CTGGAGGGAGGAGGGGAAGGGGG - Intergenic
1092169382 12:6363711-6363733 CTGAAGGGGCGAGGGGAAGAGGG + Intronic
1092802022 12:12177959-12177981 ATACAGGGAAGAAGGAAAGAAGG + Intronic
1093475382 12:19548938-19548960 CTAAAAGGAGGAAGGGAAGAAGG - Intronic
1093905786 12:24690627-24690649 CTGGAGGGAAGCAGAGAGGATGG - Intergenic
1094008471 12:25781571-25781593 ATGTTGGGAAGGAGGGAGGAGGG - Intergenic
1094330380 12:29285536-29285558 AGGAAGGGAGGAAGGGAAGAAGG + Intronic
1094343999 12:29446253-29446275 TTGTAGGGATGAAAGGAAGGAGG + Intronic
1094615070 12:32029216-32029238 CTGTAGGAAAGAAAAGAAGGAGG + Intergenic
1094812449 12:34151689-34151711 ATGTTGGGAAGGAGGGCAGAGGG - Intergenic
1095116147 12:38354379-38354401 CAGTAGGGAAGAAGGGCCTAGGG + Intergenic
1095700925 12:45190087-45190109 AAGAAGGGAAGGAGGGAAGAAGG - Intergenic
1095813325 12:46394856-46394878 AAGTAAGGAAGAAGGGAGGAAGG + Intergenic
1096071886 12:48780066-48780088 CAGTGGGGGAGAAGGGAAGGGGG + Intronic
1096228492 12:49884287-49884309 GAGTAGGGAAGAAGGAGAGAGGG + Intronic
1096609547 12:52791817-52791839 CTGCAGAACAGAAGGGAAGATGG + Intronic
1096650678 12:53060652-53060674 CTGTAGGGTGGAAGGGCAGATGG - Intronic
1096792624 12:54054389-54054411 CGCTAGGGAAGAAGGGAGGGAGG - Intronic
1097059278 12:56270342-56270364 GTGTAGGGAAGTGGGGTAGAAGG - Exonic
1097070132 12:56348670-56348692 GTGTAGGGAAGGAGGGACGTGGG + Intronic
1097156153 12:57013670-57013692 CTCTAGGGAAGAAACAAAGAGGG + Exonic
1097207311 12:57333721-57333743 CTAGAGGGAAGGAGGGAGGAAGG + Intronic
1097608433 12:61785098-61785120 CAGGAGGGAAGGAGGGAATAGGG - Intronic
1098163125 12:67666703-67666725 ATGAAGGGAAGAAGGGAGGGAGG + Intergenic
1098469712 12:70829202-70829224 TTGAAGGAAAGAAGGAAAGAAGG + Intronic
1098547898 12:71731603-71731625 ATGAAGGGAGGAAGGGAGGAAGG + Intergenic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1099005780 12:77233244-77233266 ATGGAGGGAGGAAGGGAAGGAGG - Intergenic
1099533159 12:83812455-83812477 AGGGAGGGAAGAAGGAAAGAAGG - Intergenic
1099914067 12:88870072-88870094 CTGATGGGAAGAAAGGAGGAAGG - Intergenic
1100298058 12:93281056-93281078 CTACAGGGAAGAAGGGGTGAGGG + Intergenic
1100562386 12:95760927-95760949 CTTTAAGGAAGAAAGGGAGATGG - Intronic
1100726514 12:97414561-97414583 TTGGAGGGAGGAAGGGAGGAAGG - Intergenic
1100863744 12:98833732-98833754 GGGGAGGGAGGAAGGGAAGAAGG - Intronic
1101128532 12:101664664-101664686 CTGGAGGGAGGAAGAGGAGAGGG + Intronic
1101318847 12:103654734-103654756 CTCCAGGGAACAAAGGAAGATGG - Intronic
1101322162 12:103682148-103682170 CTGATGGGAAGATGGGAAGATGG + Intronic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101590297 12:106119542-106119564 CTGTAGGGAAGCTGGAAAAATGG + Intronic
1102052976 12:109876595-109876617 AGGAAGGGAAGAAGGGAGGAAGG + Intronic
1102107644 12:110339065-110339087 CTATAGAGAAAAAGGGAAGGGGG - Intronic
1102176044 12:110875752-110875774 CGTTAGGGATGAAGGGAAGAGGG - Intronic
1102448915 12:113026013-113026035 AGGTAGGGAAGAAGGAAGGAAGG - Intergenic
1102574864 12:113849934-113849956 CTGGAGGAAAGAGGGGAAGAGGG + Intronic
1102717363 12:114986094-114986116 AGGCAGGGAAGATGGGAAGAAGG - Intergenic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1103434635 12:120915259-120915281 GTGTGGGGAAGAGGGGATGAGGG + Intergenic
1104243092 12:127010141-127010163 CTGAAAGAAAGAAGGGAAGTAGG - Intergenic
1104299311 12:127549789-127549811 CAGGAGGGAAGAAGGGAGGGAGG - Intergenic
1104386492 12:128355671-128355693 AAGGAGGGAATAAGGGAAGAGGG - Intronic
1104510010 12:129368711-129368733 CTGTTGGTAAGGAGGAAAGAGGG - Intronic
1104632283 12:130413748-130413770 AGGGAGGGAAAAAGGGAAGAAGG - Intronic
1105662157 13:22508426-22508448 CTGGAGGAAAAATGGGAAGAAGG - Intergenic
1106286657 13:28323855-28323877 CTTTGGGGAAGGAGGGAACATGG + Intronic
1106976629 13:35225428-35225450 CTGTAGAGGAGATAGGAAGAAGG + Intronic
1107199328 13:37695171-37695193 AGGAAGGAAAGAAGGGAAGAAGG - Intronic
1107410721 13:40156035-40156057 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
1107795310 13:44045761-44045783 GTGCAGGGAACATGGGAAGAGGG - Intergenic
1107939188 13:45369404-45369426 CTTTAGGGAGGAAGAGTAGAAGG - Intergenic
1107993342 13:45837610-45837632 AGGGAGGGAGGAAGGGAAGAAGG + Intronic
1108118335 13:47155252-47155274 GTGTAGGGAAGAAGGTAACTAGG - Intergenic
1108255354 13:48604543-48604565 CTGTAGGGGAGAAGTGGGGAAGG - Intergenic
1108822334 13:54368646-54368668 AAGGAGGGAAGGAGGGAAGAAGG + Intergenic
1108822337 13:54368654-54368676 AAGGAGGGAAGAAGGGAAGGAGG + Intergenic
1108822342 13:54368670-54368692 AAGGAGGGAAGGAGGGAAGAAGG + Intergenic
1108829116 13:54454398-54454420 CTGAAGGGTAGAAAGGAAAAAGG + Intergenic
1109624861 13:64961893-64961915 ATTTAGGAAAGGAGGGAAGATGG + Intergenic
1109759849 13:66813456-66813478 TGGGAGGGAGGAAGGGAAGAAGG + Intronic
1110136210 13:72070639-72070661 CTGTAGGCAAGCAGGCAGGAAGG + Intergenic
1110303934 13:73962574-73962596 GTGTAGGGATGAGGGGTAGATGG + Intronic
1110420731 13:75304787-75304809 ATGTAGAGAAGTAAGGAAGAAGG + Intronic
1110466287 13:75806024-75806046 ATGAAGAAAAGAAGGGAAGAGGG - Intronic
1110641307 13:77827912-77827934 CTGATGAGAAGAAGGGAAGTGGG + Intergenic
1110843975 13:80173145-80173167 AGGGAGGGAAGAAGGGAGGAAGG + Intergenic
1111005189 13:82238624-82238646 CAGAAGGGAGGAAAGGAAGAAGG - Intergenic
1111435964 13:88208488-88208510 CTGTAAGGAACAGGGTAAGAGGG + Intergenic
1111501437 13:89126063-89126085 CTGTGGGGAAGCAGAGAGGAAGG + Intergenic
1111647701 13:91051449-91051471 GTGAAGGAAAGCAGGGAAGAGGG - Intergenic
1111694653 13:91608136-91608158 GTGTAGGGTAGATGGGAATATGG + Intronic
1111766590 13:92538395-92538417 AGGTAGGGAAGAAGGAATGAAGG - Intronic
1111855730 13:93634700-93634722 CAGTAGGAAAGGAAGGAAGAAGG + Intronic
1111926338 13:94467324-94467346 CTGTTATGAAAAAGGGAAGAAGG - Intronic
1111997380 13:95178092-95178114 CTGTATGGACAAAGGAAAGAAGG + Intronic
1112164586 13:96904505-96904527 CTGCAGGGAAGAGGGGGACAGGG + Intergenic
1112387786 13:98956232-98956254 AAGTAGGGAAGAAGAGAATATGG + Intronic
1112924503 13:104657356-104657378 AGGGAGAGAAGAAGGGAAGAGGG - Intergenic
1113799343 13:113078340-113078362 CTGTTGGGAAGAAGGGGAGCGGG - Intronic
1113849275 13:113408854-113408876 CTGCAGAGAGGAAGGGAGGAGGG + Intergenic
1114517398 14:23308793-23308815 CTGTGGGAGAGAAGGGAAGCAGG - Intronic
1114777343 14:25498685-25498707 GTGTAGGGGAGAAGGAGAGAGGG + Intergenic
1114798503 14:25743723-25743745 ATGAAGGAAAGAAGGAAAGAAGG - Intergenic
1115143431 14:30199639-30199661 CTGTGGGGAAGAAGGCAGGGTGG - Intergenic
1115644906 14:35362272-35362294 AAGAAGGGAAGGAGGGAAGAAGG - Intergenic
1115834026 14:37377274-37377296 CAGTAGGGGAGGAGGAAAGAGGG + Intronic
1116375836 14:44199544-44199566 AGGGAGGGAAGGAGGGAAGAGGG + Intergenic
1116378877 14:44239748-44239770 CAGGAGGAAGGAAGGGAAGAAGG - Intergenic
1116391299 14:44393500-44393522 CTGAAGGGAAGAATGGATGTTGG - Intergenic
1116711846 14:48378214-48378236 TGGTAGTGAAGTAGGGAAGAGGG + Intergenic
1116749382 14:48863892-48863914 CTGGAGGGCAGAGGGAAAGAAGG + Intergenic
1116785293 14:49281288-49281310 CAGTAGGGAGGAAAGGAAAAGGG + Intergenic
1117237648 14:53795311-53795333 CTGCAGGGAAGAAGAGGAAAGGG - Intergenic
1117275837 14:54192538-54192560 CTGTAAAGAAGAAGGGAAGCAGG + Intergenic
1117278402 14:54213049-54213071 CTGTCAGGAAGAAAGGAAAAAGG - Intergenic
1117857709 14:60052206-60052228 AGGGAGGGAAGAAGGGAAGAAGG + Intronic
1118384363 14:65243461-65243483 CTGGTGGGAACCAGGGAAGAGGG + Intergenic
1118438073 14:65789533-65789555 CAGAGGGGAAGAGGGGAAGAGGG - Intergenic
1119080579 14:71689837-71689859 CTGTAAGGAAGGAGGGAGGGAGG - Intronic
1119431207 14:74569149-74569171 ATGGAGGGAAGGAGGGAAGAAGG + Intronic
1119431209 14:74569157-74569179 AAGGAGGGAAGAAGGGAAGCAGG + Intronic
1119684837 14:76623352-76623374 ATGTGGAGAAGAAGGGAGGAGGG - Intergenic
1119895912 14:78219926-78219948 ATGGAGGGTAGAAGGGAAGAGGG + Intergenic
1120122966 14:80704761-80704783 CAATAAGGAAGAAGGGAAGGAGG - Intronic
1120228531 14:81818015-81818037 AGGGAGGGAAGAAAGGAAGAAGG - Intergenic
1120228539 14:81818046-81818068 AGGGAGGGAAGAAAGGAAGAAGG - Intergenic
1120393463 14:83938106-83938128 TAGTAGGGAAGAAAGGGAGAAGG + Intergenic
1120862456 14:89267067-89267089 CTGTAGGGAAGAAGGGAAGAAGG - Intronic
1121518063 14:94566947-94566969 CTGAAGGGAAGATGAAAAGAAGG - Intronic
1121797225 14:96745206-96745228 CTGTAGGGAAGGAGGGAGGCAGG - Intergenic
1121800173 14:96768575-96768597 ATGTAGGGAGGAAGGGAGGGAGG - Intergenic
1121930426 14:97966989-97967011 CTGTAGGGAAAATGGGGAGTAGG - Intronic
1121990851 14:98555747-98555769 AAGAAGGAAAGAAGGGAAGAAGG + Intergenic
1122012155 14:98759166-98759188 AGGGAGGGAGGAAGGGAAGAAGG - Intergenic
1122047233 14:99032908-99032930 CTCCAGGGAAGCTGGGAAGATGG + Intergenic
1122140952 14:99662755-99662777 ATGGAGGGAAGAAGGGAGGGAGG + Intronic
1122159837 14:99774786-99774808 CTGAAGGAAGGAAGGGCAGAAGG + Intronic
1122723351 14:103734664-103734686 CTTTGGTGATGAAGGGAAGAAGG + Exonic
1122973456 14:105161676-105161698 CCCTAGGGAAGAAGGGGAGCTGG - Intronic
1123434827 15:20247543-20247565 AAGGAGGGAAGAAGGGTAGATGG + Intergenic
1124098715 15:26673254-26673276 CTCTAAGGAAGAAGGAAGGAAGG - Intronic
1124367906 15:29087042-29087064 GTGAAGTGAAGAAGGCAAGATGG - Intronic
1124400462 15:29343489-29343511 CTGTAGGGCAGCAGGGAGGCTGG - Intronic
1124683178 15:31755122-31755144 ATGAAGGGAAGGTGGGAAGAGGG + Intronic
