ID: 1120896190

View in Genome Browser
Species Human (GRCh38)
Location 14:89534563-89534585
Sequence CAGCTAGGGCAGTTTGCCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120896190_1120896193 9 Left 1120896190 14:89534563-89534585 CCTACGGCAAACTGCCCTAGCTG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1120896193 14:89534595-89534617 AAAGAAATTAGTCACCTTCTAGG 0: 1
1: 0
2: 0
3: 24
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120896190 Original CRISPR CAGCTAGGGCAGTTTGCCGT AGG (reversed) Intronic
903193885 1:21670890-21670912 CAGCTAGGGAAGCTTGCTGGAGG - Intergenic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
911979850 1:104553342-104553364 CAGCTAGGGCAGTTTTAAGAGGG + Intergenic
912204919 1:107498634-107498656 CAACTGGGGCAGTTTGCTGATGG - Intergenic
915248515 1:154572407-154572429 CAGCTCAGGCATTTTGCCCTGGG - Intronic
915283399 1:154837897-154837919 CAGCCAGGGCTGTGTGCCGTGGG + Intronic
918015323 1:180628068-180628090 GAGCTAGTGCACTTTGCCGAAGG + Intergenic
1065773787 10:29101230-29101252 CAGGAAGGGCAGTTTCCCCTGGG + Intergenic
1067528867 10:47055889-47055911 CAGGTAGGGCAGTGTGCACTGGG + Intergenic
1072781556 10:98255255-98255277 CAGCAAGGGCAGTTTTTCCTTGG - Intronic
1072798717 10:98376742-98376764 CAGGCAGGGCAGTTTGCCAAAGG - Intergenic
1076231571 10:128823769-128823791 CAGCAAGGGCAGCATGGCGTCGG + Intergenic
1078484567 11:11709631-11709653 CACCTAGCACAGTCTGCCGTGGG + Intergenic
1080584595 11:33669761-33669783 CAGAAAGGGCAGTTTGCCATTGG - Exonic
1083635132 11:64116788-64116810 CAGCTTGAGCTGTTTGCTGTCGG - Exonic
1085319784 11:75566891-75566913 GACCTCGGGCAGCTTGCCGTCGG - Exonic
1088212568 11:107472973-107472995 CAGCTGGGGCATTTTTCCTTAGG - Intergenic
1093934084 12:24982847-24982869 CAGCTAGAGGAGTTTGCCTTGGG - Intergenic
1097300187 12:58009782-58009804 CAGCAAGGGAAGTTTGAAGTGGG + Intergenic
1098637582 12:72803105-72803127 CAGTTAGGGCACATTGCCGGAGG + Intergenic
1099105051 12:78486607-78486629 CTGCTAGGGCAGTGTGCAGAAGG - Intergenic
1101880251 12:108621487-108621509 CAGCTATGGGATTTTGCAGTGGG - Intergenic
1102934181 12:116882898-116882920 GAACTAGGGCAGTATGCCGCAGG + Intergenic
1104053779 12:125214164-125214186 CAGCTATGCCAGTTTGACTTGGG - Intronic
1104599190 12:130141117-130141139 GAACAAGGGCGGTTTGCCGTGGG - Intergenic
1104639260 12:130457065-130457087 CAGCCCGGGCACTTTGCAGTTGG + Intronic
1112306642 13:98280320-98280342 CAGCTCGGGCCATTTCCCGTGGG - Intronic
1120896190 14:89534563-89534585 CAGCTAGGGCAGTTTGCCGTAGG - Intronic
1126109145 15:45165703-45165725 TAGCTGGGGCACTTTGCCTTGGG - Intergenic
1126153650 15:45545564-45545586 TAGCAAGGGCAGATAGCCGTAGG + Intergenic
1126825780 15:52546391-52546413 CAGGTAGGGGAGTTTGTCCTTGG + Intergenic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129664084 15:77569677-77569699 CACATAGGGCAGTTTGGCTTCGG + Intergenic
1133307211 16:4817977-4817999 CAGCAAGGGGACTTTGCCCTGGG - Intronic
1133312801 16:4861139-4861161 CAGTTTGGGCAGATTGCTGTTGG + Intronic
1135660717 16:24294245-24294267 CAGCGAGGACAGTTTCCCCTTGG + Intronic
1136399293 16:30009217-30009239 CAGCAAGTGCAGCTTGACGTAGG + Exonic
1139171535 16:64635891-64635913 CAGCTCTGGCATTTTGCAGTAGG + Intergenic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1156060148 18:33063862-33063884 CAGTTAGTGCAGTTTGCTTTAGG - Intronic
