ID: 1120887570

View in Genome Browser
Species Human (GRCh38)
Location 14:89463744-89463766
Sequence CTGGGGAATCAGAGATATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 190}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120887564_1120887570 0 Left 1120887564 14:89463721-89463743 CCCCAAAAGTTTGGCTGTGGAGA 0: 1
1: 0
2: 0
3: 17
4: 138
Right 1120887570 14:89463744-89463766 CTGGGGAATCAGAGATATGCAGG 0: 1
1: 0
2: 1
3: 5
4: 190
1120887560_1120887570 19 Left 1120887560 14:89463702-89463724 CCATAAGTTACTAGGGCTCCCCC 0: 1
1: 0
2: 1
3: 1
4: 44
Right 1120887570 14:89463744-89463766 CTGGGGAATCAGAGATATGCAGG 0: 1
1: 0
2: 1
3: 5
4: 190
1120887565_1120887570 -1 Left 1120887565 14:89463722-89463744 CCCAAAAGTTTGGCTGTGGAGAC 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1120887570 14:89463744-89463766 CTGGGGAATCAGAGATATGCAGG 0: 1
1: 0
2: 1
3: 5
4: 190
1120887563_1120887570 1 Left 1120887563 14:89463720-89463742 CCCCCAAAAGTTTGGCTGTGGAG 0: 1
1: 0
2: 1
3: 15
4: 129
Right 1120887570 14:89463744-89463766 CTGGGGAATCAGAGATATGCAGG 0: 1
1: 0
2: 1
3: 5
4: 190
1120887566_1120887570 -2 Left 1120887566 14:89463723-89463745 CCAAAAGTTTGGCTGTGGAGACT 0: 1
1: 0
2: 0
3: 16
4: 132
Right 1120887570 14:89463744-89463766 CTGGGGAATCAGAGATATGCAGG 0: 1
1: 0
2: 1
3: 5
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120887570 Original CRISPR CTGGGGAATCAGAGATATGC AGG Intronic
902822964 1:18954756-18954778 CTGGGGAATCTGGGCTAGGCAGG + Intronic
904767184 1:32859237-32859259 CTGGAGAAGCAGAGATAGGGAGG - Intergenic
904863754 1:33560406-33560428 AGGGGGAATCAGAGGGATGCAGG - Intronic
910542011 1:88370285-88370307 CTGGAGAATCAGATGTCTGCTGG - Intergenic
911052921 1:93686946-93686968 CTGGGGAACCTGACCTATGCTGG - Intronic
915950015 1:160183467-160183489 CAGGGGAATCAGAGAAAAGAGGG - Intronic
916572806 1:166041873-166041895 CTGGGCATTCAGGGATAAGCAGG + Intergenic
919773706 1:201179517-201179539 CTGTGGAGTCAGAGAATTGCTGG + Intergenic
920461274 1:206142386-206142408 CTGGGGAATGAGGGATTTCCTGG + Intergenic
922118405 1:222636840-222636862 CTGAGGCATCTGAAATATGCAGG - Intronic
922469781 1:225868906-225868928 CTGGGGACTCAGAAATTTCCAGG + Intronic
922897722 1:229113436-229113458 CTGGGCATTCTGAGACATGCTGG - Intergenic
923078815 1:230634454-230634476 CTGGGGAATCTGAAATGTGGAGG + Intergenic
1062841101 10:672481-672503 CTGGGGAGCCAGAGATGAGCAGG + Intronic
1062947492 10:1472528-1472550 CTGGGGACTTGGAGGTATGCTGG + Intronic
1065142220 10:22728856-22728878 CTGGGGACTCAGGGCTATGCTGG - Intergenic
1071125790 10:82333332-82333354 CTGAGGAATCAGAGAGATCAAGG + Intronic
1071973087 10:90927979-90928001 CTTGGGAATCAGAGAAATTTAGG + Intergenic
1072316762 10:94211000-94211022 CTGGAGAATTTCAGATATGCTGG - Intronic
1072813514 10:98482438-98482460 CTGGGGAATCTAAGATAGGGAGG + Intronic
1073983310 10:109179223-109179245 CTGGGGTTTCAGGGAAATGCTGG - Intergenic
1074906809 10:117871408-117871430 GTGGGGAGACAGAGATATGTAGG - Intergenic
1076069494 10:127475548-127475570 CTGGGGAAGCACTGATCTGCAGG - Intergenic
