ID: 1120894138

View in Genome Browser
Species Human (GRCh38)
Location 14:89514736-89514758
Sequence CAAGATGCACAGATGGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120894138 Original CRISPR CAAGATGCACAGATGGAGTG AGG (reversed) Intronic
901522609 1:9796863-9796885 CAGAATGAACAGATGGAATGTGG + Intronic
903292919 1:22326074-22326096 GAAGATTCACAGAGGGAGGGAGG - Intergenic
906900252 1:49828415-49828437 CAAGAAGTAAAGATGGTGTGGGG + Intronic
910251102 1:85200603-85200625 CAGGATGGACGGCTGGAGTGGGG - Exonic
910493491 1:87799425-87799447 GAAGAAGCAGGGATGGAGTGGGG - Intergenic
911206529 1:95096831-95096853 CAAGACGCACACATGGTGTGAGG - Intergenic
912692975 1:111818591-111818613 CCAGGGGAACAGATGGAGTGCGG + Intronic
913336234 1:117710972-117710994 TAAGTGGCACAGATGGGGTGTGG + Intergenic
914685024 1:149970877-149970899 AAAGATGCAGAGACGCAGTGAGG + Intronic
915372951 1:155366906-155366928 CAAGATGCACAGATTGCCTGAGG - Intronic
915475061 1:156148351-156148373 CGAGATGCAGAGAGGCAGTGAGG + Intronic
915642558 1:157240329-157240351 CAGGATGCACAAATGGCCTGTGG + Intergenic
919153227 1:193726875-193726897 CAACATGAGCAGAAGGAGTGTGG + Intergenic
921521623 1:216162772-216162794 AAGGATGCACACATGGAGTTTGG - Intronic
922011704 1:221595420-221595442 TAAGATGCTGAGATGGAGTTGGG + Intergenic
922130293 1:222771019-222771041 CAAGGTGGACAGATGGCTTGAGG + Intergenic
922605119 1:226885401-226885423 CATGCTGCCCTGATGGAGTGCGG - Intronic
923029393 1:230235426-230235448 GAAGATGGGGAGATGGAGTGAGG - Intronic
923065423 1:230513132-230513154 CCAGATGCATAAATGGAGAGCGG - Intergenic
1063146443 10:3298954-3298976 GCAGATGCCCAGAGGGAGTGAGG - Intergenic
1063209030 10:3862032-3862054 CACCATGCCCAGATGGAATGTGG - Intergenic
1063532139 10:6843746-6843768 CAAGATGAACAGCAGGAGTCAGG + Intergenic
1067846351 10:49724911-49724933 CAAGATGGACAGATTGCTTGAGG + Intergenic
1069032924 10:63617123-63617145 CAGCATGCACAGAGGCAGTGAGG - Intronic
1070623978 10:78035859-78035881 TAAAATGCACAGGTGGAGTACGG + Intronic
1071116891 10:82232450-82232472 CAAGCAACACAGAGGGAGTGGGG - Intronic
1071212346 10:83358479-83358501 CAAGATGTGGAGATGGAGGGGGG - Intergenic
1071664349 10:87539789-87539811 TAAGAACCACAGATGCAGTGAGG + Intronic
1073054223 10:100688776-100688798 CAGGAGGCAGAAATGGAGTGAGG + Intergenic
1073956919 10:108883162-108883184 CTAGAAGCTCAGATGGAGAGGGG + Intergenic
1074058896 10:109946948-109946970 GAAGATGCACAGATGAATCGTGG - Intronic
1077479921 11:2808973-2808995 ATAGATGCAGAGATGGAGGGAGG + Intronic
1077555664 11:3224907-3224929 CATGATGCCCAGCTGGAGAGAGG - Intergenic
1079338359 11:19590899-19590921 TAAGATGGACAGAAGGACTGTGG - Intronic
1079604620 11:22349435-22349457 TAAGATGAATAGATGGATTGAGG + Intronic
1079897676 11:26142482-26142504 AAAGATGAACAGATGGAATGAGG + Intergenic
1080172193 11:29318309-29318331 CAAGTTCCACAGATGCACTGTGG + Intergenic
1080588851 11:33704044-33704066 CCAGATGCAGAGCTGGAGTGGGG - Intronic
1081325079 11:41734688-41734710 CAGGAAGCACAGCTGGAATGGGG + Intergenic
