ID: 1120881396 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:89417344-89417366 |
| Sequence | GGGTCAGTGCCCCGCGCCCC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 243 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 21, 4: 220} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1120881396_1120881411 | 28 | Left | 1120881396 | 14:89417344-89417366 | CCTGGGGCGCGGGGCACTGACCC | 0: 1 1: 0 2: 1 3: 21 4: 220 |
||
| Right | 1120881411 | 14:89417395-89417417 | GCGCGCCCCAGCACTCAGCCAGG | 0: 1 1: 0 2: 0 3: 65 4: 527 |
||||
| 1120881396_1120881412 | 29 | Left | 1120881396 | 14:89417344-89417366 | CCTGGGGCGCGGGGCACTGACCC | 0: 1 1: 0 2: 1 3: 21 4: 220 |
||
| Right | 1120881412 | 14:89417396-89417418 | CGCGCCCCAGCACTCAGCCAGGG | 0: 1 1: 0 2: 0 3: 58 4: 488 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1120881396 | Original CRISPR | GGGTCAGTGCCCCGCGCCCC AGG (reversed) | Intronic | ||