ID: 1120881589

View in Genome Browser
Species Human (GRCh38)
Location 14:89418122-89418144
Sequence TCACCACCAGGGTGTCCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120881589_1120881592 12 Left 1120881589 14:89418122-89418144 CCAACAGGACACCCTGGTGGTGA 0: 1
1: 0
2: 0
3: 21
4: 167
Right 1120881592 14:89418157-89418179 TGTGATTGCACATTACTCCCAGG 0: 1
1: 0
2: 1
3: 14
4: 104
1120881589_1120881594 28 Left 1120881589 14:89418122-89418144 CCAACAGGACACCCTGGTGGTGA 0: 1
1: 0
2: 0
3: 21
4: 167
Right 1120881594 14:89418173-89418195 TCCCAGGTAGCCAAATTGGTTGG 0: 1
1: 0
2: 0
3: 12
4: 148
1120881589_1120881593 24 Left 1120881589 14:89418122-89418144 CCAACAGGACACCCTGGTGGTGA 0: 1
1: 0
2: 0
3: 21
4: 167
Right 1120881593 14:89418169-89418191 TTACTCCCAGGTAGCCAAATTGG 0: 1
1: 0
2: 2
3: 14
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120881589 Original CRISPR TCACCACCAGGGTGTCCTGT TGG (reversed) Intronic