1124792812 15:32745839-32745861 CTTTATGGAAGGATGGAAGAGGG + Intergenic
1124914762 15:33959108-33959130 ATGCAGGGAAGTTGGGAAGATGG - Intronic
1125121234 15:36161151-36161173 CTGAAGGGAAGAAGGAAGGAAGG + Intergenic
1125259808 15:37810164-37810186 ATGTAGGGAAGAAGAGATCAGGG - Intergenic
1125281754 15:38049069-38049091 CTATAGAGAAGAGGGGAAGAAGG - Intergenic
1125873019 15:43119556-43119578 GTGAAGGGAAGAAGGGGAGAAGG + Intronic
1126058609 15:44756603-44756625 CTGTAGGGTGGAAAGGAATATGG + Intronic
1126370539 15:47941233-47941255 AAGAAGGGAAGAATGGAAGAAGG + Intergenic
1126430314 15:48576549-48576571 CTGGAGGAATGAAGGGAAGGTGG + Intronic
1126688883 15:51272152-51272174 CTGAAGGGAAAAATCGAAGATGG - Intronic
1126790214 15:52214124-52214146 AAGGAGGGAAGAAGGGAGGAGGG + Intronic
1127122800 15:55785997-55786019 CTGGAGAAAAGAAGGAAAGACGG + Intergenic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1127501593 15:59558959-59558981 CTGTAGGAAAGAAGGGATAGTGG - Intergenic
1127660804 15:61098268-61098290 AGGCAGGGAAGGAGGGAAGAAGG - Intronic
1128371305 15:67041342-67041364 AAGAAGGGAAGAAGGAAAGAAGG + Intergenic
1128458003 15:67843724-67843746 CCGGAGGGAAGGAGGGAGGAAGG + Intergenic
1128510001 15:68307540-68307562 CTGGAAGGAAGAAGGGAAAGGGG - Intronic
1128530860 15:68446603-68446625 CTGTTGGGAAGGAAGAAAGAAGG + Intergenic
1128612491 15:69085135-69085157 TTTCAGGGAAGAAGGGGAGAAGG - Intergenic
1128793525 15:70449547-70449569 ATGGAGGGAAGGAGGGAAGGAGG + Intergenic
1129180967 15:73875290-73875312 AAGGAGGGAAGGAGGGAAGAAGG + Intronic
1129300202 15:74621053-74621075 CAGGAGGGAGGCAGGGAAGAGGG - Intronic
1129302055 15:74631109-74631131 CTGAAGGGAAGATGAGAGGAGGG + Exonic
1129331479 15:74830107-74830129 CTGAAGGGAAGAGGGGAAGAGGG - Intronic
1129380114 15:75159492-75159514 CTATAGCAAAGAAGGGAGGAAGG - Intergenic
1129669056 15:77597079-77597101 CTGGAGGGAGGAAGGGAGGGAGG - Intergenic
1129766868 15:78175153-78175175 CTGTTGGACAGAAGGAAAGAAGG - Intronic
1129919302 15:79306230-79306252 ATTAAGGGAGGAAGGGAAGAAGG - Intergenic
1129930610 15:79407507-79407529 CTGGAGGCAATGAGGGAAGACGG + Intronic
1130054834 15:80513549-80513571 TTTTAGGAAAGAAGGGAAGAGGG - Intronic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1131009386 15:89004595-89004617 AGGGAGGGAAGAAGGGAAGGGGG - Intergenic
1131065612 15:89433393-89433415 TTGGAGGGAGGGAGGGAAGAAGG - Intergenic
1131850753 15:96541042-96541064 CGGGAGGGAAGAAGGAAGGAAGG + Intergenic
1132858528 16:2058236-2058258 GTGGAGGGGAGAAGGCAAGATGG - Intronic
1132880182 16:2158676-2158698 CTGCAGGGCAGAAGGAAGGAGGG + Intronic
1133048443 16:3102375-3102397 CTGCAGGGAAGAAGGGGAGATGG + Intergenic
1133668851 16:7997981-7998003 CTGTAGTGGAAAATGGAAGAGGG - Intergenic
1133691274 16:8217839-8217861 CTTTAGGTAAGTAGGGAAGGTGG + Intergenic
1133978586 16:10617568-10617590 GTGTAGGGGTGAAGGGAGGAGGG - Intergenic
1133985367 16:10664264-10664286 CTGCAGGGAGGGAAGGAAGAGGG + Intronic
1133997741 16:10761165-10761187 CTGTAGGGATGTAGGGATGATGG + Intronic
1134001629 16:10787437-10787459 CTGGAAAGGAGAAGGGAAGATGG - Intronic
1134444472 16:14320450-14320472 GCTTAGGGAAGAAGGGAAGAAGG - Intergenic
1134792472 16:17001741-17001763 CTTTAGGGAAGACAGAAAGAAGG - Intergenic
1135110177 16:19684577-19684599 CTGTAAGGATTAAGGGAAAAAGG - Intronic
1135166817 16:20146464-20146486 TTCTTGGGAAGAAGGAAAGAAGG + Intergenic
1135887700 16:26326480-26326502 AAGGAGGGAAGAAGGGAAGGAGG + Intergenic
1135992995 16:27228877-27228899 CTGTAGGGGAGGGTGGAAGAGGG - Intronic
1136050342 16:27645739-27645761 CGGTCAGGAAGAAGGGTAGAAGG + Intronic
1136285578 16:29238501-29238523 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
1136285582 16:29238509-29238531 AGGGAGGGAAGAAGGGAGGAGGG + Intergenic
1136470250 16:30474814-30474836 CTGTAGGGAAGAGATGAGGACGG + Intronic
1136575993 16:31125728-31125750 CTGTAGCTGAGAAGGGAGGAAGG - Intronic
1136619716 16:31420268-31420290 GTGTAGGGCTGAAGGCAAGAGGG + Intronic
1136730343 16:32405933-32405955 GGGAAGGGATGAAGGGAAGAAGG - Intergenic
1137342017 16:47617438-47617460 CTGGAGGGAGGAAAGAAAGAGGG - Intronic
1137737559 16:50736208-50736230 GTGTAGGGAACTAGGGAAGTAGG + Intergenic
1137774037 16:51040963-51040985 AGGGAGGGAAGAAGAGAAGAAGG + Intergenic
1138147325 16:54624429-54624451 GTGCAGGGAGGAGGGGAAGATGG + Intergenic
1138147912 16:54628653-54628675 CAGAAGGAAAGAAGGGAAGCAGG + Intergenic
1138264154 16:55647420-55647442 AAGGAGGGAAGGAGGGAAGACGG + Intergenic
1138376333 16:56566524-56566546 CGGAAGGAAAGAAGGAAAGAAGG + Intronic
1138746873 16:59373384-59373406 AAGAAGGGAGGAAGGGAAGAAGG - Intergenic
1139210036 16:65068033-65068055 AGGGAGGGAAGAAGGGAGGAAGG + Intronic
1139516489 16:67455256-67455278 GTTTAGAGAAGAAGGGAAGTGGG + Intronic
1139641443 16:68294525-68294547 CTGTAGGGAAGGGGGGAGCAGGG + Intronic
1139869058 16:70089436-70089458 AGGGAGGGAGGAAGGGAAGAAGG - Intergenic
1140231016 16:73117203-73117225 AAGAAGGGAAGGAGGGAAGAAGG - Intergenic
1140289696 16:73641594-73641616 ATGTAGGGAAGATGGGAGGGGGG + Intergenic
1140386318 16:74542695-74542717 AGGGAGGGAGGAAGGGAAGAAGG + Intronic
1140543761 16:75786019-75786041 ATGAAGGGAGGAAGGGAAGGAGG - Intergenic
1140866438 16:79066498-79066520 GGGAAGGGAAGAAGGGAGGAAGG + Intronic
1140868219 16:79082760-79082782 GTGTAGGGAAGATGGGAGGGAGG + Intronic
1141024925 16:80537484-80537506 ATGCAGGGAAGGAGGAAAGATGG + Intergenic
1141289652 16:82706043-82706065 GAATAAGGAAGAAGGGAAGAAGG - Intronic
1141401242 16:83748896-83748918 CTGTAGGGCACAAGGGCAGAAGG + Intronic
1141603943 16:85142525-85142547 CTGTGGGGGAGAGGGGAATAAGG - Intergenic
1141756242 16:85992977-85992999 CAGAAGGGAAGAAGGACAGAAGG - Intergenic
1141775757 16:86121741-86121763 GAGGAGGGAGGAAGGGAAGATGG - Intergenic
1141822820 16:86459353-86459375 CTGTCGGGATGAAGTGAAAATGG + Intergenic
1141845213 16:86603841-86603863 CAGGAGGAAAGAAGAGAAGAAGG - Intergenic
1141870263 16:86780547-86780569 GGGTCGGGAAGAAGGGAAGGCGG - Intergenic
1141992481 16:87618448-87618470 CTGTAGGACAGCAGGGACGATGG - Intronic
1142090911 16:88208653-88208675 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
1142090915 16:88208661-88208683 AGGGAGGGAAGAAGGGAGGAGGG + Intergenic
1202996057 16_KI270728v1_random:111374-111396 GGGAAGGGAAGAAGGGAAGAAGG + Intergenic
1203022744 16_KI270728v1_random:423716-423738 GGGAAGGGAAGAAGGGAAGAAGG + Intergenic
1142492055 17:285783-285805 CTGTAGGGGAGCAGGGGAGCAGG - Intronic
1142557502 17:789904-789926 CTGGAGGGGAGAAGGGAAAGGGG - Intronic
1142615702 17:1133719-1133741 AAGCAAGGAAGAAGGGAAGACGG - Intronic
1142958252 17:3535475-3535497 AAGGAGGGAAGAAGGGAGGAGGG - Intronic
1143032259 17:3974297-3974319 CTGTAGAGATGGAGGCAAGAGGG - Intergenic
1143539097 17:7558940-7558962 CAGTGGTGCAGAAGGGAAGAAGG - Exonic
1143624925 17:8104220-8104242 GTGTGGGGAGGAAGGGTAGAGGG + Intronic
1143847218 17:9781595-9781617 CTGTGGGGAAGAAGGAAACAGGG + Intronic
1144192155 17:12856401-12856423 CTGTAGGGAAGCAGAGAAGAAGG - Intronic
1144288790 17:13805755-13805777 AGGAAGGGAAGAAGGAAAGAAGG + Intergenic
1144336165 17:14270693-14270715 CTGGAGGGTAGAAGAGAAGCAGG + Intergenic
1144352896 17:14415801-14415823 ATGGAGGGAGGAAGGGAAGGAGG - Intergenic
1144433017 17:15212514-15212536 CTGCAGGGGTGAAGGGGAGATGG + Intergenic
1144590824 17:16522276-16522298 ATGTAGTGGAGAAGGGAAGCTGG + Intergenic
1145883007 17:28365317-28365339 CGGTGGGGAAGAAGGGAGGCTGG + Intronic
1146296443 17:31654088-31654110 CTGCAGGGAAAATGGGGAGATGG - Intergenic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1147131898 17:38414792-38414814 CTGTAGGGAAAAAGAGAGGAGGG + Intergenic
1147679103 17:42228392-42228414 CGGAAGGAAAGAAGGAAAGAAGG - Intronic
1147997191 17:44366785-44366807 ATGAAAAGAAGAAGGGAAGAAGG - Intergenic
1148131906 17:45267199-45267221 CTGCAGGGAAAAGTGGAAGATGG + Intronic
1148510837 17:48168292-48168314 CTTTTGGGAAAAAAGGAAGAAGG + Intronic
1148582617 17:48754087-48754109 AGGAAGGGAGGAAGGGAAGAAGG + Intergenic
1148693121 17:49544478-49544500 CTGGAGGGGAGAAGAGGAGATGG + Intergenic
1148757212 17:49979801-49979823 ATGTCGGGAAGTGGGGAAGAGGG - Intergenic
1148807708 17:50272551-50272573 CTGCAGGGGAGGAGGGGAGACGG + Intronic
1149881048 17:60290788-60290810 CTCTAGGGAGGGAGGGGAGAGGG + Intronic
1149939380 17:60846774-60846796 AGGGAGGGAAGAAGGAAAGAAGG - Intronic
1150128526 17:62653734-62653756 CTGTTGGGGAGGAGGGAGGAGGG + Intronic
1150502078 17:65660514-65660536 AAGAAAGGAAGAAGGGAAGAAGG - Intronic
1150716046 17:67573367-67573389 CTGTAGGGAAGGAGTGGAGGAGG + Intronic
1150842374 17:68620749-68620771 CTGGAGGGAAGGATGGAAAAAGG + Intergenic
1151159135 17:72150246-72150268 ATCTAGAGAAGAAAGGAAGATGG + Intergenic
1151229971 17:72677454-72677476 CTTTAGGAAAAAAGAGAAGAGGG + Intronic
1151409502 17:73912467-73912489 AGGAAGGGAAGAAGGAAAGAGGG - Intergenic
1151586108 17:75009294-75009316 CCTCAGGGAAGAAGGAAAGAGGG + Intergenic
1151618273 17:75228975-75228997 CTGTAAGCCAGGAGGGAAGAAGG - Intronic
1151685809 17:75646076-75646098 CAATAGGGAAGCTGGGAAGAGGG - Intronic
1151792858 17:76320306-76320328 AGGAAGGGAGGAAGGGAAGAAGG + Intronic
1152519657 17:80847777-80847799 CTGGAAGGAAGAAGGGCAGGTGG - Intronic
1152607052 17:81296840-81296862 TAGCAGGGAAGAGGGGAAGAAGG - Intergenic
1153200537 18:2643185-2643207 CTGCAGGGGAGACGGGAAAAAGG + Intergenic
