ID: 1120864602

View in Genome Browser
Species Human (GRCh38)
Location 14:89284984-89285006
Sequence CAGGTCGGACAGCCTGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 148}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120864589_1120864602 29 Left 1120864589 14:89284932-89284954 CCACACTCTGAGCTGCACTACCT 0: 1
1: 0
2: 2
3: 16
4: 220
Right 1120864602 14:89284984-89285006 CAGGTCGGACAGCCTGAGGGTGG 0: 1
1: 0
2: 1
3: 19
4: 148
1120864594_1120864602 6 Left 1120864594 14:89284955-89284977 CCAGCTCCCAAGGGGATATCCTG 0: 1
1: 0
2: 0
3: 11
4: 120
Right 1120864602 14:89284984-89285006 CAGGTCGGACAGCCTGAGGGTGG 0: 1
1: 0
2: 1
3: 19
4: 148
1120864595_1120864602 0 Left 1120864595 14:89284961-89284983 CCCAAGGGGATATCCTGAGTCAA 0: 1
1: 0
2: 1
3: 5
4: 118
Right 1120864602 14:89284984-89285006 CAGGTCGGACAGCCTGAGGGTGG 0: 1
1: 0
2: 1
3: 19
4: 148
1120864596_1120864602 -1 Left 1120864596 14:89284962-89284984 CCAAGGGGATATCCTGAGTCAAC 0: 1
1: 0
2: 2
3: 5
4: 78
Right 1120864602 14:89284984-89285006 CAGGTCGGACAGCCTGAGGGTGG 0: 1
1: 0
2: 1
3: 19
4: 148
1120864593_1120864602 9 Left 1120864593 14:89284952-89284974 CCTCCAGCTCCCAAGGGGATATC 0: 1
1: 0
2: 1
3: 4
4: 142
Right 1120864602 14:89284984-89285006 CAGGTCGGACAGCCTGAGGGTGG 0: 1
1: 0
2: 1
3: 19
4: 148
1120864588_1120864602 30 Left 1120864588 14:89284931-89284953 CCCACACTCTGAGCTGCACTACC 0: 1
1: 0
2: 2
3: 9
4: 121
Right 1120864602 14:89284984-89285006 CAGGTCGGACAGCCTGAGGGTGG 0: 1
1: 0
2: 1
3: 19
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120864602 Original CRISPR CAGGTCGGACAGCCTGAGGG TGG Intronic
900800536 1:4734436-4734458 GAGGTCACACAGCCTGAAGGGGG + Intronic
901858353 1:12058507-12058529 GAGGTCACACAGCATGAGGGTGG - Intergenic
902398437 1:16144736-16144758 AAGGTCATACAGCCTGTGGGTGG + Intronic
902676169 1:18009857-18009879 CTGGTGGGAAAGCCTGAGGTTGG + Intergenic
902724163 1:18324041-18324063 CAGGTTGTACAGCCTGGGAGTGG - Intronic
905434195 1:37945896-37945918 AAGGTGGGACAGCCTGGGTGGGG - Intronic
905539168 1:38746577-38746599 CAGGCAGGACAGCTTTAGGGCGG - Intergenic
910757945 1:90711013-90711035 GAGGTCGGACAGCCTGTGAGCGG - Intergenic
915255706 1:154627270-154627292 CAGGCCAGACAGGCTGAGCGCGG + Intronic
922160626 1:223077197-223077219 CAGGGCACACAGCCTGATGGTGG - Intergenic
922207941 1:223465350-223465372 AAGGTCACACAGCCTGAAGGAGG - Intergenic
922720748 1:227899157-227899179 CAGGTGGGAGAGCCGGAGAGGGG + Intergenic
1062787874 10:280336-280358 CAGGTCAGAAACCCTGAGGGAGG - Intronic
1063434341 10:6018304-6018326 CAGGGAGGACAGGGTGAGGGTGG + Intronic
1063959903 10:11298359-11298381 CAGGTGGTGCAGCCTGAGGGAGG + Intronic
