ID: 1120893356

View in Genome Browser
Species Human (GRCh38)
Location 14:89508732-89508754
Sequence GATCGAAACCTGCATCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120893356_1120893360 -4 Left 1120893356 14:89508732-89508754 CCTGTGAGATGCAGGTTTCGATC 0: 1
1: 0
2: 0
3: 2
4: 93
Right 1120893360 14:89508751-89508773 GATCCAGCAGGTGTGTGGTAGGG 0: 1
1: 0
2: 4
3: 31
4: 328
1120893356_1120893359 -5 Left 1120893356 14:89508732-89508754 CCTGTGAGATGCAGGTTTCGATC 0: 1
1: 0
2: 0
3: 2
4: 93
Right 1120893359 14:89508750-89508772 CGATCCAGCAGGTGTGTGGTAGG 0: 1
1: 0
2: 1
3: 17
4: 231
1120893356_1120893362 28 Left 1120893356 14:89508732-89508754 CCTGTGAGATGCAGGTTTCGATC 0: 1
1: 0
2: 0
3: 2
4: 93
Right 1120893362 14:89508783-89508805 TGCATTTTTAACAAGCACTCAGG 0: 1
1: 16
2: 122
3: 607
4: 1737
1120893356_1120893358 -9 Left 1120893356 14:89508732-89508754 CCTGTGAGATGCAGGTTTCGATC 0: 1
1: 0
2: 0
3: 2
4: 93
Right 1120893358 14:89508746-89508768 GTTTCGATCCAGCAGGTGTGTGG 0: 1
1: 0
2: 2
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120893356 Original CRISPR GATCGAAACCTGCATCTCAC AGG (reversed) Intronic
904168425 1:28573859-28573881 CACCGAAACCTCCATCTCCCGGG - Intronic
907841166 1:58158793-58158815 GATCCAGACCTGCATCTTTCTGG - Intronic
909412867 1:75374664-75374686 GATTGCAACCTGAATCACACCGG + Intronic
912818482 1:112849000-112849022 CATCGCAACCTCCATCTCCCGGG - Intergenic
916207973 1:162333669-162333691 GATCTAGCCCTGCCTCTCACTGG + Intronic
916986465 1:170197456-170197478 CATCGCAACCTCCATCTCCCAGG + Intergenic
917284276 1:173407998-173408020 GTTGGCAATCTGCATCTCACAGG + Intergenic
924248813 1:242110446-242110468 GATCTCAACCTCCATCTAACAGG - Intronic
1064546196 10:16452370-16452392 CATTGCAACCTGCATCTCTCAGG + Intronic
1065374756 10:25027459-25027481 AACCGCAACCTGCATCTCCCAGG - Intronic
1067337624 10:45377956-45377978 AAGGGAAACCTGCAACTCACCGG - Intronic
1067380467 10:45768441-45768463 AATCAGAACCTGCATTTCACAGG - Intronic
1067888169 10:50109092-50109114 AATCAGAACCTGCATTTCACAGG - Intronic
1069635747 10:69923798-69923820 CATCGACACCTGCTTCTCCCTGG - Exonic
1089281766 11:117379653-117379675 GATAGCAAACTGCAACTCACAGG - Intronic
1089404813 11:118188850-118188872 GATCACAACCTCCATCTCCCAGG + Intergenic
1090428359 11:126626123-126626145 TATAGAAACATGTATCTCACAGG - Intronic
1096875406 12:54626311-54626333 GATGGAGACATTCATCTCACAGG + Intergenic
1097661570 12:62436165-62436187 GCTCCAAACCTGCAGCTCTCAGG - Intergenic
1105666139 13:22558618-22558640 GTTCGTAACCTGAATTTCACTGG - Intergenic
1112254394 13:97816324-97816346 GATTTCAACCTGCATCTCATTGG - Intergenic
1120893356 14:89508732-89508754 GATCGAAACCTGCATCTCACAGG - Intronic
1122907688 14:104809638-104809660 CATCGCAACCTCCATCTCCCAGG + Intergenic
1202878625 14_KI270722v1_random:35280-35302 GATTCAAACCTTCAACTCACTGG - Intergenic
1125912559 15:43454437-43454459 CATCGCAACCTCCATCTCCCGGG + Intronic
1128028364 15:64459051-64459073 GTTGGCAAACTGCATCTCACAGG - Intergenic
1132330400 15:101008621-101008643 CATCGGCACCTGCGTCTCACAGG - Intronic
1143531340 17:7506035-7506057 GATCGCAACCTCCACCTCCCAGG - Intronic
1146360781 17:32175530-32175552 TATCGCAACCTCCATCTCGCAGG + Intronic
1151284663 17:73101373-73101395 AATCCAAACCTGCACCACACAGG + Intergenic
1152672159 17:81615173-81615195 CACTGGAACCTGCATCTCACGGG + Intronic
1158384090 18:56969350-56969372 GATCAAAACCAGAATCTCAAAGG - Intronic
1159445410 18:68536379-68536401 GATTGTAACCTCCATCTCCCAGG + Intergenic
1162336362 19:10063148-10063170 CACCGAAACCTCCATCTCCCGGG + Intergenic
1202654246 1_KI270708v1_random:4328-4350 GATTCAAACCTTCAACTCACTGG - Intergenic
930357732 2:50343551-50343573 TCTCAAAACCTGCTTCTCACAGG + Intronic
932409024 2:71534399-71534421 GATCCAAACCAGCAGCTCACAGG - Intronic
935162887 2:100544401-100544423 GATCGAGGTCTGCATCTCACAGG - Intergenic
938775325 2:134536627-134536649 GAGCGAAACCTCTATCTCATAGG + Intronic
943603358 2:189947512-189947534 GATTCAAACCTGCATCTTTCTGG - Intronic