1153353452 18:4108125-4108147 CTTCAGGGAAGAAGGTATGAAGG - Intronic
1153516343 18:5905781-5905803 TTGTAGGACAGGAGGGAAGATGG - Intergenic
1153581157 18:6575104-6575126 ATTTAGGGATGAAGGGAATAGGG - Intronic
1153734226 18:8047714-8047736 CTAGAGGGAAGAGGGTAAGATGG + Intronic
1153973096 18:10244281-10244303 CTGGAAGGAAGATGGGATGATGG - Intergenic
1154013412 18:10594899-10594921 AGGAAGGGAGGAAGGGAAGAGGG + Intergenic
1154152585 18:11918162-11918184 AGGAAGGGAGGAAGGGAAGAGGG + Intergenic
1154225893 18:12503618-12503640 CTGTAGGGAAGCAGCTAAGTAGG - Intronic
1154263123 18:12855266-12855288 ATGTAGGTAAGAAAGGAAGTGGG + Intronic
1155063118 18:22246147-22246169 GTGAAGGGCAGAAGGAAAGAAGG + Intergenic
1155385752 18:25275645-25275667 CTGATGGGGAGAAGGAAAGAGGG - Intronic
1155533644 18:26793911-26793933 CAGAAGGGAGGAAGGAAAGAAGG - Intergenic
1156071952 18:33222304-33222326 AGGGAGGGAAGAAGGGAGGAAGG - Intronic
1156521193 18:37723585-37723607 GTGCTGGGAAGAAGGGAGGAGGG + Intergenic
1156590005 18:38476096-38476118 CTGTATGGAGGTAGAGAAGATGG + Intergenic
1156838275 18:41581743-41581765 ATGTAGGGAAGAAGAAAAGAAGG - Intergenic
1157239837 18:45998636-45998658 CTGAAGGGAAAAAGGGAGGAAGG - Intronic
1157367708 18:47081071-47081093 ATGGAGGGAAGGAGGGAAGAAGG - Intronic
1157535745 18:48456108-48456130 CTGGAGGGAAGAAGAAAGGAAGG + Intergenic
1157564786 18:48672640-48672662 CTGGAGGCAAGAAGGAAAGAGGG + Intronic
1157615137 18:48982417-48982439 CGGTGGGGAGGAAGGGAAGCAGG - Intergenic
1158331176 18:56364495-56364517 CTGTGGGGAAGAGTGGAAGTGGG - Intergenic
1158516895 18:58138314-58138336 GGGGAGGGAAGAAGGAAAGAAGG - Intronic
1158680908 18:59565721-59565743 CTGTAGCTAAGAGGGGAAGACGG + Intronic
1159320767 18:66845048-66845070 CTATAGGGAAGAAGGAAGCAGGG + Intergenic
1159914032 18:74173152-74173174 TTGTAGGGAAGCAGTGAGGATGG + Intergenic
1160087297 18:75788494-75788516 AGGAAGGGAAGAAGGGAGGAAGG - Intergenic
1160306796 18:77747565-77747587 CTGCGGGAAAGAAGGAAAGAGGG - Intergenic
1160484349 18:79275217-79275239 CTGTACAGAAGAGGGGAAAAGGG - Intronic
1160997191 19:1888256-1888278 CTGCAGGGAAGATGGGAGGGGGG - Intergenic
1161260109 19:3332936-3332958 AGGGAGGGAAGAAGGGAGGAAGG - Intergenic
1161665551 19:5574056-5574078 CTGTAGGCAAATAGGGAAGGAGG - Intergenic
1161827849 19:6581046-6581068 AAGGAGGGAAGGAGGGAAGAAGG - Intergenic
1162104713 19:8363493-8363515 AGGTAGGGAGGGAGGGAAGAAGG - Intronic
1162783527 19:13020164-13020186 CTGGAGGGGAGAAGAGAAGGAGG + Intronic
1162865321 19:13541630-13541652 ATGGAGGGAGGGAGGGAAGAAGG + Intronic
1162865322 19:13541638-13541660 AGGGAGGGAAGAAGGAAAGAAGG + Intronic
1163093267 19:15036063-15036085 CAGGAGGGAAGAAAGGAAGGAGG + Intergenic
1163235387 19:16026796-16026818 CTGGAAGGAAGAAGGGAGCAGGG - Intergenic
1164588753 19:29494682-29494704 AAGGAGGGAAGAAGGGAAGAAGG + Intergenic
1164608454 19:29616553-29616575 CCGTAGTGGAGAAGGGAAGTGGG + Intronic
1164772938 19:30826102-30826124 CTGTAAGTGAGAAGGGTAGAGGG + Intergenic
1164815982 19:31203838-31203860 CAGGAGGGAAGAAGGAAGGAAGG - Intergenic
1165142970 19:33713447-33713469 CTGTAGGAAAAGAGGGAAGTGGG - Intronic
1165405244 19:35626663-35626685 AGGGAGGGAAGAAGGGAGGAAGG + Intergenic
1165864252 19:38926424-38926446 CTGAAGGGAGGAGGGGAGGATGG - Intronic
1166004013 19:39894850-39894872 AGGTAGGGAGGAAGGGAAAAGGG - Intronic
1166008687 19:39925481-39925503 AGGTAGGGAAGAGGGGAAAAGGG - Intronic
1166158223 19:40931761-40931783 CTGCAACGAAGAAGGGGAGAGGG - Intergenic
1166258405 19:41621381-41621403 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1166316168 19:41991447-41991469 CTGTAGGGCAGTAGGAAAGATGG - Intronic
1166349470 19:42188714-42188736 AGGGAGGGAGGAAGGGAAGAAGG + Intronic
1166349471 19:42188722-42188744 AGGAAGGGAAGAAGGAAAGAAGG + Intronic
1166548567 19:43649595-43649617 AGGAAGGGAGGAAGGGAAGAAGG + Intronic
1166818902 19:45564307-45564329 GTAGAGGGAAGAAGGGGAGAGGG + Intronic
1166972737 19:46580771-46580793 CTGTAATGAACAAGGGAATACGG - Intronic
1168243095 19:55096923-55096945 CTGCAGGGAAGGGGCGAAGACGG - Intronic
1168243147 19:55097150-55097172 CTGCAGGGAAGGGGTGAAGACGG - Intronic
1168243182 19:55097315-55097337 CTGCAGGGAAGGGGTGAAGACGG - Intronic
1168243196 19:55097372-55097394 CTGCAGGGAAGGGGTGAAGACGG - Intronic
925013575 2:504441-504463 AGGAAGGGAAGAAGGGAGGAGGG - Intergenic
925042610 2:744615-744637 CCGGAGGTGAGAAGGGAAGAGGG - Intergenic
925205789 2:2004474-2004496 CTGCAGGAAAGAAGGCAAGCAGG - Intronic
925222161 2:2150851-2150873 GGGAAGGGAAGGAGGGAAGAAGG + Intronic
925337328 2:3107991-3108013 GAGAAGGGAAGAAGGAAAGAGGG + Intergenic
925409434 2:3631565-3631587 GTTTAGGGCAGAAGGGAATAAGG + Intronic
925590391 2:5503418-5503440 CTTCAGGGAAGAAGGGGAAAGGG - Intergenic
925658883 2:6181467-6181489 CTCTTGGGAAGAGAGGAAGAAGG - Intergenic
925719514 2:6813640-6813662 AGGGAGGGAGGAAGGGAAGAAGG + Intergenic
925719517 2:6813648-6813670 AGGAAGGGAAGAAGGGAGGAAGG + Intergenic
926222230 2:10943762-10943784 GTGTTGGGAACATGGGAAGACGG - Intergenic
926667865 2:15544396-15544418 GGGAAGGGAGGAAGGGAAGAAGG + Intronic
926707850 2:15849322-15849344 GTGGAGAGAAGATGGGAAGAAGG + Intergenic
927388522 2:22564842-22564864 AAGGAGGGAACAAGGGAAGAAGG + Intergenic
927535138 2:23850657-23850679 CTGCAGGGCAGAAGAGAAGGGGG + Intronic
927912964 2:26914600-26914622 CTGAAGGGAGGAGGGGAAGCAGG + Intronic
928058088 2:28078881-28078903 AGGAAGGGAGGAAGGGAAGAAGG - Intronic
928426606 2:31183771-31183793 AAGGAGGGAAGAAGGGAAGAAGG - Intronic
928507126 2:31965282-31965304 GGGAAGGGAAGAAGGGAAGGAGG + Intronic
928533732 2:32219053-32219075 GGGAAGAGAAGAAGGGAAGAAGG - Intronic
928771512 2:34707435-34707457 CTGTAGAAGAGAAGGGCAGAAGG + Intergenic
928835690 2:35541713-35541735 AAGGAAGGAAGAAGGGAAGAAGG - Intergenic
929051823 2:37843546-37843568 TTGTGTGGAAAAAGGGAAGAGGG - Intergenic
929176133 2:38978339-38978361 CTGAAGGGAATGAGGCAAGAAGG - Intergenic
929391888 2:41478590-41478612 CTGTAGGATAGAAGGGAAGATGG - Intergenic
929428311 2:41866246-41866268 GTGGGAGGAAGAAGGGAAGAAGG - Intergenic
929529892 2:42743133-42743155 CTGGAGAGAAGAAAGGCAGATGG + Intronic
929632933 2:43484377-43484399 TTTTAGGGAAGAAGGGAATAGGG + Intronic
929954084 2:46442312-46442334 CTATGGGGAGAAAGGGAAGAGGG - Intronic
929968242 2:46551455-46551477 GTGTAGGGAGGAACGGCAGAGGG + Intronic
930245802 2:48982247-48982269 GTGTAGGTAAGAAGAGAAGATGG + Intronic
930406267 2:50960326-50960348 AAGGAGGGAAGGAGGGAAGAAGG - Intronic
931192799 2:60022089-60022111 CTGGAGGGAGGAAAGGGAGAAGG + Intergenic
931773396 2:65518647-65518669 ATGGAGGGAAGAAGGAAAGAAGG - Intergenic
931975355 2:67638018-67638040 GAGAAGGGAAGAAGGGAAGAAGG + Intergenic
931975358 2:67638026-67638048 AAGAAGGGAAGAAGGGAGGAAGG + Intergenic
932052496 2:68412693-68412715 CTGTAGTGAAGGAGAGCAGAGGG - Intergenic
932126696 2:69151371-69151393 CTGTAGGGAGGCAGGGTGGAGGG + Intronic
932213762 2:69952996-69953018 CTGGAGGGAGGCAGGGCAGAAGG - Intergenic
932320265 2:70817113-70817135 CTGGAGGGAGGAAGTGAAGAAGG + Intronic
932403619 2:71499563-71499585 CCGTATGGCAGAAGGGAAGGAGG - Intronic
932601908 2:73133431-73133453 AGGGAGGGAAGAAGGGAAGGAGG + Intronic
932691725 2:73919250-73919272 ATGGAAGGAATAAGGGAAGAGGG + Intronic
933312823 2:80682087-80682109 GTGTAGGGAAGAGGAGATGACGG - Intergenic
933654003 2:84872533-84872555 CTAGAGGGAGGGAGGGAAGAAGG + Intronic
933794095 2:85906233-85906255 GGGAAGGGAAGAAGGAAAGAAGG - Intergenic
934315369 2:91913243-91913265 GAGAAGGGAAGAAGGGAAGAAGG + Intergenic
934546552 2:95221990-95222012 GTGGAAGGAAGAAAGGAAGAAGG - Intronic
934674583 2:96240663-96240685 CTGCAGGGAAGGAAGGAAGCAGG - Intergenic
934706433 2:96484837-96484859 GTGGAGGGTAGGAGGGAAGATGG - Intergenic
935213278 2:100956351-100956373 CTGGAGGGAGGAAGGAAGGAGGG - Intronic
935656649 2:105429053-105429075 CTGCAGAGGAGAAGGGCAGAAGG + Intronic
935979548 2:108613487-108613509 GTGTAGGGAGGGAGGGCAGAAGG - Intronic
935999357 2:108811123-108811145 GGGAGGGGAAGAAGGGAAGAAGG - Intronic
936416705 2:112322108-112322130 AAGGAGGGAAGGAGGGAAGACGG - Intronic
936616919 2:114057296-114057318 AGGAAGGGAGGAAGGGAAGAAGG - Intergenic
936919561 2:117673897-117673919 CTGTGGGGCAGAAGGAAATAGGG + Intergenic
937005556 2:118509622-118509644 AAGTAGAGAAGAAGGGATGAAGG + Intergenic
937018688 2:118630956-118630978 CTCCAGGGAAGAAGGGAAGAAGG + Intergenic
937087935 2:119184118-119184140 CAGAAGGGTAGAAGGGAACAGGG - Intergenic
937126702 2:119479149-119479171 AGGGAGGGAGGAAGGGAAGAAGG + Intronic
937126703 2:119479157-119479179 AGGAAGGGAAGAAGGAAAGAAGG + Intronic
937305454 2:120867803-120867825 CTGGAGGGAAGGAGGGAGGGAGG + Intronic
937619579 2:123970548-123970570 CAGAAGGAAAGAAAGGAAGAAGG + Intergenic
937693685 2:124784166-124784188 TGGGAGGGAAGAAGGGAGGATGG + Intronic
937815950 2:126251132-126251154 CTGTAGGGAGGATGGGAAGGTGG + Intergenic
938003910 2:127771771-127771793 CTGTTGGAAAGAAGGAAGGAGGG + Intronic
938125020 2:128665126-128665148 CTGGAGGGAAGTAGGAATGAGGG - Intergenic
938828570 2:135031648-135031670 ATGTGGGGAAGAAGGGAAGTGGG + Intronic
938890154 2:135696337-135696359 TTATGGGGAAGAAGGGAAGGTGG + Intronic
939141872 2:138363724-138363746 CTTCAGGGGAGAAGGGATGAGGG - Intergenic
939576663 2:143903443-143903465 CTGTAGGGAAGGAGGGCCCAGGG - Intergenic
939857466 2:147377478-147377500 CTATGGGGAGGAAGAGAAGAGGG - Intergenic
940172816 2:150847159-150847181 ATGTAGGGAAAAAGGAAGGAAGG - Intergenic