1067535785 10:47108959-47108981 CAGGTGGGAAAGCCTGAGCATGG + Intergenic
1069664687 10:70146498-70146520 CGGGCCGGACAGCCCGAGGCGGG - Exonic
1070402863 10:76068701-76068723 CAGGTTGGACACCCTAAGGCAGG - Intronic
1075549873 10:123384214-123384236 CAGATGGGACAGCCTTAGAGAGG + Intergenic
1075573448 10:123561276-123561298 CAGGTAGAACAGCCTGAGGCAGG - Intergenic
1076193807 10:128500731-128500753 GAGGGCGAACAGCCTGAGGAAGG + Intergenic
1077305911 11:1868631-1868653 CAGGCCTGAGATCCTGAGGGTGG + Intronic
1080493203 11:32789907-32789929 AAGGTCAGTCAGCCTGAGGAAGG + Intronic
1081738593 11:45422466-45422488 CAGGGCCAAAAGCCTGAGGGTGG + Intergenic
1083642680 11:64153876-64153898 CAGGCAGGACAGCCTGGTGGAGG - Intronic
1083681483 11:64353830-64353852 CAGGATGTCCAGCCTGAGGGAGG - Intronic
1084385586 11:68841348-68841370 GGGGTCGGTCAGCCTGCGGGTGG - Intronic
1084948993 11:72654424-72654446 CAGGTGGGAGAGCCTGGGGGAGG + Intronic
1089204270 11:116746332-116746354 CAGGGCTGCAAGCCTGAGGGAGG + Intergenic
1089891236 11:121883467-121883489 CAGGTGGGACCGCCAAAGGGAGG - Intergenic
1091282214 11:134388220-134388242 AAGGTCTTACAGCCTGTGGGTGG - Exonic
1091472085 12:737770-737792 CAGGATAGACATCCTGAGGGAGG - Intergenic
1096494890 12:52034093-52034115 CAGGGCTGAGATCCTGAGGGTGG - Intronic
1097473623 12:60026270-60026292 AAGGTAGGAAAGACTGAGGGAGG + Intergenic
1101548199 12:105736654-105736676 CAGCTGGGAAAGCCAGAGGGAGG + Intergenic
1104348796 12:128026902-128026924 CAGGTGGGACAGCGTGAGTAGGG - Intergenic
1104569365 12:129911482-129911504 CAGGTCAGAAAGGTTGAGGGGGG + Intergenic
1106469618 13:30042771-30042793 CAGGCAGTACAGCCTGAGGAGGG + Intergenic
1108734035 13:53263830-53263852 CAGGTCAGAAAGCAGGAGGGTGG - Intergenic
1113037040 13:106062007-106062029 CAGGGAGCACAGCCTGAGGCAGG - Intergenic
1113285636 13:108845461-108845483 CAGGGCGGACAGCAGGAGGCAGG + Intronic
1118299917 14:64606078-64606100 CATGAGGAACAGCCTGAGGGAGG + Intergenic
1120864602 14:89284984-89285006 CAGGTCGGACAGCCTGAGGGTGG + Intronic
1121447422 14:93987900-93987922 CAGGAGGTACAGCCTCAGGGAGG + Intergenic
1124109731 15:26773824-26773846 CAGGCGGGAAAGCCTGGGGGTGG - Intronic
1124136882 15:27042784-27042806 CGGGTCTGACAGCCTGAGTCAGG + Intronic
1125598571 15:40903053-40903075 CAGGTCGCACAGCCTGCAGCAGG - Exonic
1125828312 15:42693893-42693915 CAGGTTGGCAGGCCTGAGGGAGG - Exonic
1127455776 15:59154940-59154962 CTGGTCTGACGGCCTGTGGGAGG - Intronic
1132518052 16:375052-375074 CAGGCCGGGCTGCCTGAGGTTGG - Intronic
1132738004 16:1397036-1397058 CAGGTCGGGAAGCCTGGGGGTGG - Intronic
1132934624 16:2474348-2474370 CAGGGCCGACAGCCAGAGGGCGG - Intergenic
1135993541 16:27231818-27231840 GACGTCGGACACCCTGAGAGTGG - Intronic
