ID: 1120872064

View in Genome Browser
Species Human (GRCh38)
Location 14:89346737-89346759
Sequence GGGACGGAACTCTCCACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120872064_1120872065 -9 Left 1120872064 14:89346737-89346759 CCAGGAGTGGAGAGTTCCGTCCC 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1120872065 14:89346751-89346773 TTCCGTCCCACCTCTTTCAGTGG 0: 1
1: 0
2: 1
3: 10
4: 132
1120872064_1120872071 30 Left 1120872064 14:89346737-89346759 CCAGGAGTGGAGAGTTCCGTCCC 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1120872071 14:89346790-89346812 AGCATTTGGAACCCTCTGAATGG 0: 1
1: 0
2: 3
3: 21
4: 224
1120872064_1120872070 16 Left 1120872064 14:89346737-89346759 CCAGGAGTGGAGAGTTCCGTCCC 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1120872070 14:89346776-89346798 AAAGAGCTACATCAAGCATTTGG 0: 1
1: 0
2: 0
3: 8
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120872064 Original CRISPR GGGACGGAACTCTCCACTCC TGG (reversed) Intronic