1076105187 10:127816532-127816554 CTGGTGACTCAGAGATATTTAGG - Intergenic
1076607032 10:131695790-131695812 CTGGGGGGACAGAGAGATGCAGG + Intergenic
1078548890 11:12267065-12267087 CTGGGGAATCAGAAACCTGGAGG - Intergenic
1079434916 11:20438242-20438264 CTGGGGAAGCAGGGATGTTCTGG + Intronic
1080772119 11:35351335-35351357 CTGGGAAAGCAGAGATGTTCTGG - Intronic
1081248059 11:40794471-40794493 ATGGAGAATCAGAGATTTGATGG - Intronic
1082955084 11:58862331-58862353 CTGGGGAAAGAGAAATATACAGG - Intronic
1082972141 11:59035010-59035032 CTGGGGAAAGAGAAATATACAGG - Intronic
1084861621 11:72022491-72022513 CTGGGGACTCTGAGCTATTCCGG + Intronic
1084929029 11:72538991-72539013 CTGAGGCTTCAGAGAAATGCTGG + Intergenic
1086171359 11:83840133-83840155 CTGGGGATTCAGAGAAGTGATGG - Intronic
1087632144 11:100662286-100662308 CTGGGGAATCAGAGAATTATGGG + Intergenic
1088615286 11:111620621-111620643 CTGGAGAATCAAACATATGGAGG + Intronic
1088986613 11:114914746-114914768 CTTGGGAAGCAGAGAGATGAAGG - Intergenic
1089899587 11:121966759-121966781 CTGGTAAATCAAAGCTATGCTGG + Intergenic
1095293556 12:40503617-40503639 CTGGGGAATCTGAGATACTGGGG - Intronic
1096503297 12:52078559-52078581 CTGGGGCATCAGAGAGTTGGAGG + Intergenic
1096916839 12:55042096-55042118 CAGGGAAATCATAGATATACGGG - Intergenic
1097722760 12:63041383-63041405 GTGGGGAAACAGAGAGAAGCTGG + Intergenic
1098546370 12:71716334-71716356 CAGAGGAGTCAGAGAGATGCTGG + Intergenic
1099120790 12:78686901-78686923 CTGGGCTATGCGAGATATGCAGG + Intergenic
1099337235 12:81377999-81378021 TTGGGGACACAGAGATATACCGG + Intronic
1100103637 12:91141452-91141474 CTGGGGAATAAGGGATGTGAAGG - Exonic
1101431957 12:104634270-104634292 CTGGGGAATGAAAGACATTCTGG + Intronic
1101719257 12:107336960-107336982 CTGAGAATTCAGAAATATGCAGG - Intronic
1103540685 12:121664368-121664390 CTGGGGACTCAGAGACTTCCTGG + Intronic
1104132271 12:125905823-125905845 ATGGGGAATCACAGACATGGAGG - Intergenic
1106344146 13:28859486-28859508 CTGGGGAATTAGGCATGTGCTGG + Intronic
1107018586 13:35729126-35729148 CTGTGGAATCAGAAAGATGCAGG + Intergenic
1108133805 13:47333347-47333369 CTGGGTAATAAGTGATAAGCAGG + Intergenic
1109932542 13:69234905-69234927 CTGGGGAGTCAGAGATCTCCTGG - Intergenic
1111947171 13:94678028-94678050 CTGGGGACTCATGGCTATGCAGG + Intergenic
1113232409 13:108227867-108227889 CTGGGAAATCAGAAAAATGTTGG + Intronic
1115214203 14:30998367-30998389 CTGGGAAATGAGATGTATGCAGG + Intronic
1117583434 14:57175699-57175721 CTCTGGAATCAGACATATGGTGG + Intergenic
1118904174 14:70011462-70011484 CTGGGAAAAGAGAGATATGGGGG - Intronic
1119401452 14:74365405-74365427 CTGGGGGAACAGAGATAGGAGGG + Intergenic
1119742323 14:77022145-77022167 CTGAGGGATCAGAGAAAGGCTGG + Intergenic
1120490830 14:85176750-85176772 CTGGGGAAACAGTGGTGTGCAGG - Intergenic
1120887570 14:89463744-89463766 CTGGGGAATCAGAGATATGCAGG + Intronic
1121087574 14:91158142-91158164 CTGGGGAACCACAGACATTCAGG + Intronic
1121410589 14:93746011-93746033 GAGGGGAATCAGAGTTCTGCAGG - Intronic
1121675943 14:95753057-95753079 CTGAGGATCCTGAGATATGCAGG + Intergenic