1084194765 11:67518207-67518229 GAAGATGCTGAGATGGAGTTAGG + Intergenic
1086338771 11:85826230-85826252 CAGGATGCACAGGAGGACTGAGG + Intergenic
1087094117 11:94304241-94304263 CAGGATGCAGAGATGAAGTGTGG - Intergenic
1088376900 11:109151246-109151268 CAAGATACAGAGATGCAGAGTGG - Intergenic
1090491923 11:127171548-127171570 CAACATGAACAGATGAAGTGAGG - Intergenic
1090856426 11:130612723-130612745 CAGGAAGCATAGGTGGAGTGAGG + Intergenic
1090904974 11:131067019-131067041 CCAGACGCTGAGATGGAGTGGGG - Intergenic
1092510976 12:9156359-9156381 CAAGATCCAGAGATGGAGGAAGG - Intronic
1097825735 12:64173093-64173115 CAAGAAGAGCAGATGGGGTGGGG - Intergenic
1098603846 12:72365976-72365998 GAAGATGCAAAGATGGAGAAAGG - Intronic
1098991383 12:77067707-77067729 CAAGAGCCCCAGAGGGAGTGTGG - Intergenic
1102514890 12:113439805-113439827 CAGCATGCCCAGCTGGAGTGAGG - Intergenic
1103583339 12:121932923-121932945 CAGGATGCGCAGATGGGCTGGGG + Intronic
1103690912 12:122774053-122774075 CAAGAATCACAGATGAAGAGGGG - Intergenic
1107343673 13:39437410-39437432 CAAGAGGAAAAGAGGGAGTGGGG - Intronic
1108637874 13:52353845-52353867 CATCATGCAGAGTTGGAGTGAGG - Intergenic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1109294910 13:60518305-60518327 TAAGATGCACAGCTTGAGAGGGG - Intronic
1110551340 13:76814205-76814227 CAATATGCAGAGATATAGTGTGG + Intergenic
1111519689 13:89384515-89384537 CAAGGTGGACAGATCCAGTGAGG + Intergenic
1112066605 13:95799750-95799772 CAAGATGCAAACAGGGAGGGGGG + Intergenic
1115515163 14:34177775-34177797 AAGGATGCAAAGATGGAATGTGG + Intronic
1118003313 14:61543492-61543514 TAAGCTGCACAGAGTGAGTGAGG - Intronic
1118546275 14:66893046-66893068 CAAGTGACACAGATGGTGTGAGG + Intronic
1118839045 14:69497426-69497448 CAAGATGCATACATGGGATGTGG + Intronic
1118916704 14:70113730-70113752 CAACATGCACAGATAGAGCCAGG + Intronic
1119032009 14:71200142-71200164 CAAGATGCACAGATGCAGTAAGG + Intergenic
1119180345 14:72600931-72600953 AAAGAGGCAAAGATGAAGTGGGG + Intergenic
1120894138 14:89514736-89514758 CAAGATGCACAGATGGAGTGAGG - Intronic
1121454360 14:94028810-94028832 CAATATGCTCTGAGGGAGTGGGG + Intronic
1124864116 15:33472462-33472484 CCAGATGCTCAGAAGGAGGGAGG + Intronic
1127981840 15:64041186-64041208 AAAGATGGACAGGAGGAGTGAGG + Intronic
1129185689 15:73904854-73904876 CAAAACACACAGATGGAGGGAGG + Intergenic
1130684772 15:86027344-86027366 AAAGAGGGACAGATGGAGGGAGG - Intergenic
1130752888 15:86731638-86731660 CAAGATACAAAGATAGAGAGAGG + Intronic
1131086698 15:89581625-89581647 CAATATGCCTAGAAGGAGTGGGG + Intronic
1132698731 16:1213264-1213286 CCAGACCCAGAGATGGAGTGGGG + Intronic
1133781627 16:8943430-8943452 CGAGCTGCACAGATGCAGTTAGG + Intronic
1133836576 16:9373091-9373113 GAAGCTACACAGCTGGAGTGTGG + Intergenic
1134896288 16:17889780-17889802 CAAGATGCACAGACAGAGCTTGG - Intergenic
1135017894 16:18939274-18939296 CAGGATGCAGAGATAGCGTGGGG + Intergenic
1135940317 16:26816731-26816753 CAGGATGGACAGAGGGAGAGGGG - Intergenic
