ID: 1120897160

View in Genome Browser
Species Human (GRCh38)
Location 14:89543893-89543915
Sequence CCCCCCACCCCCATTGGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 254}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120897160_1120897164 -2 Left 1120897160 14:89543893-89543915 CCAAAACCAATGGGGGTGGGGGG 0: 1
1: 0
2: 1
3: 27
4: 254
Right 1120897164 14:89543914-89543936 GGGAAGTACTCAAAATATTTTGG 0: 1
1: 0
2: 1
3: 28
4: 235
1120897160_1120897165 23 Left 1120897160 14:89543893-89543915 CCAAAACCAATGGGGGTGGGGGG 0: 1
1: 0
2: 1
3: 27
4: 254
Right 1120897165 14:89543939-89543961 AAATATTAATGTTATGAAGATGG 0: 1
1: 0
2: 2
3: 58
4: 737

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120897160 Original CRISPR CCCCCCACCCCCATTGGTTT TGG (reversed) Intronic
901953101 1:12764132-12764154 CCCCCCACCCCCAATGAATCTGG + Intergenic
903811136 1:26035660-26035682 CCCTCCGCCCCCAATGGGTTCGG + Exonic
903907448 1:26696633-26696655 GCCGCCACCCCCATTGCTCTCGG - Exonic
903979578 1:27176284-27176306 CCCCCAACCCCCAATGCTGTAGG + Intergenic
904866713 1:33585036-33585058 CCATCCACCTCCATTTGTTTGGG + Intronic
904926381 1:34051925-34051947 ACCCCCACCCCCATTAGTGAGGG - Intronic
904941452 1:34166838-34166860 CCCCCCACCCCAAGTTGTTCCGG + Intergenic
906728021 1:48058182-48058204 CCCCCCACCCCAACAGGTTTTGG + Intergenic
907529877 1:55084482-55084504 CCTCCCACCCCAACTGTTTTTGG + Intronic
908393427 1:63703800-63703822 CCCCCCACCCCCAAGGGGTTGGG + Intergenic
908408865 1:63843092-63843114 CCCCCCAGCCCCTCTGGTCTGGG + Intronic
909499810 1:76321403-76321425 CCTCCCATCCCCCATGGTTTGGG + Intronic
911124292 1:94326053-94326075 CCCCCCACCCCCACAGTGTTTGG + Intergenic
911216541 1:95201281-95201303 CCCCCCACCCCCATTGAATGGGG + Intronic
911757499 1:101576082-101576104 CCACCTACCGCCATTGATTTTGG + Intergenic
912513038 1:110201369-110201391 GTCCCCACCCCCACTGGCTTTGG + Exonic
912652296 1:111449937-111449959 GCCCCCACCCCCTTAGCTTTAGG + Intronic
915288343 1:154867083-154867105 CCCCACACCCCCCTTGCATTTGG + Intronic
915468978 1:156114608-156114630 GCCCCCACCCCCAATGGATCTGG + Intronic
915489070 1:156241558-156241580 GGCCCCACCTCCATTGGCTTTGG + Intronic
916017681 1:160764534-160764556 CTCCCCACCCACAGTGGTCTTGG - Intergenic
917107416 1:171507024-171507046 CTCCCCACCCCCCTTGATTCTGG + Intronic
920536399 1:206739444-206739466 CCTCCCCCACCCCTTGGTTTTGG + Intergenic
921947700 1:220897616-220897638 CCCCCCACCCCCAGAGGCCTCGG + Intergenic
922740651 1:228012512-228012534 CCCCCCACCCCCATTACTCCAGG - Intronic
923186626 1:231579631-231579653 CCCCCCACCCCCGTGGCCTTAGG + Intronic
924066251 1:240225322-240225344 CCCCTCAGCCCCAGTGGTTAAGG + Intronic
924166262 1:241286475-241286497 TCCCCCATCCCCATTTTTTTGGG - Intronic
1064830502 10:19460685-19460707 CCATCCACCCCCACTGTTTTAGG - Intronic
1067723071 10:48744175-48744197 CCTCCCACCCCAAGTGGGTTGGG - Intronic
1069517276 10:69087973-69087995 CCCCCCACCCCCTTTCTTTCTGG + Intergenic
1069544461 10:69318713-69318735 TCCTCCACGCCCATTGGTTGCGG - Intronic
1069777879 10:70937379-70937401 CCGCCCACTCCCCTTGGTTTTGG - Intergenic
1069961864 10:72083923-72083945 CCCCACACTCGCAGTGGTTTAGG + Intronic
1073457838 10:103648240-103648262 CCCCTGACCCCCACTGGTATCGG - Intronic
1074313810 10:112344334-112344356 TCCCCCAACCCCACTGGCTTTGG - Intergenic
1076573963 10:131451767-131451789 CCCCCCACTGCCTTTGCTTTGGG + Intergenic
1077714658 11:4569237-4569259 CCTCCCGCCGCCCTTGGTTTGGG - Intergenic
1077899724 11:6478707-6478729 TCCCCCACCCTCTTTGGTCTGGG + Intronic
1077922956 11:6655437-6655459 CCCCCCTCCCCCATTGTCTCCGG + Intronic