1121886610 14:97548794-97548816 CTGGAGATTCAGAGAAAGGCAGG + Intergenic
1123932197 15:25177339-25177361 CTTGGGAATCAGACATAAGGAGG + Intergenic
1125739477 15:41952157-41952179 CTGGGGAATGAATGATGTGCTGG - Intronic
1128095220 15:64949135-64949157 CTGTGGAAACAGACAGATGCTGG - Intronic
1128979439 15:72175781-72175803 CTGGGGATACAGAGATGTACGGG - Intronic
1128980038 15:72179362-72179384 CTGGGAAATCCGAGATGTGGAGG + Intronic
1129332947 15:74837077-74837099 CTGGGGACTCTGGGATATGGGGG + Exonic
1130035867 15:80360982-80361004 CTGGTGAATCTGAAATCTGCAGG - Intronic
1131749337 15:95489775-95489797 CTGGGGAAAGAGAGCTCTGCTGG - Intergenic
1134061310 16:11201298-11201320 CTTGGAAATTAGAGATCTGCAGG + Intergenic
1137809355 16:51338116-51338138 CTGGGAAATAAGAGATTTCCGGG + Intergenic
1141554128 16:84825992-84826014 CTGAGGACTCATAGAAATGCAGG + Intronic
1141813415 16:86392048-86392070 CCGTGGACTCAGATATATGCAGG - Intergenic
1142516763 17:436118-436140 CTGTGGAATCACAGAAATGCTGG + Intergenic
1142909654 17:3077607-3077629 CTTGGGTATCAGAGTGATGCTGG + Intergenic
1142924842 17:3226196-3226218 CTTGGGTATCAGAGTGATGCTGG - Intergenic
1145369264 17:22295031-22295053 GTGAGGAATTAGAGATATGGGGG - Intergenic
1147859893 17:43513002-43513024 CTGGGAAAGCAGAGATTTCCTGG - Intronic
1149556021 17:57574119-57574141 CTGGGGAGACACAGATGTGCAGG - Intronic
1151325761 17:73379098-73379120 CTGGGGAGTGAGTGATATGTGGG - Intronic
1153784600 18:8523401-8523423 CAGGGGGATCAGAGATGTGGAGG + Intergenic
1153813864 18:8776243-8776265 GTGGGGAAGCAGAGCTCTGCCGG - Intronic
1156559317 18:38104480-38104502 CTGGTATATCAGAAATATGCAGG - Intergenic
1156734853 18:40243465-40243487 CTGGGGAAACAGGGAGATGTTGG - Intergenic
1160956257 19:1693405-1693427 CTGGGGAGTCAGAGAGAGACTGG - Intergenic
1162195411 19:8980815-8980837 CTGGGGACTCAGCGATGGGCTGG + Exonic
1162475497 19:10897037-10897059 CTGGGGAATCTGATCTCTGCTGG - Intronic
1164566530 19:29329741-29329763 CTGGGGAAACAGAGCCAAGCTGG + Intergenic
1164763132 19:30743225-30743247 CTGGGGAAGAAGCGATCTGCAGG + Intergenic
1166179072 19:41094477-41094499 CTGGGGACACAGAGAGAGGCTGG - Intronic
1167119803 19:47510012-47510034 CTGGGGAATCCGAGAGTTCCTGG - Intronic
925272918 2:2627221-2627243 CTGGGGAAGCTGACATCTGCAGG + Intergenic
926233399 2:11021711-11021733 ATGGGTAATCAGAGCTATCCGGG + Intergenic
929026469 2:37608727-37608749 CTTTGGAATCAGAGTAATGCTGG - Intergenic
929116000 2:38444733-38444755 CCGTGGAATCAGAGCTATGGAGG + Intergenic
932402645 2:71492212-71492234 CTGGGGAATCAGATACTGGCCGG + Intronic
932777730 2:74538367-74538389 CTGGGGAATGAGGGCTATGAGGG + Intronic
934151758 2:89154115-89154137 CTGGGGAATCACAGAGCAGCAGG + Intergenic
934215502 2:90027791-90027813 CTGGGGAATCACAGAGCAGCAGG - Intergenic
935827640 2:106967598-106967620 CTGGGGAATCACAGTTGTGTGGG + Intergenic
936428364 2:112437394-112437416 CTGCAGAAGCAGAGAAATGCGGG - Intergenic
936603573 2:113924756-113924778 CAGGGGAATGAGAGGTATGGAGG - Intronic
937191875 2:120110136-120110158 CTGTGGGATTAGAAATATGCAGG - Intronic
944556620 2:200893749-200893771 CTTGGGAATCACTGATTTGCTGG - Intronic