1137519282 16:49178395-49178417 CATGGAGCACAAATGGAGTGAGG - Intergenic
1138189044 16:54999358-54999380 CACGCTGCACAGATGGAGGCTGG + Intergenic
1141565411 16:84898371-84898393 GAAGATGCACAGAGAGGGTGGGG - Intronic
1141713374 16:85713207-85713229 CAAGAGGTAGAGATGGGGTGAGG - Intronic
1141743660 16:85911605-85911627 GAAGTTACAGAGATGGAGTGCGG + Exonic
1141986479 16:87583747-87583769 CAAGAAGCACAGTGGGAGAGTGG + Intergenic
1143087272 17:4425540-4425562 AAAGTTTCACAGATGGAGGGTGG - Intergenic
1144944447 17:18962620-18962642 CAAGGTGCCCAGGTGGAGCGGGG + Intronic
1146638973 17:34526064-34526086 CAAGAGGCAGAGTTGGGGTGTGG - Intergenic
1147969977 17:44213998-44214020 AAAGATGCAGGGAGGGAGTGAGG - Intronic
1148797129 17:50202359-50202381 CATGATTGAGAGATGGAGTGGGG + Intergenic
1148825883 17:50393811-50393833 CAAAGTGTACAGAAGGAGTGCGG + Intronic
1149433865 17:56617095-56617117 AAAGATGCAAAGGGGGAGTGGGG - Intergenic
1149937298 17:60820692-60820714 AAAGATGCCCTGATGGAATGGGG + Intronic
1151551280 17:74823858-74823880 CAAGGTGCACAGTTGGATCGAGG + Intronic
1151834396 17:76573479-76573501 CAAGAAGCACAGAGGGTGGGAGG + Intronic
1156382628 18:36578028-36578050 CAACATGGTCAGATGGAGTGGGG + Intronic
1156861409 18:41840637-41840659 CCAGATGCACAGGAGAAGTGTGG + Intergenic
1157303439 18:46497906-46497928 CAGGATGCACAGTGGGAGTTAGG + Intronic
1160211261 18:76882060-76882082 CTAGAAGCACAGAGGGAGGGCGG - Intronic
1162121546 19:8472654-8472676 CAGGAGGCAGAGATTGAGTGCGG - Intronic
1162179639 19:8859283-8859305 CAAGCTGGACAGATGGATGGAGG - Intronic
1162426149 19:10597331-10597353 CAAGATGGGCAGATCGATTGAGG + Intergenic
1164867438 19:31616451-31616473 CAAGATGAAAATATGGAGTTCGG + Intergenic
1167439736 19:49501089-49501111 CAAGGGGCAAAGAGGGAGTGTGG + Intergenic
1167919308 19:52769588-52769610 CAAGATGCAGAGATGGGTAGTGG - Intronic
925584306 2:5447976-5447998 CAAATTGCAGAGATGGAATGAGG - Intergenic
928301507 2:30129558-30129580 CAGGAAGTAGAGATGGAGTGTGG + Intergenic
929231565 2:39565592-39565614 TAAGATGCACAAAAGGTGTGAGG + Intergenic
930865279 2:56116639-56116661 AAAGAGTCAGAGATGGAGTGGGG - Intergenic
931146753 2:59527753-59527775 AAAGGAGCACAGATGGAATGAGG - Intergenic
933026297 2:77263404-77263426 CAAGTTGGACAGATGTTGTGGGG + Intronic
933532612 2:83529728-83529750 CCAGATGCTCAGATGGAGCTTGG + Intergenic
936040372 2:109145238-109145260 CCACAGGCACAGATGGACTGGGG - Intronic
937115076 2:119399175-119399197 CAAGATGCACAGTTGGTAAGGGG + Intergenic
938928635 2:136066747-136066769 CAAGATTCACAGATGGAGGATGG + Intergenic
939718468 2:145616026-145616048 CAAGAGGCAAAGATAGATTGTGG - Intergenic
940642999 2:156366818-156366840 CAGGATGCACAGAGTGAGAGAGG + Intergenic
942123092 2:172797976-172797998 CAAGATACAAAGATGGAGAAAGG - Intronic
942877590 2:180820063-180820085 CAAGAAGTACAGATGAAGTATGG - Intergenic
944380805 2:199108398-199108420 CAAGATGTACAAATTAAGTGAGG - Intergenic
948122322 2:235540053-235540075 CAGGATGGACAGATGGACAGTGG + Intronic
948357071 2:237387128-237387150 CCAAAAGCAAAGATGGAGTGAGG - Intronic