940320319 2:152369985-152370007 CTATAGGGAAGAAGGGTGGATGG + Intronic
940368040 2:152870520-152870542 CCGTGGGGAAAAAGAGAAGAGGG + Intergenic
941285395 2:163606395-163606417 CAGTTGGGAAGAAGGGAATTAGG + Exonic
941477144 2:165963911-165963933 CACAAAGGAAGAAGGGAAGAAGG - Intergenic
941932156 2:170952992-170953014 TGTGAGGGAAGAAGGGAAGAAGG + Intronic
942011093 2:171762926-171762948 GTGTTAGGAAGAAGGGAAAAGGG + Intergenic
942184840 2:173415230-173415252 AAGGAGGGAAGAAGGGAGGAAGG - Intergenic
942289424 2:174454647-174454669 AGGGAGGGAAGAAGGGAAGGAGG + Intronic
942615018 2:177782755-177782777 AAGTAGGGAAGAAGGGAAGAGGG - Intronic
942756432 2:179347078-179347100 CTTCACGGAAGAAGGGAAGGAGG + Intergenic
942897673 2:181076940-181076962 GTGGAGGGAAGAAAGGAAGAAGG - Intergenic
943280646 2:185928466-185928488 AGGAAGGGAGGAAGGGAAGAAGG + Intergenic
943280653 2:185928486-185928508 AGGGAGGGAGGAAGGGAAGAAGG + Intergenic
943732304 2:191315211-191315233 TTTTAGGGAGGAGGGGAAGATGG - Intronic
944751088 2:202710693-202710715 CAGCAGGCAAGAAGGGAAGGGGG - Intronic
945512858 2:210724163-210724185 CTGCAGGGAAGGTGGGGAGAAGG + Intergenic
945610667 2:211997672-211997694 CAGAGGGGAAGAAGGGGAGAGGG - Intronic
945640728 2:212425678-212425700 GTGTAACCAAGAAGGGAAGAGGG - Intronic
945716334 2:213362074-213362096 ATGTTGGGCACAAGGGAAGAAGG + Intronic
945930196 2:215847178-215847200 CTGGAAGGAAGAAGGGTTGAAGG + Intergenic
946057846 2:216917221-216917243 CAGGGAGGAAGAAGGGAAGAGGG + Intergenic
946071629 2:217039221-217039243 CTTAAGGGATGAAGGGAATATGG - Intergenic
946079678 2:217106647-217106669 AGGTAGGGAAGAAAAGAAGAAGG - Intergenic
946102693 2:217340019-217340041 CAGTAGGGAAGAAAGGACAAGGG + Intronic
946176810 2:217927333-217927355 TGGAAGGGATGAAGGGAAGAAGG + Intronic
946411182 2:219515905-219515927 CTGGAGGGCAGAATGAAAGAGGG - Intronic
946817230 2:223591660-223591682 TTGTAGGAGAGAAGGTAAGATGG + Intergenic
947030031 2:225782934-225782956 ATGAAGGGAAGAAGGGAGGAAGG - Intergenic
947103556 2:226646550-226646572 CTGAAAGGAGGAAGGGAAAAGGG + Intergenic
948740733 2:240044197-240044219 CTGCAGGGAGGAGTGGAAGAGGG - Intergenic
948833363 2:240611800-240611822 CTCTAGGGGTGAAGGGCAGAGGG + Intronic
948995475 2:241576158-241576180 CTGCAGGGAAGGAGGGTGGAGGG - Intergenic
1169015971 20:2293022-2293044 GTGGAGGGTAGAAGGGAAGCTGG + Intergenic
1170000426 20:11608279-11608301 CTAGAGGGAAGAAGGGGCGATGG + Intergenic
1170140936 20:13124344-13124366 AGGAAGGGAGGAAGGGAAGAAGG + Intronic
1170168625 20:13386583-13386605 CTGGATGGAAGGAGGGAAGAAGG - Intergenic
1170522082 20:17197162-17197184 AAGGAGGGAAGAAGGGAAGGAGG + Intergenic
1170596754 20:17811354-17811376 CTGTAGGGATGAAGGGATGTGGG - Intergenic
1171115311 20:22520361-22520383 CTGTGAGGAAGAAGGGAAGCAGG + Intergenic
1171177259 20:23061715-23061737 CTGCAGGAAAGAAGGGCAGTGGG + Intergenic
1171206040 20:23282235-23282257 AGGAAGGGAAGAAGGGAGGAAGG + Intergenic
1172298317 20:33829886-33829908 AGGAAGGGAAGAAGGGCAGATGG + Intronic
1172350546 20:34235970-34235992 AGGGAGGGAAGAAGGAAAGAAGG + Intronic
1172412848 20:34739073-34739095 GGGAAGGGAAGAAGGGAAGGAGG + Intronic
1172527278 20:35607524-35607546 CTGGTGGGCAGAAGGGCAGACGG - Intergenic
1172537966 20:35688799-35688821 AGGGAGGGAAGAAGGGAAGGTGG + Intronic
1172791771 20:37510784-37510806 CTGTAGTCATGAGGGGAAGAAGG - Intronic
1173074853 20:39808025-39808047 CTGTAGGAAAGAGGGGAAAATGG - Intergenic
1173149971 20:40558654-40558676 ATGGAGGGAAGAAGGAAGGAAGG + Intergenic
1173179734 20:40796773-40796795 CTGTAGGAAAGAAGGGGATCTGG - Intergenic
1173253619 20:41377437-41377459 CTGGAGGGAAGAGGGGCAGGAGG + Intergenic
1173400722 20:42723607-42723629 CTGTAGGGTAGAGTGGAAGAGGG - Intronic
1173408458 20:42788172-42788194 CTGTTGTAAAGAAGGGAACAGGG + Intronic
1173409704 20:42799165-42799187 TGGAAGGGAAGAAGGGAGGAAGG + Intronic
1173432367 20:43000044-43000066 AGGAAGGGAAGAAGGGAAGGAGG + Intronic
1173662663 20:44745376-44745398 ATGAAGGGACGAAGGGAGGAAGG + Intergenic
1174701235 20:52611230-52611252 AGGGAGGGAAGAAGGAAAGAAGG - Intergenic
1174797693 20:53536157-53536179 CTGCAGAGAAGGACGGAAGAAGG - Intergenic
1175470853 20:59226427-59226449 GTGGAGGGAATAAGGGAAGCAGG - Intronic
1175596022 20:60233538-60233560 CAGTAAGGAAGAAGAGAAGGAGG - Intergenic
1175816207 20:61884482-61884504 CAGGAGGGAGGGAGGGAAGATGG + Intronic
1175984034 20:62755356-62755378 ATGGAGGGATGAAGGGAGGAAGG - Intronic
1176002635 20:62839845-62839867 GTGGAGGGGAGAAGGGGAGAGGG - Intronic
1176012171 20:62903846-62903868 GTGTGGCAAAGAAGGGAAGAGGG + Intronic
1176032725 20:63021504-63021526 CTGTAGGACAGGAGGGAAGGAGG - Intergenic
1176087251 20:63303800-63303822 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
1176087263 20:63303840-63303862 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087306 20:63304000-63304022 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087352 20:63304160-63304182 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087364 20:63304200-63304222 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087376 20:63304240-63304262 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087389 20:63304280-63304302 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087412 20:63304360-63304382 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087425 20:63304400-63304422 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087438 20:63304440-63304462 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087461 20:63304520-63304542 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087473 20:63304560-63304582 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087485 20:63304600-63304622 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087496 20:63304640-63304662 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176740300 21:10595517-10595539 CTGTCAGGAACAAGAGAAGAGGG + Intronic
1177109751 21:17010850-17010872 GGGAAGGGAAGAAGGGAGGAAGG + Intergenic
1177264583 21:18765788-18765810 TGGAAGGGATGAAGGGAAGAGGG - Intergenic
1177573353 21:22919183-22919205 ATGAAAGGAAGAAGGAAAGAAGG + Intergenic
1177674368 21:24277288-24277310 AGGCAGGGAAGAAAGGAAGAAGG - Intergenic
1177674406 21:24277390-24277412 CTGAAGGGAAGAAGGGAGACTGG - Intergenic
1178324885 21:31637133-31637155 TTGTAGGCCAGAAGGGAATAGGG - Intergenic
1178762209 21:35413831-35413853 AAGAAGGGAAGGAGGGAAGAGGG + Intronic
1179072348 21:38083466-38083488 CTGTAGGGAGGTGGGGAGGAAGG - Intronic
1179213327 21:39345667-39345689 CTGTAGGGAATAGTGGATGATGG - Intronic
1179218850 21:39389087-39389109 AGGAAGGGAAGAAGGGAGGAAGG - Intronic
1179218853 21:39389095-39389117 GTGAAGGAAGGAAGGGAAGAAGG - Intronic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179475017 21:41637465-41637487 AGGAAGGGAAGAAGGGACGAAGG - Intergenic
1179819895 21:43930642-43930664 CTGTCGGGATGAGGGGAAGGCGG + Intronic
1180007473 21:45029542-45029564 CTCTAGGGGAAAATGGAAGATGG - Intergenic
1180542141 22:16459127-16459149 GGGAAGGAAAGAAGGGAAGAAGG + Intergenic
1180928579 22:19573505-19573527 CAGAAGGGCAGAAGGGCAGAAGG + Intergenic
1181138291 22:20785015-20785037 CTGCAGGGAGGAATGGAAGGAGG - Intronic
1181339311 22:22165680-22165702 GTGAGGGGCAGAAGGGAAGAGGG + Intergenic
1181523062 22:23460282-23460304 GTGTAGGGAGGGAGGGGAGAGGG + Intergenic
1181797463 22:25320428-25320450 CTGCAAGGAAGAAGGGGAGGAGG - Intergenic
1181924657 22:26348732-26348754 GGGAAGGGAAGAAGGGAGGAAGG + Intronic
1182151248 22:28028607-28028629 CTTGAGGTAGGAAGGGAAGAAGG + Intronic
1182179514 22:28331709-28331731 TTGAAGGCAAGAAGGGAGGAAGG - Intronic
1182410428 22:30180825-30180847 GAGAAGGGAAGAAGGGAAGGGGG - Intergenic
1182536742 22:31009368-31009390 CAGTATGGAAATAGGGAAGAAGG + Intergenic
1182819607 22:33203882-33203904 GTGTAGGGAAGAGGCGATGATGG - Intronic
1183499312 22:38168944-38168966 CTATATGGACAAAGGGAAGAAGG - Intronic
1183695938 22:39422199-39422221 CTGAAGGGAAGAGGGGGAGATGG + Intronic
1184053816 22:42030536-42030558 ATGAAGGGAAGAAGTGAAAAGGG + Intronic
1184162350 22:42704541-42704563 CTGTTTGTAAGAAGGGCAGAAGG + Intronic
1184448864 22:44571039-44571061 CTTTAGGGAGGAGGGGGAGAGGG + Intergenic
1184627746 22:45750528-45750550 CTGTATGGAAGTATGGAATATGG + Intronic
1184740473 22:46426003-46426025 AAGAAGGGAGGAAGGGAAGAAGG - Intronic
1185277780 22:49957174-49957196 CCCCAGGGAAGGAGGGAAGAGGG + Intergenic
949251059 3:1984264-1984286 ATGAAGGGAGGAAGGGAGGAAGG + Intergenic
949269254 3:2195056-2195078 GTGTAGGGAAGGAGGGAATGGGG - Intronic
949515037 3:4800074-4800096 CTGTAGGGATGACTGGAAGCAGG + Intronic
949634771 3:5970618-5970640 GAGTGGGGGAGAAGGGAAGAAGG - Intergenic
949894015 3:8755928-8755950 CGGGAGGCAAGAAGGGAAAAGGG + Intronic
950089463 3:10285135-10285157 CAGTAGTGGAGAAGGGAGGAAGG + Intronic
950098388 3:10343247-10343269 CTGGAGGGGAGAGGGGAAGATGG - Intronic
950131782 3:10552260-10552282 CTGTAAAGAAAAGGGGAAGAGGG + Intronic
950725411 3:14913922-14913944 GTGTGGGGAAGAAGAGAAGCAGG - Intronic
950950816 3:16996376-16996398 CTGGAGGCTGGAAGGGAAGAGGG - Intronic
950956872 3:17063261-17063283 ATGAAGGGAGGAAGGGAGGAAGG - Intronic
951008449 3:17647401-17647423 CTACAGGGAATAAGGGAAGTTGG + Intronic
951111285 3:18807342-18807364 CTGTAGGTAATAAGGGACAATGG + Intergenic
951371310 3:21852784-21852806 ATGGAAGGGAGAAGGGAAGACGG + Intronic
