ID: 1120865763

View in Genome Browser
Species Human (GRCh38)
Location 14:89294081-89294103
Sequence CAGGAGCCCTTGGGAAGAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 362}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120865763_1120865769 10 Left 1120865763 14:89294081-89294103 CCCGTTCTTCCCAAGGGCTCCTG 0: 1
1: 0
2: 2
3: 27
4: 362
Right 1120865769 14:89294114-89294136 TCCTTTCTGTTTCTACTCCCAGG 0: 1
1: 0
2: 3
3: 29
4: 409
1120865763_1120865772 16 Left 1120865763 14:89294081-89294103 CCCGTTCTTCCCAAGGGCTCCTG 0: 1
1: 0
2: 2
3: 27
4: 362
Right 1120865772 14:89294120-89294142 CTGTTTCTACTCCCAGGCCTGGG 0: 1
1: 0
2: 7
3: 37
4: 262
1120865763_1120865771 15 Left 1120865763 14:89294081-89294103 CCCGTTCTTCCCAAGGGCTCCTG 0: 1
1: 0
2: 2
3: 27
4: 362
Right 1120865771 14:89294119-89294141 TCTGTTTCTACTCCCAGGCCTGG 0: 1
1: 0
2: 2
3: 30
4: 231
1120865763_1120865773 17 Left 1120865763 14:89294081-89294103 CCCGTTCTTCCCAAGGGCTCCTG 0: 1
1: 0
2: 2
3: 27
4: 362
Right 1120865773 14:89294121-89294143 TGTTTCTACTCCCAGGCCTGGGG 0: 1
1: 0
2: 2
3: 31
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120865763 Original CRISPR CAGGAGCCCTTGGGAAGAAC GGG (reversed) Intronic
900097332 1:945272-945294 GAGGAGCCCTGGGGAGGAACTGG + Intronic
900600823 1:3502012-3502034 CAGGAGCCCATGTGAGGCACAGG - Intronic
900860578 1:5226434-5226456 CAGGTGTCCCTGGGAAGCACTGG + Intergenic
900928493 1:5720835-5720857 CAGGGGCCCTTTGGGAGGACTGG - Intergenic
902044636 1:13515116-13515138 CAGGAGCCCTGGGGAAGAGGCGG + Intergenic
903555457 1:24189681-24189703 CAGGAGCCCATGGGTGGAGCAGG - Intergenic
903773243 1:25777327-25777349 CAGGAGCCCTGGGGACCAAGGGG - Intronic
905627623 1:39498977-39498999 AAGAGGCCCTTGGGAAGAAGGGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907289387 1:53403078-53403100 CAGGAGCCCTGGGCCAGAATGGG + Intergenic
907599068 1:55748522-55748544 CAGGAGACCTTGCTTAGAACAGG - Intergenic
908639207 1:66203626-66203648 CAGGAGCCGATGCGAACAACTGG - Intronic
909778703 1:79516034-79516056 CAGGAGCCCATGCGATCAACTGG - Intergenic
909846326 1:80399123-80399145 CAGGAGCCCATGCGATCAACTGG - Intergenic
909886365 1:80946758-80946780 CAGGAGCCCATGCGATCAACTGG + Intergenic
910295749 1:85643210-85643232 CAGGAGCCCATGCGATCAACTGG + Intergenic
911033157 1:93510818-93510840 CAGGAGCCGATGGGATCAACTGG + Intronic
912148154 1:106820189-106820211 CAGCAGCCCTGGGGAAAAAAGGG - Intergenic
913028633 1:114873585-114873607 AAGGAGGCCTTGTTAAGAACGGG + Intronic
913317825 1:117567368-117567390 CAGGCGTCTTTGGGAAGAAGAGG + Intergenic
915654174 1:157345069-157345091 CAGGAGCCGATGCGATGAACTGG - Intergenic
916789802 1:168115438-168115460 CAGGAGCCCATGGCAAAAAGAGG - Intronic
917548078 1:175993607-175993629 CAGGAGCCGATGAGATGAACTGG + Intronic
917706028 1:177635145-177635167 CAGGAGCCCATGCGATCAACTGG + Intergenic
919920566 1:202164375-202164397 CGGGAGCCCCTGGGAAGAAAAGG - Intergenic
919927547 1:202200127-202200149 CAGGAGCCCAAGAGCAGAACTGG - Intronic
920179302 1:204122704-204122726 CAGCCGCCCTGTGGAAGAACAGG + Intronic
920658579 1:207895341-207895363 GAGGAGCCCTCAGGAAGAAAGGG + Intronic
921077158 1:211709077-211709099 CTGGACCCCTTGGGAAAAGCAGG + Intergenic
921098728 1:211910238-211910260 CAGGGGCCCCTGGGTAGAAGTGG + Intergenic
922222406 1:223618642-223618664 CAAAAGCCCAAGGGAAGAACAGG + Intronic
922891166 1:229062783-229062805 CTGCAGCCCATGGGAAGCACAGG - Intergenic
923180395 1:231512596-231512618 AATGAGTCCTTGGGGAGAACAGG + Intergenic
923621328 1:235581867-235581889 CAGGAGCCCCTGTGAGGACCGGG - Intronic