1168855583 20:1005443-1005465 CAAGATGCTCAGAGGGTGTTTGG + Intergenic
1172957379 20:38770804-38770826 CAACATGCACAAATGGAGGTGGG - Intronic
1174367466 20:50065207-50065229 AAAGATGCACAGCTGGGGAGTGG - Intergenic
1174519620 20:51119430-51119452 CAAATTGCACACATGCAGTGGGG + Intergenic
1175727071 20:61325844-61325866 CAAGAAGCACACATGGTGTTGGG - Intronic
1178335301 21:31737199-31737221 GAAGATGCACAAAAGGAGTCAGG - Intergenic
1178610681 21:34076081-34076103 CAAGATGCACAAATGATTTGGGG - Intronic
1180593133 22:16957404-16957426 CATGCTGCCCAGATGCAGTGAGG - Intergenic
1181069510 22:20323800-20323822 CAAGATGGGCAGATGGCTTGAGG + Intergenic
1181692733 22:24573948-24573970 CAAGCCGCACACCTGGAGTGGGG + Intronic
1183088950 22:35508215-35508237 CACGAGGCACACAAGGAGTGAGG - Intergenic
1184001922 22:41681089-41681111 GAAGATACGCATATGGAGTGGGG - Intronic
1184395102 22:44230572-44230594 CAATATTCAATGATGGAGTGGGG - Intergenic
1184395148 22:44230969-44230991 CAATATTCAATGATGGAGTGGGG - Intergenic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
949576414 3:5343075-5343097 AAAGAGGCAGAGATGGATTGGGG - Intergenic
952169479 3:30791083-30791105 CAAGATGCAATGAGGGTGTGTGG + Intronic
952826983 3:37532261-37532283 CACGAGGCACAGATAGGGTGAGG - Intronic
953744593 3:45564618-45564640 CAAGAAGCATACATGGTGTGGGG - Intronic
954870060 3:53761075-53761097 GAAGTTGAACAGATGGAGTTGGG + Intronic
956739393 3:72263470-72263492 CAGGAAGCTCAGAAGGAGTGGGG - Intergenic
959625238 3:108442321-108442343 AAAGAAGCACAGATGGAGAGAGG + Intronic
961203643 3:125063609-125063631 CCAGACTCACAGAGGGAGTGAGG - Intergenic
961434372 3:126906463-126906485 CACGAGGCACAGATGCAGGGAGG - Intronic
962935836 3:140080079-140080101 CAAGTTGCACAGCTAGAGTGAGG + Intronic
965139031 3:164812185-164812207 CAAGATGCACAGATCACCTGAGG + Intergenic
966198259 3:177335183-177335205 GAAGATGTAGGGATGGAGTGGGG - Intergenic
969502519 4:7561760-7561782 ACAGATGGACAGATGGATTGAGG - Intronic
969502670 4:7562802-7562824 GCAGCTGCAGAGATGGAGTGGGG - Intronic
969629085 4:8324943-8324965 CAGGATGCACAGCTGGAGGGTGG + Intergenic
970914063 4:21311784-21311806 CAAGATGAACAGATGCAGTGAGG + Intronic
972336630 4:38112818-38112840 CAGGTCACACAGATGGAGTGTGG - Intronic
972459549 4:39288018-39288040 CAACACACACAGAGGGAGTGAGG + Exonic
972850203 4:43039791-43039813 GAAGAAGCACACATGGGGTGGGG - Intergenic
973767443 4:54176059-54176081 CTAGAAGGACAGATGGAGAGAGG + Intronic
975914980 4:79313819-79313841 CAAGATGCCCAGATGGTGATGGG + Intronic
978295355 4:107198640-107198662 TAATAGGCACAGATGGTGTGGGG + Intronic
978612455 4:110558525-110558547 CAAGGTGGACAGATGGCTTGAGG - Intronic
979192671 4:117881974-117881996 CAAGATGCTCAGATGGAATATGG + Intergenic
981047510 4:140278868-140278890 CAAGAAGAACAGATGGGGTTGGG - Intronic
983258797 4:165432750-165432772 AAAGATGAACAGAGAGAGTGGGG - Intronic
983994679 4:174167354-174167376 CAAAATGCTCAAATTGAGTGAGG + Intergenic
984329691 4:178298574-178298596 GTAGATGCAGAGATGAAGTGTGG - Intergenic