951615584 3:24539996-24540018 CTGAAGAAAAGGAGGGAAGAGGG - Intergenic
951738080 3:25889763-25889785 AGGGAGGGAAGCAGGGAAGAAGG - Intergenic
952011623 3:28906448-28906470 CTGCAAGGAAAAAGGAAAGATGG - Intergenic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952206863 3:31188970-31188992 CTGAAAAGAAGAAAGGAAGAGGG + Intergenic
952210597 3:31225796-31225818 CTGTGTGGCAGCAGGGAAGAGGG - Intergenic
952218333 3:31300094-31300116 GTGTAAGGAGGAAGAGAAGAAGG - Intergenic
952401236 3:32966043-32966065 CTGTAGTGCAGAAGGGAAGGTGG + Intergenic
953227694 3:41035441-41035463 GAGTGGGGAAGAAGGGGAGAAGG - Intergenic
953232854 3:41079933-41079955 TTGTAGGTAAGAGGGGAGGAAGG + Intergenic
953375882 3:42428237-42428259 CTGTAGGGAGGAGTGGTAGAAGG - Intergenic
953700953 3:45195391-45195413 AGGAAGGGAGGAAGGGAAGAAGG - Intergenic
953796663 3:45991456-45991478 CAGAGGGGAAGAAGGGAAGGAGG - Intronic
953930950 3:47005401-47005423 CTGGAGGGAAGAAGGGAGCCAGG - Intronic
954673627 3:52303777-52303799 AGGAAGGGAAGAAAGGAAGATGG + Intergenic
955064405 3:55522214-55522236 TGGTAGGGGAGAAGGGAAAAGGG + Intronic
955293087 3:57710951-57710973 AGGGAGGGAGGAAGGGAAGAAGG + Intergenic
955408193 3:58639176-58639198 CTGGACGGAATGAGGGAAGAGGG + Intronic
955516969 3:59735518-59735540 CTGAATGGAAGAAGGAAAGAAGG + Intergenic
955629715 3:60960161-60960183 AGGGTGGGAAGAAGGGAAGAGGG - Intronic
955770232 3:62378148-62378170 CTGGAGGGAAGAAGGAGGGAGGG - Intergenic
956113313 3:65893179-65893201 CAGTAGAGAAGAAGGGATGAAGG - Intronic
956266898 3:67406504-67406526 CTGAAGGGCAGTTGGGAAGAGGG + Intronic
956305606 3:67821086-67821108 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
956398915 3:68855755-68855777 TTGCAGGGAAGATGGGGAGAAGG - Intronic
956649568 3:71491590-71491612 CTGTAGGGAAGACAGGAGGCTGG + Intronic
956682822 3:71797434-71797456 ATGTAGGGAAGAAAGAAAAAAGG + Intergenic
956693564 3:71899986-71900008 CTGAAGGAAAGAAGGGGAGGAGG - Intergenic
956753513 3:72363815-72363837 AAGAAGGGGAGAAGGGAAGAGGG + Intergenic
956760644 3:72440664-72440686 CTATAGGTAAAAAGGGAAGTGGG + Intronic
956857156 3:73286544-73286566 CAGTAGGAGAGAAGGAAAGAGGG + Intergenic
957140488 3:76348696-76348718 CTGAAAGGAGGAAGGGGAGATGG - Intronic
957221588 3:77389654-77389676 ATGAAGGAAAGAAGGGAGGAAGG - Intronic
957305653 3:78455635-78455657 TAGTACGAAAGAAGGGAAGAGGG - Intergenic
958266279 3:91441261-91441283 CTTTAGGGGAGAAGGGTCGAGGG - Intergenic
958949534 3:100401317-100401339 CTTCAGGAAAGAAGGGCAGATGG + Exonic
959219207 3:103494538-103494560 ATGGAGGGAGGAAGGGAAGGAGG + Intergenic
959476449 3:106818106-106818128 CTGTAGAGAAGTAGGGGAGAAGG + Intergenic
959958719 3:112271169-112271191 ATGTAGGGAGGAAGAGAATAGGG + Intronic
960220869 3:115106798-115106820 CTGGGGGGCAGAGGGGAAGAAGG - Intronic
960418598 3:117415584-117415606 AGGAAGGGAGGAAGGGAAGAAGG - Intergenic
960604291 3:119489161-119489183 CTGTAGAGAAGAATGGAACATGG + Intronic
960815318 3:121665938-121665960 CAGGAGGGAAGCAGGAAAGAAGG - Intronic
961046669 3:123713195-123713217 CAGCAAGAAAGAAGGGAAGATGG + Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961472773 3:127126879-127126901 CTTTGTGGGAGAAGGGAAGAGGG - Intergenic
961974900 3:131013225-131013247 CTGTAGGGAAGAAGTTTAAAAGG - Intronic
962388980 3:134956077-134956099 CTGCAGGGAGGAAGGGGAGGAGG + Intronic
962493001 3:135911624-135911646 CTGTTGGGAAGCAGGGAATGGGG + Intergenic
962525146 3:136231238-136231260 CTGTAGGTCTGAAGTGAAGAAGG - Intergenic
962587458 3:136856796-136856818 CTGGAAGGCAGAAGGGAAGAAGG + Intergenic
962830505 3:139135032-139135054 TTGTAGGAAAGAAGAGAAAAAGG - Intronic
962979874 3:140478789-140478811 GGGAAGGGAAGAAGGGAGGAAGG + Intronic
963007892 3:140742932-140742954 CTTTAGGGAAGAAGAGACTAAGG - Intergenic
963253998 3:143126531-143126553 GTGTAGGGAAGAAAGAAAGTTGG - Intergenic
963347463 3:144112503-144112525 CAGTATGGAAGACGGGAAAAGGG + Intergenic
963873371 3:150444507-150444529 CTGTTGGCAAGAAAGGAAGAAGG + Intronic
964178747 3:153857613-153857635 AGGAAGGGAAGAAGGGAGGAAGG + Intergenic
964392230 3:156210018-156210040 CTGCAGGGAAGCAGGGAAACTGG - Intronic
964394520 3:156231531-156231553 AAGGAGGGAAGAAGGGAAGAAGG - Intronic
964529131 3:157648173-157648195 CTGTAGGCAAGAAGACAAGGTGG - Intronic
964610604 3:158611296-158611318 CAGTAGGGAAGATGGGAAAATGG - Intergenic
965077684 3:164000755-164000777 GTGTAGTGAAGAAGGAATGAAGG - Intergenic
965083887 3:164069463-164069485 CAGGAGGGAAGGAGGGAAGGTGG + Intergenic
965154999 3:165040153-165040175 AGGAAGGGAGGAAGGGAAGAAGG + Intronic
965211649 3:165797324-165797346 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
965742124 3:171886520-171886542 ATGTGTGGCAGAAGGGAAGAAGG - Intronic
966109133 3:176375979-176376001 ATGTAGAGATGAAGGGAAGTAGG - Intergenic
966154516 3:176901574-176901596 ATGTAGGTAAGAAGGGGAGAAGG + Intergenic
966261013 3:177979426-177979448 ATGGAGGGAAGAAGGAAGGAAGG + Intergenic
966589109 3:181660234-181660256 ATGAAGGGAGGAAGGGAGGAAGG + Intergenic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
966904888 3:184514882-184514904 TTGTAGGGAGGAAGGCAAGGGGG - Intronic
966931256 3:184677305-184677327 CTGTAGTGAAGAAGGAAAAATGG + Intronic
967080215 3:186042883-186042905 CTGTAGGGAACAGGGAAGGAAGG - Intergenic
967236899 3:187393789-187393811 ATGCTGGTAAGAAGGGAAGAAGG - Intergenic
967857319 3:194128149-194128171 CTGAAAGGAAGATTGGAAGAGGG - Intergenic
968080685 3:195844498-195844520 CTTGAGGGAAAAAGGTAAGAAGG + Intergenic
968276121 3:197441685-197441707 CTGAAAGAAAGAAAGGAAGAAGG + Intergenic
968771023 4:2507186-2507208 CTGGAAGGAAGGAAGGAAGAGGG + Intronic
968937145 4:3617359-3617381 CAGGAGGGAAGAAGGGAGGGAGG - Intergenic
969449785 4:7266405-7266427 CTGAAAGAAAGAAGGGAGGAGGG - Intronic
969492529 4:7508181-7508203 ATGTAGGGAGGAAGGGAAGGGGG + Intronic
969493342 4:7512363-7512385 ATGGAGGGAGGGAGGGAAGAAGG + Intronic
970146585 4:13042450-13042472 TGGTAGGGAAAAAGGGAACAGGG - Intergenic
970159352 4:13173337-13173359 ACGGAGGGAAGAAGGGAGGAAGG + Intergenic
970365040 4:15350048-15350070 AAGAAGGGAGGAAGGGAAGAAGG + Intronic
970434690 4:16022104-16022126 AAGGAGGGAAGGAGGGAAGAAGG + Intronic
970434693 4:16022112-16022134 AAGGAGGGAAGAAGGGAAGGAGG + Intronic
970463817 4:16303643-16303665 CTGTATATAAGAAGTGAAGATGG - Intergenic
970599910 4:17633625-17633647 CTGTAGATAAGAGGGGAAGTAGG - Exonic
970607255 4:17692241-17692263 CAGCAGGGAAGAAAGGAGGAAGG + Intronic
971033785 4:22670285-22670307 CAGGAAGGAAGAAAGGAAGAAGG - Intergenic
971065529 4:23027644-23027666 CAGTAGGGAAGATGGAGAGAGGG + Intergenic
971161927 4:24142201-24142223 TTGCAGGGAAGAAGAAAAGAAGG + Intergenic
971483027 4:27131177-27131199 CAGTAGGGGAGTGGGGAAGAGGG + Intergenic
971799130 4:31265957-31265979 ATGTAGGAGAGAAGGGAGGAAGG + Intergenic
972055521 4:34797177-34797199 ATGGAGGGAAGAAGGAAGGAAGG - Intergenic
972103244 4:35447884-35447906 AAGGAGGGAAGAAGGGAGGAAGG + Intergenic
972256145 4:37357863-37357885 CTGAAGGGGAGATGGAAAGAGGG + Intronic
972374340 4:38456592-38456614 CTGTAGCCAAGAAGGGGATAGGG - Intergenic
973270609 4:48258894-48258916 GTGTAGGGAAGTAGGGAAAGTGG - Intronic
973595340 4:52482772-52482794 CTGTAGGGGTGAGGGGAAGGAGG - Intergenic
974319591 4:60329569-60329591 ATGGAGGGAGGAAGGGAGGAAGG + Intergenic
975100728 4:70509992-70510014 AGGAAGGGAAGAAGAGAAGAGGG + Intergenic
975242625 4:72079949-72079971 CAGAAGGGAAGAGGGGAAGTTGG - Intronic
975528136 4:75373654-75373676 CTGTAGGGGAGGAGGGAGGGAGG - Intergenic
975616318 4:76251408-76251430 CTGAAGGAAAGAAAGGAAGAAGG - Intronic
975932068 4:79537343-79537365 CTGAATGGCAGAAGTGAAGATGG - Intergenic
976536061 4:86218847-86218869 TTGTAGGGAAGAGGGCAAGAGGG + Intronic
976609587 4:87016191-87016213 TTGTGGGGAAAGAGGGAAGAGGG + Intronic
976965384 4:91033371-91033393 CAGCAGGGAAAAAGGGTAGAAGG + Intronic
977166423 4:93704589-93704611 GTGGTGGGAAGAAGGGAAGTGGG - Intronic
977740956 4:100481873-100481895 AGGAAGGGAGGAAGGGAAGAAGG - Intronic
977947608 4:102931323-102931345 GGGAAAGGAAGAAGGGAAGAAGG + Intronic
978448435 4:108803149-108803171 CTGCAAAGAAGAAGGGCAGAGGG + Intergenic
979520899 4:121665677-121665699 AGGAAGGGAGGAAGGGAAGACGG - Intergenic
979520918 4:121665730-121665752 AGGAAGGGAGGAAGGGAAGACGG - Intergenic
979915791 4:126431915-126431937 CCCCAGGGAAGAAGGGAAGACGG - Intergenic
980050338 4:128033290-128033312 CAATAGGGAAGAAGTAAAGAGGG - Intronic
980344591 4:131596415-131596437 AGAAAGGGAAGAAGGGAAGAAGG - Intergenic
981206754 4:142050776-142050798 CTGTAGGTACCAAGGGATGATGG - Intronic
981413367 4:144458859-144458881 AGGGAGGGAGGAAGGGAAGAAGG + Intergenic
981413370 4:144458867-144458889 AGGAAGGGAAGAAGGGAAGGAGG + Intergenic
982201271 4:152963308-152963330 CTATAGGGCTGAAGGGAAGTGGG + Intronic
982261729 4:153500036-153500058 CGGAAGGGAGGAAGGGAGGAAGG - Intronic
982406543 4:155026780-155026802 CTTAGGGGAGGAAGGGAAGAGGG - Intergenic
982460201 4:155660448-155660470 TTGTAGAAAAGGAGGGAAGAAGG - Intergenic
982666310 4:158268905-158268927 CTTTATGAAAGTAGGGAAGATGG - Intergenic
982671067 4:158320565-158320587 CAGAAGGGGAGAAGAGAAGAAGG - Intronic
982689551 4:158532480-158532502 CTGTTGGTCAGAAGGGGAGAAGG - Intronic
982916308 4:161213960-161213982 GTGTAGGGAAGTAGATAAGAAGG + Intergenic
983317717 4:166153294-166153316 TTGTAGGGGAGAAGAGAGGATGG + Intergenic
983976218 4:173937225-173937247 CAGGAGGTAAGAAGGGAAAAAGG - Intergenic
