ID: 1120893522

View in Genome Browser
Species Human (GRCh38)
Location 14:89509707-89509729
Sequence GCCCATTATGTGTCCTGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 62}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120893522 Original CRISPR GCCCATTATGTGTCCTGTAC TGG (reversed) Intronic
901776803 1:11565671-11565693 GCCCATTTTGTGGGCTGTAGTGG + Intergenic
905813862 1:40932664-40932686 ACCTATCATGTGTCCTGTGCTGG + Intergenic
907577619 1:55541587-55541609 TCACAGTAAGTGTCCTGTACAGG + Intergenic
908322681 1:62993292-62993314 GCACACTATGTCTCCTGGACTGG + Intergenic
911503353 1:98716509-98716531 GCTCATTATGTTTCCTGCATGGG + Intronic
914438242 1:147679836-147679858 GCCCATGATGTGTCCAGAATTGG + Intergenic
1063704069 10:8413876-8413898 ACCCATTATGTGCCCTGGACTGG + Intergenic
1065441686 10:25759120-25759142 ATCCAATATGTGTCCAGTACTGG + Intergenic
1077545800 11:3169206-3169228 GCCCATTCTGTTTCCTTTCCGGG + Intergenic
1094222752 12:28012240-28012262 GCAAATTATGTGTCCAGTCCTGG - Intergenic
1098407631 12:70142597-70142619 ACCCATTATGTGGACTTTACTGG - Intergenic
1104323060 12:127770353-127770375 GCCCGTTATGTGTCAGGCACAGG - Intergenic
1106947243 13:34842302-34842324 GCCCGTTCTGTGGGCTGTACAGG - Intergenic
1108714302 13:53063814-53063836 GCCCTCTCTGTGTCCGGTACAGG + Intergenic
1112191633 13:97183874-97183896 GCTGATTATTTGGCCTGTACAGG + Intergenic
1119831442 14:77706619-77706641 AGCCATTATGTGTCTAGTACAGG - Intronic
1120893522 14:89509707-89509729 GCCCATTATGTGTCCTGTACTGG - Intronic
1121243469 14:92446685-92446707 GCCCACTATGTGTCCAGCATGGG - Intronic
1126658377 15:51005536-51005558 GCACAGCATGTGTCCTGTAGAGG + Exonic
1130576509 15:85097530-85097552 GACCATTATGTGGCCACTACCGG - Intronic
1140056696 16:71531649-71531671 GCCAGTTCTGTGTCCTGTGCGGG - Intronic
1154498165 18:14977683-14977705 GCCCTTTATCTGACCTGTGCAGG + Intergenic
1158019414 18:52823802-52823824 CCCCATTATGTATCCCGTACAGG - Intronic
1158674609 18:59506912-59506934 TCCCATTCTCTGTCCTGTACTGG + Intronic
1159475745 18:68918646-68918668 GCTCATTATGTCTTCTGTTCAGG - Intronic
935623688 2:105150739-105150761 GCACATTATGTGCTCTTTACTGG - Intergenic
939919701 2:148094236-148094258 GCTCATTATTTGTACTCTACTGG + Intronic
946823151 2:223650231-223650253 CCCCATTATGCCTCCTGCACAGG + Intergenic
1168851306 20:978895-978917 GCCCCTTAGGTGTCCTGTATTGG - Intronic
1175578970 20:60084360-60084382 GGACATTATCTGTCCTGTTCTGG - Intergenic
1179245345 21:39628700-39628722 TCCCATTAGGTCCCCTGTACAGG - Intronic
1179315796 21:40243469-40243491 ACTGATTATGTCTCCTGTACAGG - Intronic
1181729254 22:24832723-24832745 GCCCATTCTGTGTACCGTAAGGG - Intronic
1183079249 22:35446008-35446030 GCCCACTATGTGTCAAGCACTGG - Intergenic
950250405 3:11460645-11460667 TCCTATTGTGTGTCTTGTACAGG - Intronic
951401096 3:22232019-22232041 AGCCACTATGTTTCCTGTACAGG + Intronic
955426171 3:58792953-58792975 GCCAATGATGTTTCCTGTAAGGG + Intronic
958021609 3:88004161-88004183 GCCCATTAGCTGTCCTGCAGAGG + Intergenic
960252313 3:115469676-115469698 GCCCATGATGGGTGCTGTATTGG + Intergenic
960953017 3:123011835-123011857 GCTCATTCTGTGTCCTGGAGAGG - Intronic
963115436 3:141724975-141724997 GCCCATTGGGTGTCCAGCACAGG + Intergenic
967504434 3:190238219-190238241 GGGCATTATGGGTCCTCTACAGG + Intergenic
969200966 4:5605642-5605664 GCACATTATCTGTCCTGCCCAGG + Intronic
970492350 4:16587241-16587263 GCACATAGTGTGTCCTCTACAGG - Intronic
970714820 4:18908637-18908659 TGCCATTATGCTTCCTGTACAGG + Intergenic
972900857 4:43681385-43681407 GCTTATTATGTGTCCTCAACAGG + Intergenic
973590438 4:52435381-52435403 CCACATTATGTGTTCTGGACTGG + Intergenic
974908160 4:68082581-68082603 GCCCAGTATGAGTGCTTTACTGG + Intronic
976344208 4:83981526-83981548 TTCCATTATCTGTCCTGCACAGG + Intergenic
983459973 4:168015647-168015669 GCCCATTATGTGTTGAGTTCTGG - Intergenic
988569720 5:32352281-32352303 GGCCAGTATTTGTCCTTTACTGG + Intergenic
989395189 5:40947754-40947776 GCAGATAATGTGTCCCGTACTGG - Exonic
1006032555 6:31187871-31187893 GCCCATTATGTGCCAAGAACTGG + Intergenic
1008042827 6:46819842-46819864 GCCCTTTATGTGGGCTGTGCTGG + Intronic
1015733734 6:136375448-136375470 ACCTATAATATGTCCTGTACTGG - Intronic
1023922402 7:44639708-44639730 GCCCATTCTGTCTCCAGGACTGG - Intronic
1024236540 7:47403042-47403064 GCCCCTTATGTGGCCCGTACTGG - Intronic
1031867846 7:127058872-127058894 GCCCATTATGTTTAATGAACTGG - Intronic
1039833831 8:41239154-41239176 TCACAGTAAGTGTCCTGTACAGG + Intergenic
1059308056 9:113370065-113370087 GCCCATCATGTGTCCTTCCCGGG + Exonic
1060752267 9:126180206-126180228 CCCAATTATGTGTCATGTATAGG - Intergenic
1189140363 X:38598772-38598794 GCTCATTATGGGTTCTATACTGG - Intronic
1194759781 X:97782008-97782030 GCCTATTATGTGGTCTGTCCTGG - Intergenic
1195907393 X:109858345-109858367 GCGCATTCTGTGTTCTGCACTGG - Intergenic
1198081184 X:133241093-133241115 ACCCATTCTGTATCCTGCACAGG + Intergenic
1199634472 X:149802582-149802604 CTGGATTATGTGTCCTGTACTGG - Intergenic
1199789568 X:151139849-151139871 TGCCATTTTGTATCCTGTACTGG + Intergenic
1201719137 Y:17078002-17078024 GCCATATATGTGTCCTGCACAGG - Intergenic