ID: 1120886535

View in Genome Browser
Species Human (GRCh38)
Location 14:89456219-89456241
Sequence AGGGCCCACGGGCTCTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120886535_1120886543 3 Left 1120886535 14:89456219-89456241 CCACAAAAGAGCCCGTGGGCCCT 0: 1
1: 0
2: 1
3: 11
4: 107
Right 1120886543 14:89456245-89456267 GGTTCAAGGCTTTCATATTAGGG 0: 1
1: 0
2: 0
3: 9
4: 84
1120886535_1120886544 8 Left 1120886535 14:89456219-89456241 CCACAAAAGAGCCCGTGGGCCCT 0: 1
1: 0
2: 1
3: 11
4: 107
Right 1120886544 14:89456250-89456272 AAGGCTTTCATATTAGGGTTTGG 0: 1
1: 0
2: 1
3: 14
4: 140
1120886535_1120886542 2 Left 1120886535 14:89456219-89456241 CCACAAAAGAGCCCGTGGGCCCT 0: 1
1: 0
2: 1
3: 11
4: 107
Right 1120886542 14:89456244-89456266 AGGTTCAAGGCTTTCATATTAGG 0: 1
1: 0
2: 2
3: 6
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120886535 Original CRISPR AGGGCCCACGGGCTCTTTTG TGG (reversed) Intronic
901752888 1:11422427-11422449 AGGGCCCACTTGCTGTCTTGGGG - Intergenic
902521265 1:17018227-17018249 AGGCCCCACGAGGTCATTTGTGG + Intergenic
904254475 1:29245909-29245931 TGGGCACATGGACTCTTTTGGGG + Intronic
907677697 1:56533789-56533811 GGGGCCCAATGGCTCTTCTGAGG + Intronic
910925723 1:92396564-92396586 TGGGCACAAGGGATCTTTTGGGG + Exonic
916345797 1:163790054-163790076 AGGGCCCACTGGCACTTTGAGGG - Intergenic
918781182 1:188702415-188702437 AGGGTCAAAGGGCTCTTCTGTGG + Intergenic
922553895 1:226518512-226518534 TGGGCCCAAGGGATCTTTTTGGG + Intergenic
923713574 1:236406215-236406237 AGGGACTTCGGGCTATTTTGTGG + Intronic
1066268876 10:33802652-33802674 ATGGCCAACGGGCTTTGTTGAGG + Intergenic
1067936563 10:50617432-50617454 GGGGCCCAAGGGCAATTTTGGGG + Intronic
1069763762 10:70835916-70835938 AGGGCCCTAGGTCTCTGTTGTGG + Intronic
1070162079 10:73872925-73872947 AGGGGCCATGGTTTCTTTTGAGG - Intronic
1073545861 10:104348202-104348224 AGGTCCCAGAGGCTATTTTGGGG - Intergenic
1078935449 11:15945442-15945464 AGGGCACATGGGGTATTTTGGGG + Intergenic
1079023201 11:16925445-16925467 AGGGTGCACGGGCTCCTTTTGGG - Intronic
1080710474 11:34742443-34742465 TGGCTACACGGGCTCTTTTGTGG - Intergenic
1082230635 11:49761795-49761817 TGGGTCTACGGGCTCTTTTTTGG - Intergenic
1083593366 11:63907879-63907901 AGGGCTCACGCGCTGTTCTGGGG - Intronic
1083976815 11:66128975-66128997 GGGGCACAAGGGATCTTTTGGGG + Intronic
1084781656 11:71413757-71413779 AGGGCCCACCAGCTCTGTTTGGG + Intergenic
1088210730 11:107453496-107453518 AGGGCCTAAGGGCTCTTTAGTGG - Intronic
1095323417 12:40858265-40858287 AGGGCCCAAGCCCTCTTTTAAGG + Intronic
1095655743 12:44667868-44667890 AGGGCCCAGGGTCTCTTTTGTGG - Intronic
1103573035 12:121857491-121857513 GGGGGCCAGGGGCTCTCTTGCGG - Intronic
1103926349 12:124425577-124425599 AGGGCCCACGATCTCCTCTGGGG + Intronic
1106850745 13:33787958-33787980 AGGGCACAAGGGATCTTTTGGGG + Intergenic
1109134019 13:58625045-58625067 AGGGCCAACAGGCTCTCCTGTGG - Intergenic
1109203838 13:59459996-59460018 AGGGCCACCGGGTGCTTTTGTGG - Intergenic
1112045734 13:95595792-95595814 AGGGCCCAGAGCCTCTTTTTAGG - Intronic
1113484392 13:110643615-110643637 AAGGCGCTCTGGCTCTTTTGGGG - Intronic