1137586680 16:49668074-49668096 CAGGTAGGAGAGCCTGAAGTTGG + Intronic
1138318461 16:56090533-56090555 CAGGTGGGACAGGTTGAGGCAGG - Intergenic
1138455573 16:57118956-57118978 AAGCTCTGACAGCCTCAGGGTGG + Intronic
1139210967 16:65076380-65076402 CAGCTCAGTGAGCCTGAGGGAGG - Intronic
1139975350 16:70805523-70805545 TAGATCGGACTTCCTGAGGGTGG + Intergenic
1140763646 16:78135140-78135162 CAAGACGGGAAGCCTGAGGGTGG - Intronic
1140937489 16:79687661-79687683 CAGGTTGGACAGAATGAAGGTGG + Intergenic
1141647413 16:85375158-85375180 CAGCTCGCACAGCCTGAGCTGGG - Intergenic
1142279623 16:89141129-89141151 CGGGTCGGACACCCCGCGGGAGG - Intronic
1144512106 17:15886294-15886316 CAGGCAGGACAGCCTGAGGTTGG - Intergenic
1145123484 17:20281403-20281425 CAGGCAGGACAGCCTGAGCCTGG - Intronic
1147187718 17:38721881-38721903 CGGCTCGGGCAGCCTGAGTGTGG - Exonic
1151835717 17:76581480-76581502 CAGGCTGGAGAGCCTGACGGAGG + Intronic
1152068942 17:78125757-78125779 CAGGTCGTACAGGCGGAGGCTGG + Exonic
1152325165 17:79631802-79631824 CAGGGGGAGCAGCCTGAGGGTGG - Intergenic
1152344597 17:79743311-79743333 CAGGTGGGGCAGGCTGAGGTGGG - Intergenic
1152518426 17:80839627-80839649 CAGCTCTGGCAGGCTGAGGGTGG - Intronic
1154318866 18:13328028-13328050 CAGGGAGGAGAGCCTGATGGTGG - Intronic
1158137325 18:54222373-54222395 CTGGCCCCACAGCCTGAGGGAGG + Intronic
1158387657 18:57013274-57013296 CAGGCCGTACAGCAGGAGGGTGG - Intronic
1161226105 19:3146735-3146757 CAGGGAGGACAGGCTGTGGGGGG - Intronic
1161237377 19:3204685-3204707 CAGGTGGGACAGCGTGAAGGCGG - Exonic
1161273145 19:3401308-3401330 CAGGGAGGACAGACTGTGGGGGG + Intronic
1161345548 19:3767251-3767273 CATCTCGAACAGCCTGACGGGGG - Exonic
1161430822 19:4231321-4231343 CAGGTCGGAGAGCCTGGAAGGGG + Exonic
1163594651 19:18213968-18213990 CACGGCGCCCAGCCTGAGGGTGG - Intronic
1163987210 19:20964840-20964862 CTTGGAGGACAGCCTGAGGGAGG + Intergenic
1164005204 19:21142197-21142219 CGGGTCGGACATCCCGAGAGAGG + Intronic
1164490620 19:28709884-28709906 CAGATGGGACAGCATAAGGGAGG - Intergenic
1164736857 19:30548118-30548140 CAGGCCAGACATCCTGAGGGGGG + Exonic
1165321691 19:35089324-35089346 CAGGTCAGGCATTCTGAGGGTGG - Intergenic
925321544 2:2973943-2973965 CAATTGGGACAGCCTGAGTGGGG + Intergenic
926149422 2:10416338-10416360 CAGCCCTGACAGCCGGAGGGGGG + Intronic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
931587232 2:63841566-63841588 CCGGTCGGCCAGCCAGAGCGTGG + Intronic
932817787 2:74875555-74875577 GAGGGCGGACCGCCTGAGGTCGG - Intronic
934097914 2:88624686-88624708 CAGGCAGGACATCCAGAGGGAGG - Intronic
934304850 2:91812684-91812706 AAGGTAGGACAGCCCGAAGGAGG - Intergenic
934328407 2:92040066-92040088 AAGGTAGGACAGCCCGAAGGAGG + Intergenic