984095711 4:175430018-175430040 TATAAGGGAAGAAGGGAAGATGG + Intergenic
984237064 4:177172417-177172439 GAGGAGGGAAGAAGGGAAAACGG - Intergenic
984409627 4:179379756-179379778 CTGGATGGAAGAAGACAAGATGG - Intergenic
984460829 4:180034628-180034650 ATGGAGGGAGGAAGGGAAGGAGG + Intergenic
984580269 4:181502705-181502727 CCATAGGGAAAGAGGGAAGAAGG + Intergenic
984648119 4:182241370-182241392 CTGAACAGAAGAAGGGATGAAGG - Intronic
984822053 4:183890555-183890577 ATGGAGGGAGGAAGGAAAGAAGG + Intronic
984885468 4:184445727-184445749 GTGGAGGAAGGAAGGGAAGAAGG - Intronic
985657961 5:1141991-1142013 CTGCAGGGCTGCAGGGAAGAGGG - Intergenic
985835250 5:2266416-2266438 AGGCAGGGAAGCAGGGAAGAGGG + Intergenic
986632435 5:9786837-9786859 ATGTGGGGAAGAATGGAAGGTGG - Intergenic
987182769 5:15385052-15385074 CTCTGGGGGAGAAGGGGAGAGGG - Intergenic
987585557 5:19851457-19851479 TTGGAAGGTAGAAGGGAAGAAGG - Intronic
988414264 5:30926213-30926235 TTGTGAGGAAGTAGGGAAGAGGG - Intergenic
988450413 5:31336909-31336931 CTTAGGGCAAGAAGGGAAGAGGG + Intergenic
988466012 5:31493141-31493163 CTTTTGGAAAGAAGGGATGAAGG + Intronic
988545927 5:32157277-32157299 CTGGTGGGAAAAAGGGAGGAAGG - Intronic
989185141 5:38616517-38616539 CTGTGGGGAAACTGGGAAGAAGG - Intergenic
989795934 5:45472509-45472531 ATGGAGGGAGGAAGGGAAGGAGG + Intronic
990409384 5:55525717-55525739 CTGAAGGGAAGATGAGCAGAAGG + Intronic
991249648 5:64545530-64545552 CTGTAGAGAATAAGTGAAAAGGG + Intronic
991719115 5:69479404-69479426 CTATACTGATGAAGGGAAGAAGG + Intergenic
991992093 5:72349920-72349942 CTGGAGGGAGGAAGAGAAGTTGG + Intronic
992183978 5:74225868-74225890 AGGAAGGGAGGAAGGGAAGAGGG - Intergenic
992216367 5:74528474-74528496 ATCTAGGCAAGAAGGGATGATGG - Intergenic
992728207 5:79630728-79630750 TGGTAGGGGAGATGGGAAGAGGG + Intronic
992789059 5:80197628-80197650 CTGTACTGAAGAAGGAAGGATGG - Intronic
992869661 5:80993677-80993699 CTGTAGGCCTGAAGGCAAGAGGG + Intronic
993134612 5:83943376-83943398 TTTTAGGGAAATAGGGAAGAGGG + Exonic
994060565 5:95472257-95472279 CTATAGGGAGGAAGGAATGAAGG - Intronic
994073035 5:95621761-95621783 CTGTAGGGAAGAAGAGAAACTGG - Exonic
994084515 5:95743674-95743696 AGGGAGGGAAGGAGGGAAGAGGG - Intronic
994544441 5:101146122-101146144 GTGCAGGGAAGAGGGGAAGAAGG - Intergenic
994600203 5:101893245-101893267 CTGAAGGAAAGAAAGGGAGAAGG + Intergenic
994628547 5:102252079-102252101 AGGAAGGGAAGAAGGGAGGAAGG + Intronic
995580238 5:113591973-113591995 CTGTAGGTAAAATGGGAGGAAGG - Intronic
995625765 5:114075003-114075025 TGGGAAGGAAGAAGGGAAGAAGG - Intergenic
995655806 5:114424906-114424928 TTGAAAGGTAGAAGGGAAGAAGG + Intronic
996551273 5:124732942-124732964 CTGTATAGAGGGAGGGAAGAAGG - Intronic
996954385 5:129164989-129165011 CAGTAGGGGAGAGGGAAAGATGG - Intergenic
996968492 5:129333793-129333815 CTAAATGGAAGATGGGAAGAAGG + Intergenic
997174514 5:131760855-131760877 CAGGAGGGAAAGAGGGAAGAAGG + Intronic
997639938 5:135442546-135442568 CTGTAAGGATGGAGGGAGGAGGG - Intergenic
997644194 5:135469234-135469256 CAGTTTGGAAGAAGAGAAGAGGG + Intergenic
997924260 5:138013898-138013920 CTATAGGGGATAAGGGAAGATGG - Intronic
998055662 5:139074773-139074795 CTGAAGGCAAGAGGGGATGAAGG - Intronic
998098696 5:139413802-139413824 CTTCACTGAAGAAGGGAAGAAGG + Exonic
998471868 5:142389882-142389904 ATGCAGGGAAGCAGGGCAGAGGG + Intergenic
999090436 5:148931607-148931629 AAGAAGGGAAGAAGGAAAGAAGG - Intronic
999182460 5:149679746-149679768 CTTCTGGGAAGAAGGGGAGAGGG + Intergenic
999261566 5:150241810-150241832 GTGGAGGAAAGAGGGGAAGAAGG - Intronic
999275116 5:150325077-150325099 AAGGAGGGAAGAAGGAAAGAGGG + Intronic
999395234 5:151223087-151223109 CTGTGAGGCAGAGGGGAAGAAGG - Intronic
999742467 5:154566624-154566646 CTGTATGGAAGGAGGGAACTTGG - Intergenic
1000005189 5:157176591-157176613 CTGGAGGGAAAAGAGGAAGAGGG - Intronic
1000096244 5:157973364-157973386 TTGTTGGAAAAAAGGGAAGAAGG - Intergenic
1000115291 5:158148644-158148666 AAGGAGGGAAGAAGGGAAGGAGG - Intergenic
1000115294 5:158148652-158148674 AAGAAGGGAAGGAGGGAAGAAGG - Intergenic
1000115296 5:158148660-158148682 AAGGAGGGAAGAAGGGAAGGAGG - Intergenic
1000115299 5:158148668-158148690 AAGAAGGGAAGGAGGGAAGAAGG - Intergenic
1000115301 5:158148676-158148698 AAGGAGGGAAGAAGGGAAGGAGG - Intergenic
1000115304 5:158148684-158148706 AAGAAGGGAAGGAGGGAAGAAGG - Intergenic
1000115306 5:158148692-158148714 AAGGAGGGAAGAAGGGAAGGAGG - Intergenic
1000115309 5:158148700-158148722 AAGAAGGGAAGGAGGGAAGAAGG - Intergenic
1000223021 5:159232511-159232533 CTGAAGGGAAGATGGGGATAAGG + Intergenic
1000243952 5:159433571-159433593 CCTTAGGGAAGAAGGCATGAGGG + Intergenic
1000373384 5:160558116-160558138 TTGTAGGGAACAAGGAAAGGAGG + Intergenic
1000933328 5:167279466-167279488 AAGAAAGGAAGAAGGGAAGAAGG - Intergenic
1000939872 5:167347697-167347719 AAGAAGGGAAGAAGGGAGGAAGG - Intronic
1000984855 5:167855732-167855754 AGGGAGGGAAGAAGGAAAGAAGG + Intronic
1001204568 5:169750170-169750192 ATGGAGAGAAGAATGGAAGAGGG + Intronic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002875586 6:1205876-1205898 GTGGAAGGAAGAAGGGAGGAAGG + Intergenic
1003199711 6:3947820-3947842 ATGTAGGGAGGGAGGGAGGAGGG + Intergenic
1003509235 6:6765558-6765580 CTGGAGGGAACAAGGGAAGGGGG + Intergenic
1003517570 6:6829967-6829989 AGGGAGGGAAGAAGGGAAGTAGG + Intergenic
1003870525 6:10399131-10399153 CTCTAGAGGAGCAGGGAAGAGGG - Intronic
1004067880 6:12266847-12266869 TGGTAGGGAAGAAGGGCAAAGGG + Intergenic
1004219323 6:13731979-13732001 TTGACGGGAAGAGGGGAAGATGG + Intergenic
1004470335 6:15923347-15923369 GTGAAGCGAAGAAGGGGAGATGG - Intergenic
1004849646 6:19685203-19685225 CAGAAGGGAAGAAGAAAAGAAGG + Intergenic
1005187921 6:23183515-23183537 AGGAAGGGAAGAAGGGAGGAAGG - Intergenic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1005488536 6:26324177-26324199 AGGAAGGGAGGAAGGGAAGAAGG + Intergenic
1005497283 6:26398809-26398831 GTGCAGGGAAGATGGGAGGAAGG - Intergenic
1005598400 6:27401625-27401647 AAGGAGGGAAGGAGGGAAGAAGG - Exonic
1005901078 6:30216728-30216750 CTTCAGGGAAGAAGGGGCGAGGG - Intergenic
1006093035 6:31639423-31639445 CTGAAGGGATCCAGGGAAGAGGG + Intronic
1006193535 6:32223558-32223580 CCATAGGGAAGAGGGGAAGAGGG - Intronic
1006225957 6:32536259-32536281 CTTTAGGGAAGAAGGGCTGTGGG - Intergenic
1006455989 6:34132216-34132238 GTGCATGGAAGAAGGGCAGAAGG + Intronic
1007079901 6:39092579-39092601 GGGTAGGGAAGGAGGGAAAAAGG - Intergenic
1007231017 6:40347857-40347879 CTGTGGGGAGGAGGGGAGGAGGG - Intergenic
1007359824 6:41346877-41346899 GAGGAGGGAAGAAGGAAAGAAGG + Intronic
1007520801 6:42450999-42451021 GGAGAGGGAAGAAGGGAAGAAGG + Intronic
1007741020 6:44009567-44009589 AGGAAGGGAGGAAGGGAAGAGGG + Intergenic
1007760599 6:44131360-44131382 CTGAGGGGAGGAGGGGAAGATGG - Intronic
1007814943 6:44515023-44515045 AGGAAGGAAAGAAGGGAAGAAGG + Intergenic
1007939458 6:45765470-45765492 GAGGAGGGAAGAAGGGAAGGAGG - Intergenic
1008140449 6:47825762-47825784 TTATGGGGAAGAAGGGAAGAAGG + Intronic
1008348072 6:50454052-50454074 AGGTAGGCAAGTAGGGAAGAGGG + Intergenic
1008527259 6:52419578-52419600 CTCTACGGAAGGAGGGAAGTAGG + Intergenic
1008630597 6:53359730-53359752 CTTGAGGGAAGAATGGAAGGCGG + Intergenic
1008717388 6:54305569-54305591 CTGGAAGGAAGAAAGGAAGATGG + Intergenic
1008988997 6:57580715-57580737 CTTTAGGGGAGAAGGGTCGAGGG + Intronic
1009027359 6:58016039-58016061 CTTCAGGAGAGAAGGGAAGAAGG - Intergenic
1009055500 6:58329791-58329813 CTGAAGGGAAAAAAGGAAAAAGG + Intergenic
1009177539 6:60478953-60478975 CTTTAGGGGAGAAGGGTCGAGGG + Intergenic
1009235666 6:61120784-61120806 CTGAAGGGAAAAAAGGAAAAAGG - Intergenic
1009413586 6:63393478-63393500 CTGTACAGAAGAAGGGAAGATGG - Intergenic
1009480104 6:64146521-64146543 CAGCAGGGGAAAAGGGAAGAAGG + Intronic
1009530552 6:64808048-64808070 AGAAAGGGAAGAAGGGAAGAAGG - Intronic
1010037467 6:71342848-71342870 CTGTAGGGAACAAGCCATGAGGG + Intergenic
1010059911 6:71610746-71610768 GTGGAGGGCAGAATGGAAGATGG + Intergenic
1010457167 6:76069977-76069999 CTAGAGGGAAGAGGGCAAGAAGG + Intronic
1010472518 6:76245478-76245500 CTGTAGTGAAGAGTGGAACAAGG + Intergenic
1010630791 6:78195485-78195507 AGGAAGGGAAGAAGGGAGGAAGG - Intergenic
1010630794 6:78195493-78195515 AGGGAGGGAGGAAGGGAAGAAGG - Intergenic
1010704331 6:79089794-79089816 AGGGAGGGAGGAAGGGAAGAAGG - Intergenic
1010840456 6:80643653-80643675 TTGTAGGGCAGAAGGGAAAGAGG + Intergenic
1011099586 6:83707958-83707980 CTGCAGGAAACAAGGGGAGACGG + Intronic
1011731813 6:90272791-90272813 CATTAGGAAAGAAGAGAAGAGGG - Intronic
1012291507 6:97460949-97460971 CATTAGGGAAAAAGGGAATAAGG + Intergenic
1012431482 6:99168319-99168341 GGGGAGGGAAGAAGGAAAGAAGG + Intergenic
1012449386 6:99339065-99339087 CTGTAGAGAAGAGGGGAAGGGGG - Intronic
1012752965 6:103185765-103185787 AGGAAGGGAAGAAGGGAGGAGGG + Intergenic
1013979444 6:116112334-116112356 ATGTAGAGAAGTATGGAAGAAGG + Intronic
1014286719 6:119507332-119507354 CTGGAGGAGAGAAGGGAAGGAGG - Intergenic
1014325927 6:119993207-119993229 TTCTAGGGAATAAGGGAAGTGGG + Intergenic
1014378103 6:120702657-120702679 AAGGAGGGAAGAAGGAAAGAAGG + Intergenic
1014378108 6:120702680-120702702 AAGGAGGGAAGAAGGAAAGAAGG + Intergenic
1014378114 6:120702707-120702729 AAGGAGGGAAGAAGGAAAGAAGG + Intergenic
1014378120 6:120702734-120702756 AAGGAGGGAAGAAGGAAAGAAGG + Intergenic