1113601494 13:111572361-111572383 AGGGCTCAGGTGCTCTTTTCTGG + Intergenic
1113777408 13:112955704-112955726 TGAGCGCAGGGGCTCTTTTGGGG - Intronic
1120886535 14:89456219-89456241 AGGGCCCACGGGCTCTTTTGTGG - Intronic
1121338016 14:93089024-93089046 GGGGCCCACCGGGTCTGTTGGGG + Intronic
1121427754 14:93864849-93864871 GGGGCCCTAGGTCTCTTTTGAGG - Intergenic
1121602805 14:95218606-95218628 AGGGCCCACTGAGTATTTTGTGG + Intronic
1121846922 14:97180297-97180319 ATGGCCCCCAGGCTGTTTTGGGG - Intergenic
1122017360 14:98807641-98807663 AAGGGCCATGGGATCTTTTGTGG - Intergenic
1123040577 14:105488606-105488628 AGCGTCCACGGCCTCCTTTGGGG - Intronic
1132000895 15:98179208-98179230 AGAGTACATGGGCTCTTTTGCGG - Intergenic
1132575460 16:661807-661829 TGGGCCCAGGGGTTGTTTTGTGG + Intronic
1133156161 16:3877875-3877897 AAGGCACAGGGGCTCTTTCGTGG - Intronic
1137622333 16:49884086-49884108 AGGTCCCTCTGGCTGTTTTGTGG - Intergenic
1146820601 17:35981230-35981252 AGAGCCCACAGGGTCTTATGAGG + Intronic
1147456405 17:40540942-40540964 AGGTCTCTCTGGCTCTTTTGAGG + Intergenic
1148352323 17:46950044-46950066 AGGCCCCACGGCCTCTCTTTGGG - Intronic
1151505018 17:74521969-74521991 AGGCCTGACAGGCTCTTTTGGGG + Exonic
1153619883 18:6967784-6967806 AGGGCTCACGGGCTCTGGAGAGG - Intronic
1156489970 18:37490459-37490481 AGGGCCCATGGCCTGTATTGAGG + Intronic
1160714416 19:569626-569648 AGGGCCCATGGGGTTTTTTTTGG - Intergenic
1163726967 19:18928421-18928443 AGCGCCCACGGGTTCTGCTGTGG - Exonic
1165938027 19:39401321-39401343 AGTCCCCACGGTCTGTTTTGTGG - Intergenic
1166885227 19:45956369-45956391 GGGGCCCACAGGGGCTTTTGGGG + Intronic
1167577420 19:50324434-50324456 AGGGTCCACGGGTTCTGCTGTGG + Intronic
1167767100 19:51490707-51490729 AGGGTCCAGGGTCTCTTTGGAGG + Exonic
1167850214 19:52195531-52195553 AGGGCCAAGGGGCAGTTTTGAGG - Intronic
928636308 2:33250619-33250641 AGGGCCGAAGGGCTCTCCTGTGG - Intronic
935177427 2:100662062-100662084 AGGCCCAAAGGGCTCTTTAGTGG + Intergenic
937439247 2:121902852-121902874 TTGGCCCAGGGGCTCTCTTGGGG + Intergenic
943263324 2:185694396-185694418 AGGGCACACAGGCTATTTTAAGG - Intergenic
945816969 2:214616988-214617010 AAGGGGCACGAGCTCTTTTGAGG + Intergenic
948707103 2:239801664-239801686 TGGGCCCACGGGCTCTTCCAGGG - Exonic
1169057399 20:2634939-2634961 AGGGCTCACAGGCTCTATTGAGG + Intronic
1169235404 20:3926149-3926171 AGGGCACCTGGGCTCATTTGTGG + Intronic
1169810420 20:9604185-9604207 AGAGCCCCTGGGCTCTTCTGTGG + Intronic
1175241407 20:57552217-57552239 AGGGCCCATGGGGTGGTTTGGGG - Intergenic
1180839434 22:18952277-18952299 AGAGCCCCCTTGCTCTTTTGGGG - Intergenic
949457812 3:4257780-4257802 TGGCCACACGGGCTCTTTTTTGG - Intronic
949458634 3:4266202-4266224 TGGCCACACGGGCTCTTTTTTGG + Intronic
950375080 3:12564740-12564762 TGGGCACAAGGGATCTTTTGGGG - Intronic
950881035 3:16322800-16322822 AGGGCCCTGGGGATCTCTTGAGG + Intronic
952103306 3:30039907-30039929 AGGCTACACGGGCTCTTTTTTGG + Intergenic
954427558 3:50451420-50451442 ACGGCCCAGGGGCTGTTTTAAGG + Intronic
954673038 3:52300703-52300725 AAGACACACGTGCTCTTTTGGGG + Intergenic