946290068 2:218737908-218737930 CTGGGGCAAAAGAAATATGCTGG - Exonic
946920857 2:224580926-224580948 CTGGGGAATGAAAGAAATGGGGG + Intronic
947041356 2:225924656-225924678 GAGGGAAATCAGAGATAAGCAGG - Intergenic
1168932837 20:1637839-1637861 CTGGAGAATCAGAAAAATGAGGG + Intronic
1169807299 20:9572657-9572679 ATGGGTGATGAGAGATATGCTGG - Intronic
1170372056 20:15659829-15659851 CAGGGGAAACAGACATATGAGGG + Intronic
1170517628 20:17148455-17148477 CTGGGGAGAGAGAGATAAGCTGG - Intergenic
1170932448 20:20781335-20781357 GTGGGGACACAGAGATATTCAGG + Intergenic
1173139634 20:40470856-40470878 CTGGGAAAGCAGAGACAGGCGGG - Intergenic
1174461680 20:50687469-50687491 CTGTGGAACCAGTGGTATGCTGG + Intronic
1175160587 20:57004946-57004968 CTTTGGAGTCAGAGATGTGCTGG - Intergenic
1175570580 20:60017099-60017121 CTTTGGAATGAGAGTTATGCTGG + Intronic
1176373886 21:6077817-6077839 CTGCAGAAGCAGAGAAATGCGGG + Intergenic
1179749591 21:43460426-43460448 CTGCAGAAGCAGAGAAATGCGGG - Intergenic
1181166711 22:20987825-20987847 CTGGGGACACAGAGATGAGCAGG - Intronic
1183032192 22:35114682-35114704 GTGAGGAATCAGAGACAGGCTGG + Intergenic
1183976719 22:41516522-41516544 CAGGGGAACCAGAGTTCTGCAGG - Intronic
1184740954 22:46428856-46428878 CTGGGGAGGCAGGGACATGCAGG - Intronic
1184873576 22:47258037-47258059 CTGGGGAAGCAGAGAAGAGCTGG - Intergenic
1184899323 22:47434521-47434543 TTGGGGATTCAGAGATGTGTGGG - Intergenic
1185192929 22:49450202-49450224 CAAGGGAAGCAGAGAAATGCAGG + Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
953019180 3:39103195-39103217 CTGGGGCATGAGGGATATGAGGG - Intronic
953023804 3:39133343-39133365 CTGAGGAGTCACAGATATGATGG + Intronic
954802112 3:53193421-53193443 CTGGGGAAGGAGAGACAGGCAGG + Intergenic
954873908 3:53788263-53788285 CTGGGGAAAGAGGCATATGCGGG + Intronic
955981582 3:64532703-64532725 CTGGAGAATTAGAGATACACAGG - Intronic
956042614 3:65160926-65160948 CTGAGGAATGAGACATTTGCAGG - Intergenic
957981133 3:87511739-87511761 CTGGGGGATCAGAAATTTGGAGG + Intergenic
960498541 3:118406859-118406881 CTAGGGGACCAGAGAGATGCTGG + Intergenic
961516934 3:127443867-127443889 CTGGGGAGTCAGACAGAGGCAGG + Intergenic
961811439 3:129524001-129524023 CTGAGGAATCTGGGGTATGCAGG - Intergenic
962312171 3:134334410-134334432 CTGGGGCATCAGGAAAATGCTGG - Intergenic
962581773 3:136804450-136804472 CAGGGGAAACAGGGATATTCTGG - Intergenic
963198194 3:142557655-142557677 CTGGGCTATTAGAGATATGATGG - Intronic
964272581 3:154973987-154974009 CTGGTGTCTCAGAGATATGAGGG + Intergenic
965841576 3:172911416-172911438 CTGGGGAATCAAAGAGAAGTTGG - Intronic
965996518 3:174889518-174889540 ATGGGGAATGAGAGATATAAGGG - Intronic
966266743 3:178055113-178055135 CTTGGGAGTCAGAGAGATGGGGG + Intergenic
967524975 3:190481952-190481974 CTGGTGAGTCAGGGCTATGCTGG - Intergenic
968537464 4:1143395-1143417 CTGCAGAAGCAGAGATATCCAGG - Intergenic
971551234 4:27958766-27958788 CAGGGTAATCAGAGCAATGCTGG - Intergenic
972885604 4:43482418-43482440 CTGGGACATCAGAGTTATCCCGG - Intergenic