1014596783 6:123353633-123353655 GTGTAATTAAGAAGGGAAGAAGG + Intronic
1014732320 6:125047532-125047554 TTGTAGGTAAGAAGAGAAGCAGG + Intronic
1015383939 6:132600878-132600900 AAGGAGGGAAGAAGGGAAGGAGG + Intergenic
1015384006 6:132601090-132601112 AGGGAGGGAAGGAGGGAAGAAGG + Intergenic
1015384009 6:132601098-132601120 AAGGAGGGAAGAAGGGAAGGAGG + Intergenic
1015478438 6:133679687-133679709 ATGGAAGGAGGAAGGGAAGAAGG + Intergenic
1015709130 6:136120542-136120564 CAGGTGGGAAGAAGGAAAGAAGG + Intronic
1015975077 6:138782075-138782097 CTCAAGGGTAGGAGGGAAGAAGG - Intronic
1016363704 6:143293775-143293797 CTGTAGGGAAGCTGGGGAGTGGG - Intronic
1016532630 6:145075259-145075281 AGAGAGGGAAGAAGGGAAGAAGG + Intergenic
1016532639 6:145075295-145075317 AGGGAGGGAGGAAGGGAAGAAGG + Intergenic
1017193242 6:151675486-151675508 CGGTGGGGAGGAGGGGAAGAAGG - Intronic
1017349523 6:153423254-153423276 CTGTCAGTAAGAAAGGAAGATGG - Intergenic
1017622176 6:156310248-156310270 CAGGAGGGAAGAAGAGAATAAGG + Intergenic
1017681191 6:156865792-156865814 GTGGAGGGAAGGAGGGAAGGAGG - Intronic
1018650030 6:165985840-165985862 GTGTGGGGAAGAAGGGAGGGTGG - Intronic
1019162325 6:170076858-170076880 CTGTGGGGAAGAAGAGAGGAGGG - Intergenic
1019272338 7:157189-157211 CTGGAGGGAAGGAGGGGACAGGG + Intergenic
1019335180 7:479268-479290 GAGGAGGGAAGGAGGGAAGAGGG + Intergenic
1019539893 7:1546797-1546819 CTGGAGGGAGGATGGGAAGTGGG + Exonic
1019588268 7:1816281-1816303 GTGTAGGGAGGGAGGGGAGAGGG - Intronic
1020034050 7:4953135-4953157 CTGTAGGGATGGAGGAAACAGGG - Intronic
1020227019 7:6288436-6288458 AGGGAGGGAAGAAGGAAAGAAGG - Intergenic
1020569543 7:9841784-9841806 CTGTTGGAAGGAAGGGAAGCAGG + Intergenic
1020731132 7:11882414-11882436 ATGGAGGGAAGAAGAAAAGAAGG - Intergenic
1020883293 7:13791364-13791386 CTGTAGGCAGGCAGGAAAGAGGG - Intergenic
1021112428 7:16710584-16710606 CTGAAGGAAAGAAGGAAGGAAGG + Intergenic
1021112442 7:16710633-16710655 AGGGAGGGAAGAAGAGAAGAAGG + Intergenic
1021653470 7:22853639-22853661 CTGTGAGGAGGAAGGGGAGAAGG - Intergenic
1021798685 7:24283861-24283883 GTGAAGGAAAGAAGGAAAGAAGG + Intergenic
1022013383 7:26328538-26328560 GTGTAGAGTGGAAGGGAAGAGGG + Intronic
1022135376 7:27442692-27442714 CTTCAAGGAAGAAGGGAAGAGGG - Intergenic
1022337316 7:29433896-29433918 ATGAAGGGAAGAAAGGAAGGAGG + Intronic
1022381339 7:29862806-29862828 AGGTGGGGAAGAAGAGAAGAGGG - Intronic
1022468500 7:30667040-30667062 CTGTAGGGGAGTAGAGAAGGGGG - Intronic
1022482795 7:30754715-30754737 ATAGAGGGAAGAAGGAAAGATGG - Intronic
1022540328 7:31128957-31128979 CTGTGGAGAAAAAGGGAGGAGGG - Intergenic
1022644706 7:32219437-32219459 GTATATGGAAGTAGGGAAGAAGG - Intronic
1022789455 7:33672447-33672469 AAGAAGGGAGGAAGGGAAGAAGG - Intergenic
1022789457 7:33672455-33672477 AGGAAGGGAAGAAGGGAGGAAGG - Intergenic
1022839658 7:34151019-34151041 CAGTTGAGAAGAATGGAAGATGG + Intronic
1022891253 7:34702202-34702224 CAGGAAGGAAGAAGGGAGGAAGG + Intronic
1023003552 7:35838372-35838394 CTGTAGGGAGGGAGGGAGGGAGG - Intronic
1023840914 7:44097028-44097050 CTGGAGGGAGGAGGGGAAGGTGG + Intergenic
1023852140 7:44156538-44156560 CTGCAGGGAAGCAGGGGACATGG + Intronic
1024001110 7:45189863-45189885 CTGAAGGGAAGAAGGAAAGCAGG + Intergenic
1024080906 7:45854085-45854107 CTGTCGGGAAGGGGAGAAGAGGG + Intergenic
1024604396 7:51012427-51012449 CAGAAGGGAAGAAGGGAAGGTGG + Intergenic
1024633479 7:51268069-51268091 CTGCAGGGCAGGAGGGAGGAAGG - Intronic
1024780275 7:52839716-52839738 CTGGAGGGAAGAAAGAAACATGG - Intergenic
1024858975 7:53815548-53815570 CTATGGGAAAGAAGGGAAGATGG - Intergenic
1025123599 7:56327754-56327776 CTGTCGGGAAGGGGAGAAGAGGG - Intergenic
1026571910 7:71538785-71538807 TTGAAGGGAGGAAGGGAAGGAGG + Intronic
1027518486 7:79172105-79172127 GTGTAAGAAGGAAGGGAAGAGGG + Intronic
1027733577 7:81905214-81905236 CAGGAGGGAGGAAGGGAAGGAGG - Intergenic
1028843494 7:95453655-95453677 TTAAAGGGAAGAAGGGAAGAAGG - Intergenic
1029191562 7:98775820-98775842 AGGGAGGGAGGAAGGGAAGAAGG + Intergenic
1029252567 7:99247571-99247593 CTGGTGGGAGGGAGGGAAGATGG - Intergenic
1029466480 7:100728499-100728521 GAGTTGGGAAGAAGGGAAGTTGG - Intergenic
1029539910 7:101176585-101176607 CTATGGGGAAGAGGGGCAGAAGG - Intronic
1030198184 7:106874225-106874247 CTGTAGAGAAGTAGAGAAGATGG - Intronic
1030230499 7:107203922-107203944 CAGTAGGGAAGCAGGGAAAAGGG - Intronic
1030634837 7:111937018-111937040 CAGTGGGGAAGAAAGAAAGATGG + Intronic
1030773279 7:113501370-113501392 GTGTAAGGAATAAAGGAAGAAGG - Intergenic
1030874229 7:114793376-114793398 CTGTGAGGAAGAAAGGAACAAGG + Intergenic
1030891143 7:115001045-115001067 CTGAAGGGAAAAATGGAAGATGG + Intronic
1031351671 7:120739640-120739662 ATTTAGGAAGGAAGGGAAGAGGG + Intronic
1031866157 7:127040052-127040074 GAGGAGGGAAGAAGGGGAGATGG + Intronic
1031866175 7:127040093-127040115 GAGGAGGGAAGAAGGGGAGATGG + Intronic
1031933243 7:127708386-127708408 AGGAAGGGAGGAAGGGAAGAAGG - Intronic
1031952550 7:127907231-127907253 GTGATGGAAAGAAGGGAAGAAGG - Intronic
1032106756 7:129038105-129038127 CTGAAGGGAAGCAGAGAAAAAGG + Intronic
1032358342 7:131230713-131230735 CTGTAGGGAAGGAAGGCACAGGG - Intronic
1032408953 7:131678937-131678959 CAATGGGGAAGAAGGGGAGAGGG + Intergenic
1033096255 7:138433900-138433922 AGGAAGGGAAGAAGGGAAGGAGG + Intergenic
1033291984 7:140093352-140093374 TTGTGGGGGAGAAGGGAAGGAGG - Intronic
1033478659 7:141716358-141716380 GGGTAGGGAAGAAGGGAGGAGGG - Intronic
1033617372 7:143029479-143029501 CCCTTGGGAAGAAGGGAAGAGGG - Intergenic
1033935952 7:146585693-146585715 CTGTACGAAAGAAGGAAGGAAGG + Intronic
1034032874 7:147786962-147786984 CTGTCTCGAAGAAGGAAAGAAGG + Intronic
1034090369 7:148358334-148358356 ATGGGGGGAAGAAGGCAAGATGG + Intronic
1034113301 7:148559386-148559408 CTATGGGGAAGAAGGGAATAGGG - Intergenic
1034849813 7:154483088-154483110 TCGGAGGGAAGAGGGGAAGAGGG + Intronic
1035727007 8:1831005-1831027 CTGGAGGGCCGAAGGCAAGAGGG + Intronic
1035992158 8:4504310-4504332 GTGTAGGGAAGAAAGGAAAATGG + Intronic
1035992755 8:4510744-4510766 GAGGAGGGAAGGAGGGAAGAGGG - Intronic
1036154166 8:6326242-6326264 CAGGAGGAAGGAAGGGAAGAAGG + Intergenic
1036154169 8:6326250-6326272 AGGAAGGGAAGAAGGGAAGAGGG + Intergenic
1036515364 8:9438730-9438752 CTGTAAAGGAGAAGGGAAGGTGG + Intergenic
1036778269 8:11628456-11628478 CAGTAGGGATGCAGGGAAGGGGG + Intergenic
1037222469 8:16541334-16541356 AGGCAGGGAAGGAGGGAAGAAGG + Intronic
1037470280 8:19201860-19201882 CTCTCGGGAAGAGGGGAAAATGG + Intergenic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1037902739 8:22697137-22697159 CAGGAGGGAGGAAGGGAAGGAGG - Intergenic
1038219196 8:25591672-25591694 ATGAAGGAAGGAAGGGAAGAAGG - Intergenic
1038311576 8:26449535-26449557 GCGTAGGGAAGAAGGAAAGTGGG + Intronic
1038401227 8:27286429-27286451 CTGCAGAAAAGAAGGAAAGAGGG - Exonic
1038773744 8:30509244-30509266 GAGGAGGGAAGAAGGGAGGAAGG - Intronic
1038962826 8:32540225-32540247 TCTTAGGGAAGAGGGGAAGAAGG + Intronic
1038983720 8:32786412-32786434 CTGGAAAGGAGAAGGGAAGACGG + Intergenic
1039062892 8:33585776-33585798 CTGGAGGTGATAAGGGAAGAAGG + Intergenic
1039096005 8:33886136-33886158 CTACAGGGAGGGAGGGAAGAGGG + Intergenic
1039187143 8:34930327-34930349 AGGAAGGGAGGAAGGGAAGAGGG + Intergenic
1039625224 8:39043372-39043394 CTGTTGGGAAGAATGCAAAATGG - Intronic
1039747681 8:40444503-40444525 CTTTAGGGAGGAAGGGCATATGG + Intergenic
1039762204 8:40589948-40589970 AGGGAGGGAAGGAGGGAAGAAGG - Intronic
1040399551 8:47034594-47034616 AGGAAGGGAAGAAGGGAGGAAGG + Intergenic
1040433609 8:47367859-47367881 CTGGAGGAAAGAAGGCAAGCTGG + Intronic
1040856142 8:51949958-51949980 CTGTTGGCAAGAAGGTAAAATGG + Intergenic
1040859969 8:51989026-51989048 ATGTAGGGAAGAATGTAAGCAGG + Intergenic
1041144962 8:54865346-54865368 AAGGAGGGAAGAAGGGAGGAAGG - Intergenic
1041155762 8:54985317-54985339 AGGAAGGGAGGAAGGGAAGAAGG + Intergenic
1041321494 8:56618558-56618580 GAGAAGGGGAGAAGGGAAGAAGG - Intergenic
1041390142 8:57340688-57340710 CCTTTGGGAAGAAGGGAAGTGGG + Intergenic
1041444149 8:57931793-57931815 AGGGAGGGAGGAAGGGAAGAGGG + Intergenic
1041444168 8:57931860-57931882 AAGAAGGGAGGAAGGGAAGAGGG + Intergenic
1041754413 8:61298124-61298146 GTGTAGGGAAGAACTGGAGAAGG + Intronic
1041802320 8:61813496-61813518 AAGGAGGGAAGAAGGGAAGGAGG - Intergenic
1041802323 8:61813504-61813526 AAGGAGGGAAGGAGGGAAGAAGG - Intergenic
1042794757 8:72649445-72649467 GAGTAGGGAGGAAGGGAGGAAGG + Intronic
1042940159 8:74099316-74099338 CTGTAGGGAAGAAGGCCTAATGG - Intergenic
1043602034 8:81952502-81952524 ATGGAGAGAAGAAGGCAAGAAGG - Intergenic
1043912650 8:85880962-85880984 CTGTAGGGAAGATGGAGAGAAGG + Intergenic
1043965346 8:86468862-86468884 GGGAAGGGAAGAAGGGGAGAAGG - Intronic
1044185488 8:89245846-89245868 GTGTAGGGAAGAGAGGACGATGG - Intergenic
1044586029 8:93869807-93869829 CTGAAGGGAAGAAGGGAGAAGGG - Intronic
1044727665 8:95206632-95206654 CTGTTGGGAAGGAGGAAAGAGGG - Intergenic
1045180063 8:99771049-99771071 CTCTAGGGGTGAAGGTAAGAGGG - Intronic
1045271466 8:100665431-100665453 ATTTTGGGAAGAAGGGAAAACGG - Intergenic
1045502050 8:102751161-102751183 TATTATGGAAGAAGGGAAGAAGG - Intergenic
1045714239 8:105022779-105022801 CTGGAGGGAAGGAGAGACGAAGG - Intronic
1045718315 8:105074893-105074915 CGGGAGGGAGGGAGGGAAGAAGG - Intronic