1063102828 10:2965327-2965349 CTGGAGACCCAGGGAAGAACTGG + Intergenic
1063389285 10:5638702-5638724 CAGGAGACCTGGGGAAGAGATGG + Intergenic
1064271480 10:13870158-13870180 GAGCAGCCCTTGGGCAGATCTGG + Intronic
1065100048 10:22322431-22322453 CAGGAGACCTTGGAAACAACTGG - Intronic
1066818359 10:39451263-39451285 CAGGAGCCGTTGCGATCAACTGG - Intergenic
1067558620 10:47289173-47289195 CAGCGGCCCTGGGGAAGAGCAGG + Intergenic
1072013842 10:91326631-91326653 CAGGAGCCGATGGGATCAACTGG - Intergenic
1072040622 10:91602782-91602804 CAGGAGCCCATGGGAGGAGGAGG - Intergenic
1072200206 10:93151096-93151118 CAGGAGCTGTTGTGAAGAAAAGG + Intergenic
1072265478 10:93722791-93722813 CTGGAGCCTTGGAGAAGAACAGG + Intergenic
1073539322 10:104305645-104305667 CAGGAATCCTTGGGAGGAAATGG - Intergenic
1074602710 10:114931485-114931507 CAAGAGCCCCTGGCAACAACTGG - Intergenic
1074655809 10:115586532-115586554 CAGGAGCCGATGCGAACAACTGG - Intronic
1075549283 10:123380107-123380129 GAGGAGCTCTTGAGAACAACTGG - Intergenic
1077321190 11:1942853-1942875 CAGGATCCCTGGGGCAGAGCAGG - Intergenic
1078171666 11:8933071-8933093 CAGGAGGCCTTGGGAGGTAGGGG + Intergenic
1079545616 11:21628889-21628911 CAGGAGGCCCGGGGAAGGACAGG + Intergenic
1079575657 11:22000626-22000648 CAGGAGCCCATGTGATCAACTGG - Intergenic
1080781958 11:35437784-35437806 CATGTGTCTTTGGGAAGAACAGG + Intronic
1081545373 11:44067702-44067724 CAGTAGCCATGGGGAAGATCTGG + Exonic
1081577852 11:44330314-44330336 CAGGACCCACTGGGAAGCACAGG + Intergenic
1082944166 11:58740522-58740544 CAGGTGCACATGGGAAGAACTGG + Intergenic
1083860363 11:65417146-65417168 AAGAAGTCCTTGGGAAGAGCTGG - Intergenic
1084562930 11:69914327-69914349 CAGGAGCCCTTGGGCAGCACTGG + Intergenic
1084617194 11:70244412-70244434 CTTGAGCCCTTGGGAAAAGCAGG - Intergenic
1087992556 11:104763625-104763647 CAAGAGCCCTTTGCAGGAACTGG + Intergenic
1088458136 11:110053994-110054016 CAGGAGCCCTATGGAAGACCGGG + Intergenic
1089063377 11:115644112-115644134 AAGGAGGCCATGGGAAGAAAAGG - Intergenic
1089331039 11:117689055-117689077 CAGAAGCCCCTGGGAAGATGAGG - Intronic
1091845799 12:3655592-3655614 CAGGAGCCCTTGCTAAGCAGTGG + Intronic
1092169007 12:6361804-6361826 CAGGATGCCTTGGGAAGACTGGG - Intronic
1092254518 12:6919011-6919033 CTGGAGCCCTTGGGAATACTGGG + Intronic
1092759783 12:11799307-11799329 TAGGAGCCCTAGGAAAGCACCGG - Intronic
1093616465 12:21231454-21231476 GAGGAGTCCTTGGGAAAAATAGG - Intronic
1095232926 12:39763473-39763495 CAGGATGCCTTGGCAGGAACTGG + Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098239887 12:68456218-68456240 CAGGAGCCCGTGGGGAAGACTGG - Intergenic
1099538277 12:83872318-83872340 CAGGAGCTGTTGAGAACAACTGG + Intergenic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1102792394 12:115658248-115658270 CAGGGGCCCATGGCAAGACCAGG - Intergenic
1103564467 12:121808507-121808529 CAGGAGCACTTGGGAAAATGGGG - Intronic
1104916944 12:132270479-132270501 CAGGAGCCCCTGAGAACAGCTGG + Intronic
1104931715 12:132342557-132342579 GAGGAGCCACTGGGAAGGACAGG - Intergenic
1105344141 13:19558642-19558664 CAGTAGCCCTTCTGAAAAACAGG + Intergenic
1105448255 13:20475688-20475710 CAGGAGGCCTTGGGAACAGAGGG + Intronic
1105535892 13:21262941-21262963 CAGTAGCCCTTCTGAAAAACAGG - Intergenic
1106750724 13:32763697-32763719 CAGAAGCCTTGAGGAAGAACAGG + Intronic
1107639422 13:42426107-42426129 CAGGAGCCGATGGGATCAACTGG + Intergenic
1108355422 13:49625324-49625346 CAAGGGCCTTTGGGCAGAACTGG + Intergenic
1112438225 13:99406831-99406853 CACGTGTCATTGGGAAGAACAGG - Intergenic