1171370369 20:24658496-24658518 CCTCGAAACCTGCAGGTCACTGG - Intronic
1172542124 20:35726899-35726921 CATCACAACCTCCATCTCACGGG + Intronic
1174383829 20:50174530-50174552 CATCGCAACCTCCATCTCCCGGG - Intergenic
1176639933 21:9292727-9292749 GATTCAAACCTTCAACTCACTGG - Intergenic
1179593925 21:42429758-42429780 GATAGAAACATGCATCTCCTGGG - Intronic
1180348947 22:11782100-11782122 GATTCAAACCTTCAACTCACTGG - Intergenic
1180373235 22:12065554-12065576 GATTCAAACCTTCAACTCACTGG - Intergenic
1180389253 22:12210096-12210118 GATTCAAACCTTCAACTCACTGG + Intergenic
1180416689 22:12724380-12724402 GATTCAAACCTTCAACTCACTGG - Intergenic
955777489 3:62449202-62449224 GATAGAGACCTCCACCTCACTGG + Intronic
956144140 3:66175298-66175320 CATTGAAACCTCCATCTCCCAGG + Intronic
956543508 3:70372385-70372407 CATTGCAACCTCCATCTCACAGG + Intergenic
957100261 3:75818028-75818050 GATTCAAACCTTCAACTCACTGG + Intergenic
958526559 3:95268212-95268234 GATCAGAAACTGAATCTCACAGG + Intergenic
960664927 3:120099565-120099587 GAACGAAAACTCCATCTCAAAGG - Intergenic
968311445 3:197687115-197687137 GATGGAAACCGGCATCAAACTGG - Intronic
970539428 4:17062401-17062423 GCTTGAAAACTGCATCTGACTGG - Intergenic
972243013 4:37214240-37214262 GATGCAAACCTGCCTCTTACAGG + Intergenic
972978426 4:44665825-44665847 CATCGGAACCTGCCTATCACAGG - Intronic
973685392 4:53365103-53365125 GACAGAACCCTGGATCTCACAGG - Exonic
973975671 4:56259976-56259998 GACTGAAACCTGCATCTCTGAGG - Intronic
982551954 4:156813254-156813276 GGTGGTAACCTGCATCACACAGG - Intronic
983246788 4:165296656-165296678 TATCGGAACCTGCTGCTCACTGG - Intronic
1202754827 4_GL000008v2_random:51119-51141 GATTCAAACCTTCAACTCACTGG - Intergenic
989582097 5:43042702-43042724 GATCAAAACCAGCAACTCAGTGG + Intronic
999107266 5:149084941-149084963 GATCAGAATCTGCATCTTACTGG - Intergenic
1002704685 5:181152474-181152496 TAACGAGAGCTGCATCTCACAGG - Intergenic
1003218014 6:4132838-4132860 CATTGCAACCTGCACCTCACAGG + Intronic
1004889637 6:20088203-20088225 GATCTAAACTTTCATCTCAGAGG - Intergenic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1011968187 6:93186711-93186733 GATTGAAAGCTGCACATCACTGG - Intergenic
1013310007 6:108884907-108884929 GATGGAACCCTGCATGGCACTGG + Intronic
1017451877 6:154561954-154561976 AATCTCAACCTGCAACTCACTGG + Intergenic
1021981329 7:26058516-26058538 GTGGGAAGCCTGCATCTCACAGG + Intergenic
1024310612 7:47965846-47965868 GATGGATCCCTGCATCTCAACGG + Intronic
1025938363 7:66055102-66055124 TATTGAAACCTCCATCTCCCAGG - Intergenic
1030394339 7:108966801-108966823 AACCGAAACCACCATCTCACTGG + Intergenic
1030784601 7:113644562-113644584 CATTGCAACCTCCATCTCACTGG - Intergenic
1032768893 7:135027903-135027925 GAACTAAACCTGCATCTCTGAGG - Intronic
1034646162 7:152649826-152649848 GAGAGCAGCCTGCATCTCACTGG - Intronic
1034954495 7:155326249-155326271 AATAGAAACCTCCTTCTCACAGG + Intergenic
1041164915 8:55081798-55081820 GATGGAAAGCGGCCTCTCACAGG - Intergenic
1043137212 8:76543304-76543326 GATCAAAGCCTGTATCTTACAGG - Intergenic
1043142451 8:76606943-76606965 GAGCGAAACCTGTAATTCACAGG + Intergenic
1046165960 8:110436004-110436026 GATCCAAACCTTCATTTCTCAGG + Intergenic
1047235538 8:123039161-123039183 GATCCAAACCACCATCTCTCTGG + Intronic
1048940208 8:139393967-139393989 GATACAAACCTGCAGCTCAAAGG + Intergenic
1052987033 9:34495285-34495307 ACTGGAAACCTGCATCTCCCAGG + Intronic
1060804837 9:126568682-126568704 CATCGCAACCTGCATCTCCTGGG - Intergenic
1203535621 Un_KI270743v1:35840-35862 GATTCAAACCTTCAACTCACTGG - Intergenic
1203649851 Un_KI270751v1:105952-105974 GATTCAAACCTTCAACTCACTGG + Intergenic
1187393717 X:18902683-18902705 CATCGCAACCTCCATCTCCCAGG - Intronic
1190356581 X:49611486-49611508 CATTGAAACCTCCATCTCCCAGG + Intergenic
1193291269 X:79776337-79776359 CATCGCAACCTCCATCTCCCCGG + Intergenic
1199987051 X:152960036-152960058 GAGAGAAACCAGCATCTCAGGGG + Intronic
1201169828 Y:11247334-11247356 GATTCAAACCTTCAACTCACTGG + Intergenic