1045755208 8:105534007-105534029 AGGAAGGGAAGAAGGGAGGAAGG - Intronic
1045755211 8:105534015-105534037 AGGGAGGGAGGAAGGGAAGAAGG - Intronic
1045789376 8:105964108-105964130 AGGGAGGGAAGAAGGGAAGGAGG + Intergenic
1045831667 8:106469202-106469224 CTATAGGCAAGAAGGGAGGGAGG - Intronic
1046555430 8:115768232-115768254 GGGAAGGGAAGAAGGGAAGGGGG - Intronic
1046555446 8:115768275-115768297 GGGAAGGGAAGAAGGGAAGAAGG - Intronic
1047501654 8:125446388-125446410 AGGAAGGGAAGAAGGGAAGAAGG - Intergenic
1047501656 8:125446396-125446418 AGGGAGGGAGGAAGGGAAGAAGG - Intergenic
1047594521 8:126365049-126365071 CTGTGGGGAAGAAGGGGGAAAGG + Intergenic
1047594660 8:126366234-126366256 TTGTGGGGAAGAAGGGGGGAAGG + Intergenic
1047915159 8:129575148-129575170 CAGTTGGAAAGAAGGGAATAAGG + Intergenic
1048746499 8:137620079-137620101 AGGGAGGAAAGAAGGGAAGAAGG - Intergenic
1048813183 8:138307012-138307034 GTGAAGGTAAGATGGGAAGATGG - Intronic
1048831546 8:138482257-138482279 GTGTAGGGAAGAGGGAAATAGGG + Intronic
1048837880 8:138538356-138538378 GGGAAGGGAGGAAGGGAAGAAGG + Intergenic
1048905457 8:139083926-139083948 CTGTGGGGAATGAGGGAATAAGG - Intergenic
1048946533 8:139453606-139453628 CTGGAGGGTTAAAGGGAAGAAGG + Intergenic
1049141849 8:140962246-140962268 AGGAAGGGAGGAAGGGAAGAAGG + Intronic
1049406731 8:142454962-142454984 ATGCAGGGAAGGAGGGAGGAGGG - Intronic
1050292716 9:4172903-4172925 ATGTAGGGAAGCAGGCCAGATGG + Intronic
1050366956 9:4881683-4881705 AAGGAGGGAAGAAGGGAGGAGGG - Intronic
1050406011 9:5309416-5309438 CTGGAGAGAAGACAGGAAGAGGG - Intergenic
1050871283 9:10573478-10573500 TTGTATGGAGGAAGGCAAGATGG + Intronic
1052340846 9:27362849-27362871 CTGTAAGGCAGAAGGGAAAAGGG - Intronic
1052356378 9:27509267-27509289 CTATAGGAAGGAAGGGAGGAAGG + Intronic
1052393847 9:27913738-27913760 CTGTCGGGAGGAAGGGAGGAAGG - Intergenic
1052401456 9:28005468-28005490 CTGTGGGGAAGAAAAGTAGAGGG - Intronic
1052490076 9:29154795-29154817 TTGTAGGGAAGAGGAGCAGAGGG + Intergenic
1052599717 9:30610008-30610030 CTGGATAAAAGAAGGGAAGAAGG + Intergenic
1052733396 9:32315651-32315673 GTTGGGGGAAGAAGGGAAGAAGG + Intergenic
1054710071 9:68502431-68502453 CTGAAAGGGACAAGGGAAGAAGG - Intronic
1054814674 9:69463739-69463761 CTGCAGGGAGTGAGGGAAGAAGG + Intronic
1055031376 9:71773907-71773929 CTGTAGGGAAGTAGGCAGGATGG - Intronic
1055698433 9:78915396-78915418 GTGTAGGGAAAAACTGAAGATGG + Intergenic
1056483769 9:87033611-87033633 CAGAAAAGAAGAAGGGAAGAGGG + Intergenic
1056628841 9:88276050-88276072 ATGTGGGGCAGAGGGGAAGAGGG - Intergenic
1056888394 9:90466660-90466682 CTGCAGGGCAGATGGGAAAATGG + Intergenic
1056946895 9:91005285-91005307 TGGAAGGGAGGAAGGGAAGAAGG - Intergenic
1057404146 9:94752718-94752740 CTGTAGAAAAGCATGGAAGATGG - Intronic
1057998882 9:99845528-99845550 CTGAAAGGAAGCAAGGAAGATGG - Intronic
1058212254 9:102183790-102183812 ATGTAGAGAGGAAGAGAAGAAGG - Intergenic
1058583703 9:106484933-106484955 CTGAAGGGAACAAGGGAGGCAGG + Intergenic
1058603854 9:106699940-106699962 CTGAAGGGAGCATGGGAAGAGGG - Intergenic
1058663630 9:107289055-107289077 AGGGAGGGAGGAAGGGAAGAAGG - Intronic
1058830701 9:108813727-108813749 CAGTTGGGAAGAGGTGAAGATGG + Intergenic
1059253000 9:112904041-112904063 CTGCTGGGAAGAAGGTGAGATGG + Intergenic
1059400431 9:114066231-114066253 CTGTAGGGGAGAAGACATGAAGG - Intronic
1059494032 9:114694717-114694739 GTGTAGGGTAGAAGGAAAGCTGG + Intergenic
1059568978 9:115414004-115414026 CTTTAGGAAAGAAGGAAGGAAGG + Intergenic
1059670481 9:116486416-116486438 ATGGAGGGAAAGAGGGAAGAAGG + Intronic
1059867755 9:118535667-118535689 CTTAAAGGAGGAAGGGAAGATGG - Intergenic
1060202374 9:121658953-121658975 CTGTCAGGGAGAAGAGAAGAGGG - Intronic
1060595749 9:124847639-124847661 ATGTGGGGAAGTAGGGGAGAGGG - Intergenic
1060806955 9:126583738-126583760 CAGCTGGGAAGAAGGGCAGACGG + Intergenic
1061213775 9:129208595-129208617 CTGTGGGGAAGACAGGAAGTGGG - Intergenic
1061332525 9:129904716-129904738 CTGTGGGAAAGAAGGCAGGAAGG - Intronic
1061416542 9:130450364-130450386 ATGGAGGGAAGGAGGGAGGAAGG - Intronic
1061495418 9:130971116-130971138 GAGAAGGGAAGAAGGGAGGAGGG + Intergenic
1061533217 9:131230810-131230832 CTTTGGGGGAGAAGGCAAGAGGG - Intronic
1061628257 9:131855200-131855222 CTCCAGGGAAGAAGGGACAAGGG - Intergenic
1061636332 9:131911946-131911968 CTGTGGGGCAGCAGGGAAGTTGG - Intronic
1061659354 9:132118380-132118402 CTGTTGTTATGAAGGGAAGATGG - Intergenic
1061830042 9:133285905-133285927 CTGTAAGGACAAAGGAAAGAGGG - Intergenic
1061950122 9:133931459-133931481 AAGGAGGGGAGAAGGGAAGAGGG - Intronic
1062328254 9:136023080-136023102 AGGGAGGGAAGGAGGGAAGAGGG + Intronic
1062513268 9:136919678-136919700 ATGAAGGGATGAAGGGAAGAAGG - Intronic
1185700466 X:2227557-2227579 AAGGAGGGAAGAAGGGAGGAAGG + Intronic
1185914994 X:4025652-4025674 ATAAAGGGAAGAAGGGAAGGAGG - Intergenic
1186045259 X:5529722-5529744 TAGAAGGGAGGAAGGGAAGAAGG - Intergenic
1186107096 X:6219385-6219407 ATGAAGGAAAGAAGGAAAGAAGG - Intronic
1186328516 X:8507163-8507185 CTGAATTGTAGAAGGGAAGAGGG + Intergenic
1186406932 X:9312864-9312886 TGGGAGGGAAGAAGGGAAGGAGG + Intergenic
1186897638 X:14020359-14020381 CTTTGGGGAAGAAGCGCAGAAGG + Exonic
1187068172 X:15861451-15861473 GGGGAGGGAAGGAGGGAAGAAGG - Intergenic
1187117791 X:16370807-16370829 CAGGAAGGAAGAAGGAAAGATGG + Intergenic
1187149450 X:16668623-16668645 AAGGAAGGAAGAAGGGAAGAAGG + Intronic
1187172938 X:16869793-16869815 CTGGAGGAGGGAAGGGAAGAGGG + Exonic
1187242823 X:17529014-17529036 AGGAAGGGAAGAAGGGAAGGAGG - Intronic
1187807887 X:23140978-23141000 CTCTAAGGAAGAAGGCATGAGGG + Intergenic
1188439702 X:30203532-30203554 TTGGAGGAAAGAAGGGAGGAAGG + Intergenic
1189057523 X:37713964-37713986 CTTTAAGGAAGAAGAGAGGAAGG + Intronic
1189150746 X:38703798-38703820 CTTTGGGGAAGAAGAAAAGAAGG + Intergenic
1189284446 X:39841417-39841439 CATTAGGGAAGAAAGGGAGAGGG + Intergenic
1190055037 X:47176342-47176364 ATGGAGGGAAGAAGGGAGGTAGG - Intronic
1190446135 X:50526252-50526274 CTGTAGGAAACACGGGAAGGAGG + Intergenic
1190574472 X:51819175-51819197 ATGTGGGGCAGAGGGGAAGAAGG - Intronic
1190740219 X:53283670-53283692 CTGAAGGGAGGAAGGAATGAAGG + Intronic
1192109550 X:68350535-68350557 CTGTCGGAAAGAAGGGAGGAAGG - Intronic
1192178345 X:68899655-68899677 CTCTTGGGAAGATCGGAAGAGGG - Intergenic
1192428470 X:71096992-71097014 GTGTTGGGAAGAAGGTAAGAGGG - Intronic
1192435009 X:71137703-71137725 CTGGAGGGAAGAAGGAGAGAGGG - Intronic
1192544419 X:72001545-72001567 GTGGAGGAAACAAGGGAAGATGG - Intergenic
1192635074 X:72808250-72808272 CTGTAGGGGGGGAGGGACGATGG - Intronic
1192646641 X:72912553-72912575 CTGTAGGGGGGGAGGGACGATGG + Intronic
1192848051 X:74925725-74925747 TGGTGGGGAAGAAGGGTAGAGGG - Intergenic
1193269962 X:79516987-79517009 AGGGAGGGAGGAAGGGAAGAAGG + Intergenic
1193892295 X:87064887-87064909 CTGTAGGGATCAAGGGTGGAAGG + Intergenic
1194140526 X:90203587-90203609 ATGAAGGAAAGAAGGAAAGAAGG - Intergenic
1194667099 X:96687197-96687219 GAGTAGGGAAGAAGGGGAAATGG + Intronic
1194956727 X:100189670-100189692 GTGGAGGGAAGAAGGGAAGTAGG + Intergenic
1195030103 X:100918784-100918806 AGGAAAGGAAGAAGGGAAGAAGG - Intronic
1195119559 X:101736617-101736639 CTGTAGGGATCCAGGAAAGATGG + Intergenic
1195423795 X:104704983-104705005 CTATTGGGAAGATGGGAAGGTGG + Intronic
1195870650 X:109481707-109481729 ATGAAGGAAAGAAGGAAAGAAGG - Intronic
1195892733 X:109713057-109713079 AAGGAGGGATGAAGGGAAGAAGG + Intronic
1195892735 X:109713065-109713087 ATGAAGGGAAGAAGGGAAGAAGG + Intronic
1195933963 X:110107628-110107650 AAGAAGGGAAAAAGGGAAGAAGG - Intronic
1195933965 X:110107636-110107658 GGGGAGGGAAGAAGGGAAAAAGG - Intronic
1196635220 X:117994234-117994256 AGGAAGGGAAGAAGGAAAGAAGG - Intronic
1196830091 X:119768971-119768993 ATGAAGGGAAGGAGGGAAGATGG - Intergenic
1197150304 X:123213420-123213442 TTGTACAGATGAAGGGAAGAAGG + Intronic
1197329895 X:125140939-125140961 CTCTAGAGAAGAAGGGAAGGAGG - Intergenic
1198015872 X:132610366-132610388 ATATAGGAATGAAGGGAAGAAGG + Intergenic
1198133785 X:133726662-133726684 CAGGTGGGAAGAAGGGGAGAAGG - Intronic
1198455423 X:136812848-136812870 AGGAAGGAAAGAAGGGAAGAAGG + Intergenic
1198455426 X:136812856-136812878 AAGAAGGGAAGAAGGGAGGAAGG + Intergenic
1199046580 X:143181255-143181277 AAGGAGGGAAGGAGGGAAGAAGG + Intergenic
1199117785 X:144012871-144012893 CTGAAGGCAAGAAGGCAAAAGGG - Intergenic
1199411541 X:147529313-147529335 CTGGTGGGAAGGAGGGTAGAAGG - Intergenic
1200486267 Y:3772526-3772548 ATGAAGGAAAGAAGGAAAGAAGG - Intergenic
1200881738 Y:8220485-8220507 AGGGAGGGAAGGAGGGAAGAAGG - Intergenic
1200908560 Y:8511028-8511050 AGGGAGGGAAGAAGGGAAGGAGG - Intergenic
1201183035 Y:11368062-11368084 GGGAAAGGAAGAAGGGAAGAAGG + Intergenic
1201269340 Y:12239279-12239301 ATGGAGGGAGGAAGGGAGGAAGG + Intergenic
1201433788 Y:13933766-13933788 CTGAATTGTAGAAGGGAAGAGGG - Intergenic
1201478874 Y:14415806-14415828 AGGGAGGGAAGAAGGGAAGGAGG - Intergenic
1201517633 Y:14835308-14835330 ATGAAGGAAAGAAGGGAAGGAGG + Intronic
1201550080 Y:15210281-15210303 ATGAAGGGAAGGAGGGAACAAGG + Intergenic
1201652282 Y:16302743-16302765 ATGAAGGGAAGGAGGGAAGGAGG + Intergenic
1201738675 Y:17300263-17300285 AAGAAGGAAAGAAGGGAAGAAGG + Intergenic
1201741096 Y:17325431-17325453 GGGGAGGGAAGAAGGGAGGAGGG + Intergenic
1202199133 Y:22328724-22328746 AGGGAGGGAGGAAGGGAAGAAGG - Intronic