1114317922 14:21524684-21524706 CAGGAGCCCTGGGGAGGCAGTGG + Exonic
1115095488 14:29630768-29630790 GAGGAGCCCTTGGGAATGACGGG + Exonic
1115732531 14:36286802-36286824 AAGGAGCCGGTGGGAAGAGCAGG - Intergenic
1116013426 14:39378000-39378022 CTGGAGCCCCTTGGAAAAACTGG - Intronic
1116322942 14:43493404-43493426 CAGGAGCCGATGGGATCAACTGG + Intergenic
1116331191 14:43599114-43599136 CAGGAGCCGATGGGATCAACTGG + Intergenic
1118315989 14:64726499-64726521 CTGCAGCCTTTGGGAAGGACAGG - Intronic
1118789982 14:69081880-69081902 AAGGAGCCTTTGGAGAGAACTGG - Intronic
1119799141 14:77427139-77427161 CAGGAGGTCTTGGGAAACACTGG + Exonic
1119920604 14:78442555-78442577 CAGTAGCCCTAGGAAAGAAAGGG + Intronic
1120865763 14:89294081-89294103 CAGGAGCCCTTGGGAAGAACGGG - Intronic
1122857957 14:104568957-104568979 CAGGAGCCCTGGGGAAGGGCTGG - Intronic
1123043526 14:105500171-105500193 CAGGAGCCCTTAGGAGGAGCTGG - Intergenic
1124957304 15:34367617-34367639 AAGGAGCCCATAGGAAGAGCGGG - Intergenic
1126022373 15:44414982-44415004 CAGTAGCCCTTCTGAAAAACAGG - Exonic
1126324746 15:47464477-47464499 CAGGAGTCCTTGGCATGGACTGG - Intronic
1126662814 15:51048888-51048910 AAGGAGGCCTTGGAAAGAAAAGG + Intergenic
1127963202 15:63905533-63905555 TAGAAGCCCTTGGGAAGCACAGG - Intergenic
1128058305 15:64717333-64717355 CAGGAGGCGCTGAGAAGAACAGG + Intergenic
1129689685 15:77706164-77706186 CAGGAGCCCTGGAGAAGGAGTGG - Intronic
1130911595 15:88274766-88274788 CAGGAGCCCTGGGGGAGAGGTGG - Intergenic
1132718385 16:1303644-1303666 CAGGAGCCCTTGGATAGGGCAGG - Intergenic
1132971465 16:2691334-2691356 AAGGAACCCATGGGAAGAAACGG + Intronic
1133202300 16:4211382-4211404 CAGGAGCCCATGGAAAGGGCTGG - Intronic
1133229802 16:4361107-4361129 CAGGAGCCCTTGGGAGACACTGG + Intronic
1133309521 16:4835050-4835072 CAGAAGCTCCTAGGAAGAACTGG - Intronic
1133337473 16:5015378-5015400 CTGGAGCCTTTGGGAGGAAGAGG - Exonic
1134008320 16:10833197-10833219 GAGGAGCCCCTGGGAGAAACAGG + Intergenic
1134190275 16:12115570-12115592 CATGAGCTCTTGTGAATAACAGG - Intronic
1134370520 16:13619943-13619965 CAGGAGCAATTGGGAAGATTAGG - Intergenic
1134875873 16:17698082-17698104 CAGCAGCTCCTGGGAAGAACTGG + Intergenic
1135235515 16:20751683-20751705 CAGGGTCTCTTGGGAAGAAAAGG + Intronic
1138012499 16:53396147-53396169 CAGAGGCCCTTGGCAAAAACTGG + Intergenic
1139274832 16:65717821-65717843 CAGAAGCACTTGGGAAAAAAAGG + Intergenic
1140396013 16:74627450-74627472 CAGGGGCCAATGGGAAGAAGGGG - Intronic
1141006608 16:80358693-80358715 CAGGTGCCTGTGGGAAGACCTGG - Intergenic
1141647907 16:85377328-85377350 CAGGAGCCAAGGGGGAGAACAGG - Intergenic
1141919792 16:87128044-87128066 CAGGAGCCCTTGAGAAGCAGAGG - Intronic
1142187202 16:88700235-88700257 CAGCAGCCCTTAGGCAGAGCTGG - Intronic
1142245578 16:88968706-88968728 CAGGCCCCCTTGGGAATAAGCGG + Intronic
1142410379 16:89912972-89912994 CAGGAGCCTGTGGGGAGCACAGG + Intronic
1142675024 17:1508299-1508321 CAGCAGCCCTTGGGTTGAGCAGG - Intronic
1143772872 17:9179532-9179554 CAGAAGCCCTTTGGAAGCCCAGG - Intronic
1146055080 17:29576888-29576910 CAGGAGCCCCTGCGCAGCACCGG - Exonic
1146471855 17:33131140-33131162 CAGGATCCAATGGGCAGAACGGG + Intronic
1146617728 17:34370159-34370181 GAAGAGCCCTTAGGAAGACCTGG + Intergenic
1147308232 17:39578341-39578363 CAGGAGCCCTTTGGAACCACAGG + Intergenic
1147444060 17:40464087-40464109 CAGGAGGCTTTGGGGAGAGCAGG + Intergenic
1148810016 17:50284317-50284339 TAGGAGACCTTGGGAAGGACTGG - Intergenic
1151148406 17:72063201-72063223 TCGGAGCCCTTTGGGAGAACTGG + Intergenic
1153320145 18:3764927-3764949 CAGGGGCCACAGGGAAGAACAGG + Intronic