984521105 4:180801937-180801959 CAAGGGGTACAGATGGAATGGGG - Intergenic
985571218 5:646581-646603 CAAGAGGAACAGCTGGTGTGGGG - Intronic
985614919 5:914307-914329 CAAGATGCACAGCTGCACTAGGG - Intronic
985822321 5:2168808-2168830 CATAAAGAACAGATGGAGTGTGG - Intergenic
986292975 5:6415200-6415222 GAAGATGCAGAGATGCAGAGGGG - Intergenic
987662927 5:20900569-20900591 CAAGATTCACAGCTAGAGAGTGG - Intergenic
988453425 5:31365661-31365683 CATGATACTCAGATGGAGAGAGG + Intergenic
988759764 5:34301618-34301640 CAAGATTCACAGCTAGAGAGTGG + Intergenic
991003582 5:61806558-61806580 CAAGAGGCTCAGATGAGGTGGGG - Intergenic
991897199 5:71416048-71416070 TAAAAGGAACAGATGGAGTGCGG + Intergenic
992179815 5:74184913-74184935 CCACATGGCCAGATGGAGTGTGG - Intergenic
992307997 5:75463595-75463617 CAAAATTCACAGTTGGAATGTGG + Intronic
992359764 5:76025063-76025085 GAACACACACAGATGGAGTGTGG - Intergenic
993868808 5:93225559-93225581 CAAGGTGCTCAGAAGGAGTGAGG + Intergenic
994747495 5:103696890-103696912 CAAGAGGCAAAGATGAAGTGGGG - Intergenic
996848931 5:127931492-127931514 CAATATGCACAGCTGGAGGAGGG - Intergenic
998898757 5:146829509-146829531 CAAGAGGCACAGATAAGGTGGGG + Intronic
998977315 5:147662586-147662608 CAAGCAGCAGAGATGAAGTGGGG - Intronic
1000177938 5:158776634-158776656 AAAGAACCACAGGTGGAGTGCGG - Intronic
1001257959 5:170199554-170199576 TAAGATGTGCTGATGGAGTGTGG - Intergenic
1002317149 5:178350604-178350626 CAAGAGCCACAGAGGAAGTGTGG + Intronic
1002544787 5:179933106-179933128 CAAGATCCACAGAAGGACTTGGG + Intronic
1006289690 6:33125189-33125211 GAAGATGCACACATTGAGTAAGG + Intergenic
1007109980 6:39307743-39307765 CAAGATGCAAAGTGGCAGTGAGG - Intronic
1008497823 6:52151058-52151080 CAAGTGGCACAGCTGGAGAGTGG - Intergenic
1010682615 6:78814279-78814301 CAAAAGGCAAATATGGAGTGTGG + Intergenic
1010715219 6:79221313-79221335 CGAGATGGGCAGAGGGAGTGTGG + Intronic
1011542344 6:88445354-88445376 CCATCTGGACAGATGGAGTGTGG - Intergenic
1013018308 6:106181791-106181813 CAAGATCCCCAGATAGAATGCGG - Intergenic
1013693507 6:112673051-112673073 CAAGATGGACAGAGGAAGTGAGG - Intergenic
1021055996 7:16046938-16046960 AAAGATGAACAGGTGGAGTAGGG + Intergenic
1022535963 7:31098680-31098702 CATTATGCACAGATGCAGCGGGG + Intronic
1023082249 7:36536543-36536565 CAAGATCCAAAGATGGGGTTTGG + Intronic
1023875443 7:44283980-44284002 CTCCATGCACAGATGCAGTGGGG - Intronic
1023940754 7:44767207-44767229 GCTGATGCACAGAGGGAGTGTGG + Intronic
1024007028 7:45232124-45232146 CTAGAAGCACAGAGAGAGTGTGG + Intergenic
1024285989 7:47758030-47758052 CAAGATGTTCTGATGCAGTGTGG - Intronic
1027830263 7:83168004-83168026 AAAAATGCACAGATGGATAGAGG - Intergenic
1028471680 7:91212927-91212949 CATGCTGCACAGATGGCGTAAGG + Intergenic
1028847764 7:95501478-95501500 TAAGATGAAAAGATGGAATGCGG - Intronic
1030282456 7:107791001-107791023 CAAGATGAACAGATTGAGGTGGG + Intronic
1030811376 7:113976374-113976396 AAATAAGCACAGATGGAGAGTGG - Intronic