1163585230 19:18160369-18160391 CAGCTGGGGCAGTTTGAGGCAGG - Intronic
1164426103 19:28143032-28143054 CAGCTAGAGCAGTTTGGAATTGG + Intergenic
929490416 2:42391317-42391339 CAGGTAGGTCACTTTGCCCTGGG - Intronic
940906694 2:159175916-159175938 TGGCCAGGGCAGTTTGCCCTGGG + Intronic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
943698679 2:190965046-190965068 CTGCTCGGGCTGTTTGCTGTTGG + Exonic
947550341 2:231041187-231041209 AAACTAGGGCAGTTGACCGTTGG + Intronic
948397980 2:237661549-237661571 CACATAGGGCAGTTTGCCCTGGG - Intronic
1169028283 20:2387814-2387836 CAGCTGGGGCAGATTGCCTGGGG + Intronic
1170581406 20:17702209-17702231 CATCGATGGCAGTTTGCCTTAGG - Intronic
1172335612 20:34112987-34113009 CAAGTAGGGCAGTACGCCGTGGG + Intergenic
1175147124 20:56905237-56905259 AAGCTAGCCCAGTTTGCTGTAGG + Intergenic
1175543241 20:59761381-59761403 CAGCTTGGGCAGCTGGCTGTGGG - Intronic
1176222320 20:63975507-63975529 CAGCTAGGACATTTTCCCGAAGG + Exonic
1181018120 22:20083025-20083047 CAGCTGGGGCAGTGTGCTGAGGG - Intronic
1182811552 22:33121242-33121264 CAGCTAGGCCAGTTGGCAGCTGG - Intergenic
951017398 3:17745460-17745482 CAGCTAGGGCTGTTGGCCAGGGG - Intronic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
956808121 3:72837153-72837175 CAGCTAGGGCAGTTTTCCAAAGG + Intronic
957349610 3:79006426-79006448 CAGATAGGCCAGTTGGCCATAGG + Intronic
957611717 3:82475053-82475075 CAAGGAGGGCAGTTTGCCCTTGG - Intergenic
961737094 3:129009234-129009256 CACCTAGGTCAGTTTGCATTAGG - Intronic
962313036 3:134339333-134339355 CAGCAAAGCCAGTCTGCCGTGGG + Intergenic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
965687947 3:171325293-171325315 CAGCAAAGGCATTTTGCCTTTGG - Intronic
966707668 3:182934300-182934322 CAGCCAAGGCAGTGTGCCATAGG + Intergenic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
979900710 4:126214212-126214234 CAGCCAGGGCACTCTGCCGATGG - Intergenic
989561587 5:42858376-42858398 CAGGTAGGGAAGTTTGCAGGAGG - Intronic
991450197 5:66743357-66743379 CAGGTGGGGAAGTTTGCCTTGGG + Intronic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
997884674 5:137619642-137619664 CAGCTAGAGCAGATTGGCTTTGG + Exonic
1009411922 6:63375633-63375655 CATTTAAGGCAGTTTGCCTTTGG + Intergenic
1016107386 6:140179461-140179483 CAGGAAGTGGAGTTTGCCGTGGG + Intergenic
1021525190 7:21578632-21578654 CTGCTAGGGCAGTGTGGGGTTGG - Intronic
1029127963 7:98308234-98308256 TTGCGAGGGCAGTTTGGCGTTGG - Intronic
1032572428 7:133014481-133014503 CTGCTGGGACAATTTGCCGTTGG - Intronic
1034863740 7:154622791-154622813 CAGCCAGGGCAGCCTGCTGTGGG + Intronic
1036553041 8:9831998-9832020 CAGCTAGGGCAAATTGTCCTTGG + Intergenic
1038689616 8:29749374-29749396 CAGCTAGGGCACATTGTGGTTGG - Intergenic
1052833518 9:33234001-33234023 CAGCATGGCCAGTTTGCCCTGGG - Intronic
1052963276 9:34318945-34318967 GACCTTGGGCAGCTTGCCGTCGG - Intronic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1058189005 9:101890405-101890427 CAGGTAGGGCAGCTTTCCTTGGG + Intergenic
1059072941 9:111158588-111158610 CAGATGAGGCAGTTTGCTGTGGG - Intergenic
1197560513 X:128014897-128014919 CTGCTAGGGCAGTGTGGGGTTGG - Intergenic
1197856959 X:130923729-130923751 CAGCTAGATCAGTTTTCAGTAGG - Intergenic
1199439412 X:147851427-147851449 CAGCTAGGGTAGTTTGAGGATGG + Intergenic
1200131231 X:153847888-153847910 CAGATAGGGCAGTTTGGGCTCGG - Intergenic