1153730495 18:8006600-8006622 CAGGAAACCATGGGTAGAACTGG + Intronic
1153981242 18:10312454-10312476 AAGCAGACCTTGGGAAGAGCTGG - Intergenic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1155485314 18:26335336-26335358 CAGAAGCCTTGGGGAAGGACAGG + Intronic
1156206950 18:34896129-34896151 CAGGAGCCAATGGGATCAACTGG + Intergenic
1156381437 18:36565056-36565078 CAGTTGCCCTTGGGGAAAACTGG + Intronic
1156849810 18:41713143-41713165 CACGCGCCCTTGGGAAAATCTGG - Intergenic
1157532056 18:48429504-48429526 CAGGAGGCTCAGGGAAGAACTGG - Intergenic
1158260524 18:55601289-55601311 AAGGAGCCCTCTGGAAGGACAGG - Intronic
1159879869 18:73848521-73848543 CAGCAGCCTTTGGAAAGAAATGG - Intergenic
1160507619 18:79436295-79436317 TGGGAGCCGTTGGGAACAACTGG + Intronic
1161183284 19:2899946-2899968 CAGGGGCCTGTGGGAAGGACAGG + Intergenic
1161482943 19:4519745-4519767 CAGCCACCCTTGGGAAGCACTGG - Intergenic
1162322615 19:9978942-9978964 CAGGACCCCTTGGGAAAGAAGGG - Exonic
1164916052 19:32053138-32053160 CAGCCTCCCTTGGGAAGACCTGG - Intergenic
1165397137 19:35570656-35570678 TGGGAGACCTTGGGAAGAAGTGG + Intergenic
1166332404 19:42086631-42086653 GAGGAGTCTTTGGGAAGAGCAGG - Intronic
1166368814 19:42290532-42290554 CAGGATCCATTGGGAGGAACCGG - Exonic
1168315983 19:55485007-55485029 AAGGGGACCTGGGGAAGAACGGG - Exonic
1168452946 19:56479963-56479985 CAGGAACCCATGGGAATTACAGG + Intergenic
925037246 2:697736-697758 CAGGAGCCAATGGAAAGATCTGG - Intergenic
925470846 2:4159038-4159060 CAGGAGCCGATGGGATCAACTGG + Intergenic
927560016 2:24063733-24063755 CAGGTGCCCTTGGGAAAGAGTGG + Intergenic
928224738 2:29438906-29438928 CTGGAGCCCTAGGGAAGAACTGG - Intronic
929618763 2:43334046-43334068 CAGACCCCCTAGGGAAGAACTGG + Intronic
932965895 2:76474217-76474239 CTGGATGCCTTGGGAAAAACAGG + Intergenic
932986060 2:76727653-76727675 CAGGAGCCCATGCGATCAACTGG - Intergenic
933709646 2:85315884-85315906 CATGAGCCCCAGGGAAGGACAGG + Intergenic
933713420 2:85343890-85343912 CATGAGCCCCAGGGAAGGACAGG - Intronic
934099595 2:88640622-88640644 CAGAGGCCCATGGCAAGAACAGG - Intergenic
936024019 2:109017433-109017455 CAAGAGACCTTGGGAATCACAGG + Intergenic
936792270 2:116164381-116164403 CAGAGGCCCTGGGGAAAAACTGG + Intergenic
937492434 2:122383811-122383833 TAGCAGCCCATGGGAAGTACAGG + Intergenic
938340579 2:130533450-130533472 AAGGAGCCATTGGGCAGAGCTGG + Intergenic
938349251 2:130587269-130587291 AAGGAGCCATTGGGCAGAGCTGG - Intergenic
941916565 2:170817362-170817384 CAGGCGCCCTTTGGAGGGACAGG - Intronic
942400122 2:175593332-175593354 CAGGAGCCCATGTGATCAACTGG - Intergenic
943228468 2:185211977-185211999 CCGGAGACCTAGGGAAGAGCTGG + Intergenic
943436358 2:187869312-187869334 CTGGAGACCTGGGGAAGAGCGGG - Intergenic
944209333 2:197190095-197190117 CAGGAGCCATTAGGAAGAAGAGG + Intronic
945912096 2:215661158-215661180 GTAGAGCCCTTGGGAAAAACAGG + Intergenic
945989257 2:216380121-216380143 CAGGAGCCTTGGAGAAGAAGAGG - Intergenic
948271205 2:236674490-236674512 AAAGAGCCCTTGGGAAGATCAGG + Intergenic
948368245 2:237472526-237472548 CAGTGGCCCTGGGGAAGAAATGG - Intergenic
1170355968 20:15491762-15491784 AAGGAGCCCTTGGGTAAAAGGGG + Intronic
1172126215 20:32626798-32626820 GAGCAGGCCTTGGGCAGAACTGG - Intergenic
1172144124 20:32744258-32744280 GAGGAGCCCCTGGGAAGAGAGGG - Intergenic
1172501824 20:35433128-35433150 CAGGGGCCTTTGGAAGGAACAGG + Exonic
1173054471 20:39597745-39597767 AAGTAGCCCTTGGGAAGAATGGG - Intergenic
1173525126 20:43726478-43726500 CAGGAGCGCTGTGGAAGAAGAGG - Exonic
1174179850 20:48667986-48668008 TAGGAGGCCTTAGGAAGAACTGG - Intronic