954899070 3:54003451-54003473 AGGGCACATGGGCCCTTTAGAGG + Intergenic
960821562 3:121738536-121738558 AATGCCCACTGGCTCTTTTGAGG - Intronic
961683901 3:128616835-128616857 AGGGCGCACTGGGTCCTTTGGGG + Intergenic
962774927 3:138650082-138650104 AGGGCCAAGGGGCTCTCTGGTGG + Intergenic
963758202 3:149258566-149258588 AGGGCTAAGGGGCTCTCTTGTGG - Intergenic
965745051 3:171916167-171916189 AGGGCCCCCAGGCTCATTTCTGG - Intronic
966694687 3:182777808-182777830 AGGGCCAAGGGGCTCTCCTGTGG + Intergenic
966931909 3:184680909-184680931 AGGACCCAGGGGCTGTTTTACGG - Intronic
969576108 4:8036627-8036649 AAGGCCTACTGGCTCTTTTGTGG - Intronic
979605885 4:122638556-122638578 AGAGCCCATAGGCTCTTTTGGGG - Intergenic
979654998 4:123181688-123181710 TTGGCCCACTGGCTGTTTTGGGG + Intronic
979675486 4:123405504-123405526 AGGGCCCATAAGCTCTTATGAGG - Intergenic
993835023 5:92809369-92809391 AAGGCCCACTTGCTTTTTTGGGG - Intergenic
994322930 5:98414115-98414137 AGTGATCATGGGCTCTTTTGAGG + Intergenic
996802058 5:127415189-127415211 AGGCCCCACGGGCTGTATTTAGG + Intronic
999375914 5:151086379-151086401 AGGGCCGCTGGACTCTTTTGTGG - Intronic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1002906333 6:1452204-1452226 AAGTCCCACCAGCTCTTTTGAGG - Intergenic
1004838912 6:19560445-19560467 TGGGCCTATTGGCTCTTTTGTGG - Intergenic
1005592922 6:27347819-27347841 AGGGCCAAGGGGCTCTCTTGTGG - Intergenic
1006538718 6:34721809-34721831 TGGGCCCAGGGTCTCTTTTTGGG + Intergenic
1007753586 6:44084458-44084480 AGGGCCTGGGGCCTCTTTTGAGG + Intergenic
1012073785 6:94657689-94657711 AGGGCCCAGGTACTCTTTAGTGG + Intergenic
1015166781 6:130207766-130207788 AGGGCCCACTGACTCTTGTTTGG - Intronic
1019468576 7:1204628-1204650 AGTGCACACGTGCTGTTTTGGGG - Intergenic
1019599332 7:1873558-1873580 GGGGCCAAGGGGCTCTTCTGGGG + Intronic
1022523739 7:31024090-31024112 AGGGCCATCAGGCTCTGTTGTGG - Intergenic
1029489096 7:100860703-100860725 AGGGCTCACGGGCACTTTTCAGG + Intronic
1035181160 7:157090576-157090598 CAGGCCCCCGGGCTCTTGTGTGG + Intergenic
1035650276 8:1258716-1258738 AGGGTCCACTGGCTCTGGTGTGG + Intergenic
1035889694 8:3329857-3329879 ATGGCCCACAGTCTCTTTAGAGG + Intronic
1042727667 8:71894637-71894659 AAGGCCTAGGGGCTCTTTTTGGG + Intronic
1051360426 9:16277150-16277172 TGGGTCCACGGGCTCCTTTGAGG - Intergenic
1052695285 9:31869788-31869810 AGGGCCCAGGGGCTTTCTTGGGG + Intergenic
1053367980 9:37537371-37537393 AGGGCCCACGCCCTGTATTGGGG - Exonic
1061486835 9:130924421-130924443 AGGGGGCAGGGGCTCTGTTGGGG + Intronic
1061819248 9:133216518-133216540 AAGGCCCAGGGGTTCTATTGCGG - Intergenic
1061861806 9:133472230-133472252 AGCGCCCACGAGCTCCTCTGGGG - Intronic
1062467889 9:136689147-136689169 AGGCCCCACGGGCTCCATTCCGG - Intergenic
1186544843 X:10438534-10438556 AGGGCCTAAGGGAACTTTTGAGG - Intergenic
1188864628 X:35299957-35299979 AGGGCCCAAGGGCCCTTTAGAGG - Intergenic
1190177637 X:48164778-48164800 AAGGCCCACGGGCACTTGGGAGG + Intergenic
1190482237 X:50889286-50889308 AGGGCCAAGGGGCTCTCCTGTGG - Intergenic
1192329597 X:70164424-70164446 TGGGCACAAGGGATCTTTTGGGG + Intronic
1195702271 X:107714537-107714559 AGGGGCCTCGGGCACTTGTGGGG + Exonic