934605952 2:95695256-95695278 TTGTTCTGACAGCCTGAGGGTGG + Intergenic
934617915 2:95786504-95786526 AAGGGCTGACAACCTGAGGGAGG - Intergenic
934642978 2:96038055-96038077 AAGGGCTGACAACCTGAGGGAGG + Intronic
935566966 2:104619235-104619257 CAGGTCTGACTGTCAGAGGGCGG + Intergenic
935949369 2:108314803-108314825 CAGGTGTGAGAGGCTGAGGGAGG - Intergenic
942887747 2:180948494-180948516 CAGGTGTGAGAGCCTGAGTGGGG - Intergenic
943142720 2:184002662-184002684 CAGGACTGAGAGACTGAGGGAGG + Intergenic
943747720 2:191479696-191479718 CACGTTGGGCAGCCAGAGGGAGG + Intergenic
1169022567 20:2340651-2340673 CAGGCCGGACAGCATGGGCGGGG - Exonic
1173087616 20:39939309-39939331 CAGGAAGGACAGCTTGGGGGTGG - Intergenic
1173567828 20:44054493-44054515 CATGTGGGACAGCCTGGGAGAGG + Exonic
1175596633 20:60239766-60239788 CTGGAGGGAAAGCCTGAGGGTGG + Intergenic
1185116348 22:48940421-48940443 CAGGAAGCACAGCCTGAGGCAGG + Intergenic
949158011 3:850389-850411 CAGGTCAGGCAGCCCCAGGGCGG - Intergenic
950195962 3:11009471-11009493 AAGGTCACACAGCCTGAGAGTGG - Intronic
950269929 3:11605580-11605602 CAAGGAGGACAGCCTGATGGAGG - Intronic
952883941 3:38001591-38001613 CAGGTGTGCCAGCCTGAGGGAGG + Exonic
956879843 3:73499418-73499440 CAGGTCTGAGAGCCTGGGAGGGG - Intronic
967853853 3:194101830-194101852 GTGGGAGGACAGCCTGAGGGTGG - Intergenic
968287893 3:197518890-197518912 CGGGGAGGTCAGCCTGAGGGGGG - Intronic
969601497 4:8179240-8179262 CAGCTCCGGCAGGCTGAGGGAGG - Intergenic
971524724 4:27602500-27602522 CAGGTAGCACAGGCTGAGAGAGG + Intergenic
973014367 4:45119042-45119064 CAGGAGGAACAGCATGAGGGAGG + Intergenic
973979773 4:56298347-56298369 CAGGTAAGACAGCTTGAGAGTGG + Exonic
979878239 4:125920830-125920852 CAGGACTGACAGCATGAAGGCGG - Intergenic
982334068 4:154214448-154214470 AAGGTCTAACAGCATGAGGGTGG + Intergenic
984083613 4:175280991-175281013 CAGGTCTAACAGCCTCAGGGTGG + Intergenic
985548768 5:522971-522993 CAGGGAGGACAGCCTGAGCCTGG + Intronic
990900415 5:60743522-60743544 CAGGACGGACAGGCTGGGAGGGG + Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
995446082 5:112245710-112245732 CAGGTCAGAGAGCCAGAGAGAGG + Intronic
998377206 5:141699167-141699189 GAGGTCACACAGCCTGTGGGGGG - Intergenic
999314500 5:150575244-150575266 CAGGTGGGGCAGCCTCAGGGAGG - Intergenic
1001021620 5:168187729-168187751 CAGATTGGACAGCCTGAATGTGG + Intronic
1001701569 5:173710332-173710354 CAGGTCAGACAGCCAGAAGCTGG - Intergenic
1002205183 5:177557856-177557878 TAGGTCAGCCAGCCTCAGGGAGG - Intergenic
1004123476 6:12849538-12849560 TAGGTCAGACAGCCTGGGGCTGG + Intronic
1006899246 6:37489571-37489593 AAGGTGGAACAGCCTGGGGGCGG + Intronic
1007165283 6:39824677-39824699 CAGGCAGGACAAGCTGAGGGAGG + Intronic