1175169788 20:57072132-57072154 CAGGATCCCTTGGGAACTCCTGG + Intergenic
1175873081 20:62217492-62217514 CAGGGCCTCTTGGGAAGAAGAGG + Intronic
1175878736 20:62244138-62244160 CAGGTGCCCTGGGGAAGGCCGGG + Intronic
1176010081 20:62888571-62888593 CAGAAGCCCTTGGACAGCACAGG - Intronic
1176064948 20:63189419-63189441 TGGGAGCCCTGGGCAAGAACAGG - Intergenic
1176124209 20:63468237-63468259 CAGGAGGCTGTGGGAAGAAGGGG + Intronic
1176270127 20:64231998-64232020 CTGGAGCCTCAGGGAAGAACTGG - Intronic
1176344802 21:5733594-5733616 CAGGAGCCCTTGGCAGGAGTGGG + Intergenic
1176351616 21:5854178-5854200 CAGGAGCCCTTGGCAGGAGTGGG + Intergenic
1176500025 21:7590861-7590883 CAGGAGCCCTTGGCAGGAGTGGG - Intergenic
1176539123 21:8131664-8131686 CAGGAGCCCTTGGCAGGAGTGGG + Intergenic
1176558074 21:8314709-8314731 CAGGAGCCCTTGGCAGGAGTGGG + Intergenic
1177685859 21:24436417-24436439 CAGGAGACTCTTGGAAGAACTGG + Intergenic
1178593264 21:33930364-33930386 CAGGAGCCGATGGGATCAACTGG - Intergenic
1178847870 21:36188448-36188470 CATGAGCACTTGGGAAGTCCTGG + Intronic
1178911189 21:36674862-36674884 CAGAAGCCCTGGGGCAGGACTGG - Intergenic
1179675902 21:42981951-42981973 CAAGAGCCCTGGTGCAGAACTGG - Intronic
1182440918 22:30363301-30363323 CAGGGGAACTGGGGAAGAACGGG + Intronic
1183058059 22:35319066-35319088 CATGAGTCCTTGGCAAGATCAGG - Intronic
1183471103 22:38007227-38007249 CAGGAGACCTAGTGAAGAAGGGG - Intronic
1184529059 22:45042868-45042890 AGGGAGACCCTGGGAAGAACAGG + Intergenic
1184566279 22:45294006-45294028 CACTAGCCCCTGGGAAGACCAGG + Intronic
1184927242 22:47651469-47651491 CAGGAGGCCAGGGCAAGAACAGG + Intergenic
1185122181 22:48977938-48977960 CCAGAGCCCAGGGGAAGAACGGG + Intergenic
1203244073 22_KI270733v1_random:48019-48041 CAGGAGCCCTTGGCAGGAGTGGG + Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950122372 3:10490115-10490137 CAGGAGCCCAGGGGAAGCCCTGG - Intronic
950325013 3:12099256-12099278 CATGTGCCCTTGAGAAGAATAGG - Intronic
950544229 3:13629310-13629332 CAGGACCCCTGGGGAACACCTGG + Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
950990005 3:17424325-17424347 CAGCTGCCCTTGGGAAGAGGAGG + Intronic
951175568 3:19595038-19595060 CAGGAGCCGTTGCGATCAACTGG - Intergenic
951269994 3:20612992-20613014 CACGTGCCCTTGAGAAGAATGGG - Intergenic
951592429 3:24280800-24280822 CAGGAGCCCATGCGATCAACTGG + Intronic
951818687 3:26784323-26784345 CAGGAGCCGATGCGAACAACTGG + Intergenic
952419555 3:33118844-33118866 CAGAAGTCCTCAGGAAGAACAGG - Intronic
952716068 3:36482292-36482314 CAGGAGCACTGGAGAGGAACTGG - Intronic
953174025 3:40532869-40532891 CAGGATCCCTGGAGAAGAACAGG - Exonic
954433302 3:50482779-50482801 AAGGAGCCCTGGGGAAGGGCAGG + Intronic
955022847 3:55137556-55137578 CAGGAGCCCATGTGATCAACTGG + Intergenic
955427581 3:58807927-58807949 CAGGAGCCCATGTGATCAACTGG + Intronic
955430884 3:58843376-58843398 CAGGAGCCCATGTGATCAACTGG + Intronic
955438710 3:58932136-58932158 CAGGAGCCCATGCGATCAACTGG + Intronic
958208429 3:90435435-90435457 CAGGAGCCAATGCGATGAACTGG - Intergenic
962135917 3:132731880-132731902 GAGGAGCCATGGGGAAGAAAGGG - Intergenic
962536063 3:136329683-136329705 TAGGAGCACTTGGCAAGAAAAGG - Intronic
962834857 3:139181135-139181157 CTGGAGTCCTTGGGAAGTATGGG + Intronic
962847033 3:139281993-139282015 CCACAGCCCCTGGGAAGAACAGG - Intronic
963954943 3:151242979-151243001 CAGGAGCCCATGCGATCAACTGG + Intronic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
966012012 3:175090164-175090186 AAGGAGCCCATGGCAGGAACAGG + Intronic
966735369 3:183182721-183182743 CAGGAGCCCTGGGGGATACCTGG - Intronic