974224535 4:59021490-59021512 GTTGGGACTCAGAGACATGCAGG - Intergenic
974544489 4:63282975-63282997 CTAAGGAAGTAGAGATATGCAGG - Intergenic
976035276 4:80810973-80810995 CTGTGGAGACAGACATATGCAGG - Intronic
984252254 4:177348565-177348587 CTGGGGACTCAGAGGATTGCAGG - Intronic
987586680 5:19864787-19864809 CTAGAAAATCAGATATATGCTGG - Intronic
987881668 5:23754247-23754269 CTTTGGTATCAGAGAGATGCAGG - Intergenic
989233737 5:39118952-39118974 GTGGGGAACCAGAGATCTACAGG - Exonic
990647558 5:57861462-57861484 CTGGAATATCAGAGATATTCTGG + Intergenic
991294173 5:65063202-65063224 CTAGGTAAGCAGAGAGATGCTGG - Intergenic
997781316 5:136661652-136661674 CTGAGTAATTATAGATATGCTGG + Intergenic
1003624502 6:7728900-7728922 GTTGGGAATCATAGATAGGCTGG - Intronic
1003923979 6:10859674-10859696 CTGGCAAGTCAGAAATATGCAGG - Intronic
1006913883 6:37582322-37582344 CAGGAGAGTCAGAGATATGGTGG + Intergenic
1007226673 6:40320324-40320346 CTGGGGAGACAAAGATGTGCAGG + Intergenic
1007265264 6:40590940-40590962 CTGGGGAATAAGAAAGATCCTGG + Intergenic
1007744695 6:44036385-44036407 CTGGGGAGTCAGAGCTGTACTGG - Intergenic
1008818049 6:55593128-55593150 CTGGGGAATCTGAGCTTTGAAGG - Intergenic
1009507724 6:64505921-64505943 CTTGAGAATCACAGCTATGCAGG + Intronic
1016765203 6:147785157-147785179 CTGGAGAATAAGAGGTATGTGGG - Intergenic
1017589585 6:155964361-155964383 TTGGGGATTCAGAAATATGAGGG - Intergenic
1017623429 6:156323248-156323270 CTTTGGTATCAGAGAAATGCTGG + Intergenic
1020145696 7:5640828-5640850 CTTTGGAATCAGCGTTATGCTGG + Intronic
1023002711 7:35828045-35828067 CTGGGAAATCAGTCATATGGGGG + Intronic
1024264239 7:47594641-47594663 CTGGGGAGGCAGAGAGCTGCAGG - Intergenic
1029157021 7:98524628-98524650 CTGGGGACTCAGGGAGGTGCAGG - Intergenic
1031854986 7:126911665-126911687 CAGGGGAAGCAGAGAAATCCAGG + Intronic
1032137910 7:129298247-129298269 CTAAGGAATCAGAAATAGGCTGG - Intronic
1036657680 8:10688421-10688443 CTGGGGATTCAGGCAGATGCAGG - Intronic
1037956218 8:23062015-23062037 CTTGGGTATCAGAGCAATGCTGG + Intronic
1039587462 8:38719256-38719278 CTGGCAAATCAGAGAAATCCCGG - Intergenic
1041463055 8:58132572-58132594 ATGGGGAAGCAGAGACATGGAGG - Intronic
1042648964 8:71018590-71018612 CTGGGAAATCAAATATATCCAGG - Intergenic
1048042363 8:130743696-130743718 CTGGGAAATCAGGGACATGTTGG - Intergenic
1056276847 9:85001935-85001957 ATGGAGCATCAGAGGTATGCGGG + Intronic
1057474085 9:95384223-95384245 CTGGGGAGGCAAAGATATGGAGG - Intergenic
1059740639 9:117146212-117146234 CTGGGGAGTCAGAGCTCAGCGGG - Intronic
1062178764 9:135179385-135179407 CTGGGGAACGAGAGCTCTGCAGG + Intergenic
1187853851 X:23617829-23617851 CTGGGGGCTCTGAGATATGGAGG - Intergenic
1189103455 X:38214055-38214077 GTGGGGAACCAGAGATAGGCAGG - Intronic
1192331037 X:70175443-70175465 CAGGGAAAGCAGAGATATGGAGG - Intergenic
1193515664 X:82459371-82459393 CTTGGGAATGTGAGATATGTTGG + Intergenic
1193736839 X:85167234-85167256 CTGGGGAATCAGAGAGATGGGGG + Intergenic
1199679362 X:150214782-150214804 CTGGGGAGGCAGAGGTCTGCTGG - Intergenic
1199695865 X:150342267-150342289 CTGGGGAGGCAGAGGTCTGCTGG + Intergenic