1019315062 7:380518-380540 CAGCTCGGACAGAGGGAGGGAGG + Intergenic
1022739998 7:33111631-33111653 CAGGTACGAAAGACTGAGGGAGG + Intergenic
1022843832 7:34190608-34190630 AAGGTCAGGCAGCCTGAGGATGG - Intergenic
1024252619 7:47517901-47517923 TGGGTCACACAGCCTGAGGGAGG + Intronic
1026436777 7:70406179-70406201 CAGGTCAGAAAGGCAGAGGGAGG - Intronic
1029479836 7:100805636-100805658 GAGGTGGGACAGTCTGGGGGCGG + Exonic
1034265012 7:149776578-149776600 CAGGCCGGACATCCTGAGAGTGG + Intergenic
1034313489 7:150110430-150110452 CAGGTGGGGCTGCCTGAGGGTGG + Intergenic
1034313508 7:150110499-150110521 GAGGTGGGGCTGCCTGAGGGTGG + Intergenic
1034313526 7:150110568-150110590 CAGGTGGGGCTGCCTGAGGGTGG + Intergenic
1034493836 7:151408854-151408876 CAGGTCGCACAGCCAGTGAGGGG - Intronic
1034793371 7:153990234-153990256 CAGGTGGGGCTGCCTGAGGGTGG - Intronic
1036645985 8:10611651-10611673 CAGGTTGGACGGCCTGAGCAAGG - Exonic
1037537094 8:19834990-19835012 CAGGAGGGACAGCCTTTGGGAGG - Intronic
1037711340 8:21357805-21357827 CAGATAGGACAGCCTGTGAGTGG + Intergenic
1039866817 8:41512189-41512211 CTTGTAGAACAGCCTGAGGGAGG + Intergenic
1040034652 8:42858728-42858750 CAGGTGTGACAGCCTTAAGGTGG + Intronic
1040785848 8:51161128-51161150 CAGGTGGGACAGCCTGAGGAGGG + Intergenic
1044602616 8:94020790-94020812 CAGGGAGGACACCCTGAAGGAGG - Intergenic
1045323665 8:101101035-101101057 GAGCTGGGAGAGCCTGAGGGAGG - Intergenic
1047355663 8:124119334-124119356 CAGGTTGGACAGATGGAGGGTGG + Intronic
1047761835 8:127960279-127960301 CAGGTCACACAGCTTGAGGGTGG + Intergenic
1049576977 8:143394009-143394031 CAGGTCGGGCAGCCAGCTGGTGG + Intergenic
1049682672 8:143926610-143926632 CAGGTGGGGCAGCCTGGGGCAGG + Intronic
1049777812 8:144414537-144414559 CAGGAGGGTCAGCCTGAGTGAGG - Intronic
1051602409 9:18888584-18888606 CAGGTCAGAAAGCCTTTGGGTGG + Intronic
1057076394 9:92140421-92140443 CAGCTCGGCCACCCTGAGGCTGG - Intergenic
1059325747 9:113503230-113503252 CAGGGCTGAGAGCCGGAGGGTGG + Intronic
1061009058 9:127944595-127944617 CAGGTAGGGCAGGCTTAGGGAGG - Exonic
1062121566 9:134836591-134836613 CAGGCAGGAAAGCCAGAGGGTGG + Intronic
1062270763 9:135707325-135707347 TAGGGTGGACAGCCTGAGGGTGG - Intronic
1062672455 9:137719505-137719527 CAGGCCGGCCAGCCTGGGAGTGG - Intronic
1190304359 X:49073713-49073735 CAGGACGGGGAACCTGAGGGGGG - Intronic
1192225883 X:69227582-69227604 GAGGTGGGGCAGCCTGGGGGAGG - Intergenic
1192344499 X:70290021-70290043 CAGTGCGGACTGCCCGAGGGCGG - Intronic
1192846025 X:74907918-74907940 CAGCTGAGACAGCCTGAGGTGGG - Intronic
1199593333 X:149488130-149488152 CAGTACTGACAGCCAGAGGGAGG - Intronic
1199598685 X:149527301-149527323 CAGTACTGACAGCCAGAGGGAGG + Intronic