968520588 4:1033108-1033130 CAGGAGGCCCTGGGACGAAGAGG + Intergenic
968670335 4:1846801-1846823 CAGAAGCCCTGGGAAAGAAGAGG + Intronic
968718247 4:2177949-2177971 TACCAGGCCTTGGGAAGAACAGG - Intronic
968948810 4:3679631-3679653 CAGGAACCCCTGGGAAGAGCAGG - Intergenic
969136043 4:5029618-5029640 CAGGAGCCGTCGGGGAGGACCGG - Intergenic
969607393 4:8209417-8209439 CCAGAGCCCCTGGGAGGAACAGG + Intronic
970238413 4:13982147-13982169 AGGGAGCCCTGGGGAGGAACAGG - Intergenic
970239346 4:13992170-13992192 CAGCAGCCCTGGGCAGGAACAGG + Intergenic
970412163 4:15818759-15818781 CAGCAGCCCTATGGAAGAAAGGG + Intronic
970447590 4:16136965-16136987 CAGGAGCCCTGGGAAAGAGATGG + Intergenic
970993124 4:22236007-22236029 CAGAAGCCCTGGGGGAGAACTGG - Intergenic
973731599 4:53828410-53828432 CAGGAGCCGATGGGATCAACTGG - Intronic
973845640 4:54910277-54910299 CAAGAGCTTCTGGGAAGAACAGG - Intergenic
974152409 4:58026537-58026559 CAGGAGCCGATGGGATCAACTGG + Intergenic
975531359 4:75402422-75402444 CAGGAGCCCATGCGATCAACTGG + Intergenic
976600742 4:86935394-86935416 TGGGAGCCCTCGGGGAGAACGGG + Intronic
976865748 4:89724058-89724080 TAGGAGCTCTTTGTAAGAACTGG + Intergenic
977349084 4:95857552-95857574 GAGGAGCCCATGGAAAGAATAGG + Intergenic
979112711 4:116779816-116779838 CAGGAGCCCATGTGATCAACTGG - Intergenic
979932089 4:126643383-126643405 CAGCTCCCCTTGGGAAGGACTGG - Intergenic
980450017 4:132958714-132958736 GAGGGGCCCTGGGGAAGAGCTGG + Intergenic
983439581 4:167764339-167764361 AAGGAGCAATTGGGAGGAACAGG + Intergenic
983446504 4:167859112-167859134 CAGGAGCCGGTGCGATGAACTGG + Intergenic
984307719 4:178016260-178016282 CAGGAGCCCATGCGATCAACTGG + Intergenic
984816988 4:183848172-183848194 CAGGAAACCTGGGGATGAACAGG + Intergenic
985607128 5:863864-863886 CAGGGGCCATTGGGGAGCACAGG - Intronic
986108062 5:4679612-4679634 GAGGAGCCCTTGGAAAGAGATGG + Intergenic
989020462 5:36999611-36999633 CAGGAGCCTTTAGGCAGACCTGG - Intronic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
989797881 5:45498364-45498386 CAGGAGCCAATGCGATGAACTGG - Intronic
990519683 5:56566861-56566883 CAGGTGTTCTTGGGAAGAGCAGG - Intronic
991291130 5:65034984-65035006 CGGCAGCCCTGGGGCAGAACAGG - Intergenic
991726704 5:69542654-69542676 CAGGTGACCCTGGGAAGACCAGG - Intronic
991868253 5:71085220-71085242 CAGGTGACCCTGGGAAGACCAGG + Intergenic
992128119 5:73663905-73663927 CAGGAGCCCTAGGGTAGAGGTGG + Intronic
992605973 5:78456963-78456985 CAGGAGCCCATGCGATCAACTGG - Intronic
992614597 5:78536078-78536100 CAGGAGCCCATATCAAGAACAGG + Intronic
993004249 5:82413428-82413450 CAGGAGGCCTTGGAAACACCTGG - Intergenic
994497519 5:100532694-100532716 CAGCAGTCCTTGGCAATAACTGG + Intergenic
997450818 5:133981670-133981692 CAGCATCCCTTAGGAAGAGCAGG + Intronic
998247058 5:140516159-140516181 CAGGAGCCCATGCGATCAACTGG + Intronic
998378582 5:141708086-141708108 CAGGAGCCCCTGGGAAGCAGAGG + Intergenic
1000156288 5:158555299-158555321 CAGGAGACCTTAGGAGGAAGTGG - Intergenic
1002089634 5:176796884-176796906 CAGCAGCCGTAGGGAAGACCTGG - Intergenic
1002157717 5:177295853-177295875 TAGGAACCCTTGGGAGGAAATGG + Exonic
1002493521 5:179596720-179596742 CAGGAGGGACTGGGAAGAACTGG + Intronic
1002605804 5:180382035-180382057 CAGGAGCCCTGGGCCAGAAGAGG - Intergenic
1003330224 6:5123275-5123297 CAGAAGCCCTCAGGAAGAGCTGG + Intronic
1004342118 6:14817088-14817110 CAGGAGCTCTTGGGAGCAAAGGG - Intergenic
1006269973 6:32956883-32956905 AAGGAGATCTGGGGAAGAACAGG + Intronic
1006791079 6:36701728-36701750 GAGGACCCCTAGGGGAGAACAGG + Intronic