1031560435 7:123231458-123231480 CAAGATACACAGACAGAGTGAGG + Intergenic
1031706831 7:124991327-124991349 GTAGATGCTCAGATGGAGTTTGG - Intergenic
1032177777 7:129646608-129646630 GAAGAGGCACAGCTGGAGTTGGG + Intronic
1032456178 7:132075153-132075175 GAAGATGCAAAGAAGGACTGTGG + Intergenic
1032510257 7:132466607-132466629 CAAGATGCAAGGATGGAGGTGGG + Intronic
1035325018 7:158060150-158060172 CACCATGTGCAGATGGAGTGTGG - Intronic
1035547449 8:494335-494357 CAACAGGGACAGACGGAGTGGGG + Intronic
1035789671 8:2292611-2292633 CAAGGTGGACAGATGGCTTGAGG + Intergenic
1035803134 8:2429094-2429116 CAAGGTGGACAGATGGCTTGAGG - Intergenic
1036605055 8:10297242-10297264 GAAGATGAACAAATGGAGAGGGG - Intronic
1037465011 8:19151396-19151418 CATGAGGCACAGGTGGTGTGTGG + Intergenic
1038932598 8:32211547-32211569 CTAGATGCAGTGTTGGAGTGAGG - Intronic
1039250180 8:35654956-35654978 AATGATGCACAGATGGAAAGTGG + Intronic
1039932387 8:42005615-42005637 CCAGATCCAGAGAGGGAGTGAGG + Intronic
1045173829 8:99698456-99698478 CAAGATTCACAGATGAACAGAGG - Intronic
1047355663 8:124119334-124119356 CAGGTTGGACAGATGGAGGGTGG + Intronic
1047618027 8:126579339-126579361 CAAGACCGACAGATGGAGTTAGG + Intergenic
1047806311 8:128364450-128364472 CCAGATGCAGAGATGGAATGTGG + Intergenic
1047948993 8:129912554-129912576 AAAGATGCACAGATGCACTCTGG + Intronic
1048019204 8:130522919-130522941 CAAGAGGGACAGTTGCAGTGGGG + Intergenic
1049395266 8:142397307-142397329 CAAGGTGCACAGAGGGGCTGTGG - Intronic
1050507829 9:6365877-6365899 CCTGATTCACAGATGGAGTCAGG + Intergenic
1051524030 9:18022397-18022419 CAAGAGGCAAAGATAGTGTGGGG - Intergenic
1051931310 9:22389565-22389587 CAAGATGCAAATATGGAGAAAGG + Intergenic
1052104217 9:24492409-24492431 CAAAATCCAAAGATGGAGCGAGG + Intergenic
1056880107 9:90383405-90383427 CAAGATCAACAGCTTGAGTGTGG + Intergenic
1057498097 9:95575849-95575871 CAGGAAGCACAGGTGGAGTGGGG + Intergenic
1057853979 9:98588611-98588633 CAAGTTGCACACAGTGAGTGAGG + Intronic
1060019809 9:120119449-120119471 CAAGATCCACAGATGATGTGTGG - Intergenic
1061105274 9:128525339-128525361 CAAGAGGCACAGATGCAGCAGGG + Exonic
1062343416 9:136103836-136103858 CAGGGTGGACAGGTGGAGTGTGG - Intergenic
1062469398 9:136695937-136695959 CAGGATGCACAGAGGGAAGGGGG - Intergenic
1186719630 X:12289466-12289488 CAAGATGCACAGATAGCTAGTGG + Intronic
1187258898 X:17667298-17667320 CCAGAAGCACAAATGGAGAGAGG + Intronic
1188415305 X:29925833-29925855 CAAGAAGCACACAGGGAGTTGGG - Intronic
1190727305 X:53197956-53197978 CAAGGTGGACAGGTGTAGTGAGG - Intronic
1192149208 X:68701564-68701586 CAAGGTGGACAGATGGATAGAGG + Intronic
1192615280 X:72614529-72614551 CAAGAAGTAGAAATGGAGTGTGG + Intronic
1194773908 X:97939275-97939297 GAAATTGCACAGATGGAGAGGGG - Intergenic
1195695956 X:107667667-107667689 CAGGATGCAGTGATGGATTGGGG - Intergenic
1200411257 Y:2864160-2864182 TAAGATGCTCAGATTGAGTTGGG + Intronic
1202182275 Y:22149779-22149801 CAATAAGGTCAGATGGAGTGAGG - Intergenic
1202209085 Y:22436623-22436645 CAATAAGGTCAGATGGAGTGAGG + Intergenic