1008262866 6:49388106-49388128 CAGGAGCCCATGCGATCAACTGG + Intergenic
1008826939 6:55707063-55707085 AAAGAGCCCTTGGTAAGAATGGG - Intergenic
1009508890 6:64522564-64522586 CAGGAGGCCTTGGGATTATCAGG - Intronic
1010078651 6:71831488-71831510 CAGGAGCCCATGCGATCAACTGG - Intergenic
1010695834 6:78972741-78972763 CAGGAGCCGATGCGATGAACTGG + Intronic
1012997408 6:105987015-105987037 CTGGAGCCCTGGATAAGAACTGG + Intergenic
1013842891 6:114419193-114419215 CAGGAAACATTTGGAAGAACAGG + Intergenic
1014021059 6:116590424-116590446 CAGGAGGGTTTAGGAAGAACAGG - Intronic
1015378403 6:132536655-132536677 TAGGAGACCTGGGGAAGAAGAGG + Intergenic
1016690191 6:146929127-146929149 AAGGTGCCCTTGGGAAAAAAGGG + Intergenic
1016739629 6:147513588-147513610 GAGGAGCCCTGGGGAACAGCAGG + Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017009361 6:150052911-150052933 CTGGAGCCCTGGGGAGGAGCCGG - Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1017470467 6:154733510-154733532 CAGGAGCCCGTCGGAGGAAGGGG + Intronic
1018143775 6:160864228-160864250 CAGGAGACCCCCGGAAGAACAGG - Intergenic
1018161741 6:161051373-161051395 TATGAGCCCTTAGGAGGAACGGG + Intronic
1018957444 6:168419664-168419686 CTGGAGCCCTAGGGTAGCACAGG - Intergenic
1019174254 6:170152152-170152174 AAGGAGGCCTTGGCGAGAACAGG - Intergenic
1019376734 7:696842-696864 CAGGAGGCCTTGGGAGAAAGGGG + Intronic
1019753058 7:2744882-2744904 CAGGAGCCGATGCGATGAACTGG + Intronic
1019760870 7:2811692-2811714 CAGCAGCCCTTGGGCAGCATTGG - Intronic
1019948907 7:4354927-4354949 CAGGAGCACTGGGGAGGAGCAGG + Intergenic
1019982485 7:4631682-4631704 CAGGAGCCCCGGAGAACAACAGG + Intergenic
1020202201 7:6088775-6088797 CAGGAGGTCTGAGGAAGAACAGG - Intergenic
1020381876 7:7556597-7556619 CAGAGGCCCATGGCAAGAACGGG - Intergenic
1020745832 7:12076725-12076747 TAGGTGCCCATGGGAATAACAGG + Intergenic
1022520020 7:31000295-31000317 GAGGAGCCCTTGGGAACATCTGG + Intergenic
1024385096 7:48741902-48741924 CAGATGCCCTAGGGAAGACCTGG + Intergenic
1025157647 7:56623776-56623798 AAGCACCCCTTGGGAAAAACTGG + Intergenic
1025233555 7:57218798-57218820 CAGTAGACCTGGGGAAGAGCCGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026365020 7:69639640-69639662 TAGGTGCCCTTGGGCACAACAGG - Intronic
1028927869 7:96379930-96379952 CAGAAGCACCTGGGAAGAAAAGG - Intergenic
1029654574 7:101915722-101915744 AAGGAACCCTTGGGAAGAAGAGG + Intronic
1030141396 7:106307760-106307782 CAAAAGCATTTGGGAAGAACTGG - Intergenic
1030937698 7:115606121-115606143 CAGGTGCTCATGGGAAAAACTGG - Intergenic
1033669208 7:143474396-143474418 CATGTGCCCTTGAGAAGAATGGG - Intergenic
1033946849 7:146729175-146729197 GAGGAGCCCTAATGAAGAACAGG - Intronic
1034993185 7:155560864-155560886 CAGGCGCCCTGGAGAAGAGCAGG + Intergenic
1036121335 8:6020833-6020855 CATGAGCCCCTGGGACAAACTGG - Intergenic
1036416560 8:8554888-8554910 CAGAGGCCCTTGGATAGAACTGG - Intergenic
1038492418 8:27980608-27980630 CAGGAGGCGTTGGGAAGAGGAGG - Intronic
1038672983 8:29597216-29597238 CATGAGCACTTCAGAAGAACAGG - Intergenic
1039074323 8:33676077-33676099 GAGGAACCCTTGAGAAGAATTGG - Intergenic
1039787584 8:40847503-40847525 CAGGTGCGCTGAGGAAGAACAGG + Intronic
1041730075 8:61053932-61053954 CAGCAGGCCTTGGGCAGGACTGG - Intergenic
1041746345 8:61212474-61212496 CAGGATCTCTTGGGACCAACTGG - Intronic
1041804396 8:61834301-61834323 CAAAAGCCCTTGGAAAGAAAGGG - Intergenic
1042367711 8:67955523-67955545 AAGGAGCACCTGGGAAGAAGGGG - Intronic
1042427764 8:68668872-68668894 GAGGAGTCCTTAGGAGGAACTGG + Intronic
1043009857 8:74867749-74867771 CAGGAGCCGATGTGAACAACTGG + Intergenic
1043016607 8:74947430-74947452 CAGGAGCCGATGTGAACAACTGG - Intergenic
1043094900 8:75955268-75955290 CAGAAGCACTTCTGAAGAACTGG - Intergenic
1043241640 8:77941731-77941753 CAGGAGCCGTTGCGATCAACTGG + Intergenic
1045246383 8:100445089-100445111 CAGGAGTCCATGCGAAGAGCGGG - Intergenic
1046468382 8:114636068-114636090 CAGGAGCCGATGCGAACAACTGG - Intergenic
1048438881 8:134445158-134445180 AAGGAGCCCTTGGGAAAGGCAGG + Intergenic
1049483094 8:142836704-142836726 CAGGAGCCTGTGGGAAGGCCTGG + Intronic
1051458635 9:17289787-17289809 CAGGAGCCCATGCGATCAACTGG - Intronic
1052035908 9:23680672-23680694 CAGGAGCCCTGGGCAAGGAGTGG - Intergenic
1052088975 9:24303808-24303830 CAGCAAACCTTGGGAAGAAAGGG - Intergenic
1052110781 9:24579318-24579340 CAGGAGCCCATGCGATCAACTGG - Intergenic
1052476766 9:28970826-28970848 CAGGAGTCCTAGTGATGAACTGG + Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052967123 9:34348579-34348601 ATGGAGAACTTGGGAAGAACTGG - Intergenic
1053426249 9:38012066-38012088 GAGGAGCCCCTGGGAGAAACAGG + Intronic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056652526 9:88479530-88479552 AATGAGCCATTGGGAAGCACAGG + Intergenic
1059306740 9:113359593-113359615 CAGGTGCCTTTGGGAAGGATTGG + Intronic
1060589165 9:124805180-124805202 CAAGATCCCTTCGGAAGGACGGG - Intronic
1060723595 9:125993752-125993774 CAAGAGCCCTTGGGCAGCCCTGG - Intergenic
1060878457 9:127100581-127100603 CAGGAAGCCTTGGGTACAACTGG - Intronic
1061293870 9:129666736-129666758 CCTGAGCCCTTGGTAAGAAGGGG + Intronic
1061881497 9:133571373-133571395 CAGGGCCCCTTGGGATGAGCTGG - Intronic
1062654113 9:137593356-137593378 CAGGGGCCCTAGGGGAGACCCGG + Intergenic
1185737817 X:2506417-2506439 CAGGAGGCCCTGGAAAGAATTGG + Intergenic
1187816682 X:23239741-23239763 CAGGAGCCGATGGGATCAACTGG + Intergenic
1188039022 X:25350556-25350578 CAGGTGATCTTGGGAAGAACTGG + Intergenic
1189565524 X:42237303-42237325 AAGTAGTCCTTGGGAAGAGCAGG - Intergenic
1189586850 X:42470549-42470571 CAAGAGCATTTGGGAAGAAAAGG - Intergenic
1189713266 X:43837829-43837851 CAGGAGTCCCATGGAAGAACTGG - Intronic
1190637675 X:52452253-52452275 AAGGAGCCCTTGTGACAAACAGG + Intergenic
1190639645 X:52471529-52471551 AAGGAGCCCTTGTGACAAACAGG + Intergenic
1190647974 X:52540771-52540793 AAGGAGCCCTTGTGACAAACAGG - Intergenic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1193157576 X:78190205-78190227 CAGGAGCCAATGGGATCAACTGG + Intergenic
1193825666 X:86222800-86222822 CAGGAGAGCTTGGGAAGGAGGGG + Intronic
1196171346 X:112591481-112591503 CAGGAGCCAATGGGATCAACTGG + Intergenic
1197714809 X:129699032-129699054 CAGGAGAGCTGGGGAAGAAGCGG + Intergenic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1198848153 X:140935960-140935982 CTGGAGACCCAGGGAAGAACTGG + Intergenic
1199894198 X:152116278-152116300 CAGGTCCTCTTGGGAAGGACAGG + Intergenic
1200012120 X:153127163-153127185 CAGGTGCCCTTGGCAGGGACAGG - Intergenic
1200027480 X:153272756-153272778 CAGGTGCCCTTGGCAGGGACAGG + Intergenic
1201536304 Y:15052466-15052488 CAGGAGCCGATGCGAACAACTGG - Intergenic
1201859755 Y:18584129-18584151 CAGGAGTCCTTGCCAAGACCCGG + Intronic
1201873566 Y:18736252-18736274 CAGGAGTCCTTGCCAAGACCCGG - Intronic
1201967335 Y:19752742-19752764 CAGGAGCCGATGCGAACAACTGG - Intergenic
1202167310 Y:22003502-22003524 CAGGAGTCCTTGCCAAGATCCGG - Intergenic
1202224050 Y:22582867-22582889 CAGGAGTCCTTGCCAAGATCCGG + Intergenic
1202319065 Y:23612794-23612816 CAGGAGTCCTTGCCAAGATCCGG - Intergenic
1202551704 Y:26057263-26057285 CAGGAGTCCTTGCCAAGATCCGG + Intergenic