1078347625 11:10564784-10564806 TCCCCAAACCACATTGGTTTGGG - Intronic
1081198558 11:40190648-40190670 CCCCCCAGCCCCATTTCTTCAGG - Intronic
1082752382 11:57033042-57033064 CTCCCCTCACCCAGTGGTTTGGG + Intergenic
1083304064 11:61753716-61753738 CCCCACCCCTACATTGGTTTTGG + Intronic
1083319788 11:61838644-61838666 CCCACCACCCCCATTGCCTCTGG + Intronic
1083871109 11:65489092-65489114 ACCCCCACCCCCACTGTTTGTGG - Intergenic
1087517413 11:99181419-99181441 TATCCCACCCCCATTGGTATTGG + Intronic
1088225852 11:107619111-107619133 GCCCCCCACCCCAGTGGTTTTGG + Intronic
1089585902 11:119509340-119509362 CCCCCCACCCCCACCCCTTTTGG - Intergenic
1089713896 11:120337163-120337185 CTCCCCACCCCCAGTGCTCTGGG - Exonic
1091306083 11:134536918-134536940 CCCACCATCCCCAGAGGTTTGGG + Intergenic
1093539922 12:20269339-20269361 CTCCCCATCCCCATTCGTTGAGG + Intergenic
1096121404 12:49091651-49091673 TCCCTCACCCCTATTGGTTCAGG + Intronic
1096143266 12:49260184-49260206 CCCCCTTCCCCCATTCCTTTAGG - Intronic
1096714109 12:53480848-53480870 CCCCCCACCCCCTATTATTTGGG + Intronic
1097017021 12:55994386-55994408 CCCCCCACCCCCATAGGAACAGG + Exonic
1097166116 12:57087564-57087586 CCCACCACCCCCACTGTGTTTGG + Intronic
1098650356 12:72958937-72958959 CCCCCCACCCCCAGAGATTGTGG + Intergenic
1098955711 12:76687604-76687626 ACCCCCACCCCCATATGTTGGGG + Intergenic
1100656862 12:96656304-96656326 CCCCCCTCCCCTTTTGGATTGGG + Intronic
1102556444 12:113729780-113729802 CCACCTACTCCCATTGCTTTTGG - Intergenic
1102680769 12:114688809-114688831 CCCCCCCCCCCCTTTTCTTTTGG + Intergenic
1102825412 12:115944287-115944309 ACCACCACGCCCACTGGTTTGGG - Intergenic
1103137333 12:118518962-118518984 CCCCCCACCCCCAGACATTTTGG + Intergenic
1104066895 12:125313698-125313720 CCCCCTCCCTCCATTGGTTTGGG + Intronic
1104140827 12:125984285-125984307 CCCCCCACGCCCCTTGGTGGAGG + Intergenic
1107048963 13:36027172-36027194 CACCCCACCCCCATTTCTGTGGG - Intronic
1107441315 13:40429866-40429888 CCCCCCACCCCCATTAATTCTGG + Intergenic
1107963741 13:45580835-45580857 CACCCCACCCTCTTTGGCTTTGG + Intronic
1112053496 13:95668861-95668883 CCCCCCACCACCATCTCTTTAGG + Intergenic
1112699712 13:101992231-101992253 CCCCACCCCCCAATTGCTTTGGG - Intronic
1114144167 14:19954327-19954349 CCACCCACCCCCACAGCTTTAGG + Intergenic
1115754742 14:36519780-36519802 ACCCCCACCCCCATTTTTTGTGG + Intronic
1116629104 14:47306369-47306391 CCCTCCACCCCCAATGAATTGGG - Intronic
1118756041 14:68844353-68844375 CCCCCCACCCCTCTTCTTTTGGG + Intergenic
1119060845 14:71472118-71472140 CCCACCACCCTCACTGCTTTGGG + Intronic
1119719175 14:76879672-76879694 CCACCCACCCCCACTGTTTTTGG - Intergenic
1119901628 14:78265322-78265344 CCACCTACCACCACTGGTTTTGG - Intronic
1120250817 14:82060308-82060330 CACCCCACCCCTAGTGGTATTGG - Intergenic
1120864772 14:89286372-89286394 CACCCCATCCCCGTTGGTTTGGG - Intronic
1120897160 14:89543893-89543915 CCCCCCACCCCCATTGGTTTTGG - Intronic
1123449617 15:20351649-20351671 CCCCCCAGCCCCACTGCCTTGGG - Intergenic
1126845127 15:52752589-52752611 CCCCCCCCCCTCTTTGATTTGGG - Intergenic
1128892544 15:71343971-71343993 CACCCCACCCCCATCACTTTGGG - Intronic
1130966413 15:88700923-88700945 CCCCCCACCCCAAGAGGTATAGG + Intergenic
1131056042 15:89375752-89375774 CCCCCCACCCCCCATGAATTAGG + Intergenic
1131483818 15:92803908-92803930 CTCCCCACTCCCACAGGTTTTGG + Intronic
1131968253 15:97867840-97867862 CCCCCCTCCACCATGGGCTTAGG - Intergenic
1132062381 15:98703036-98703058 CCCAGCACCCCCATCTGTTTTGG + Intronic
1133033354 16:3021926-3021948 CCCCCCACCCCCCTTGTGGTTGG - Exonic
1133785701 16:8971422-8971444 CCCCCAACCAACATTGCTTTTGG + Intergenic
1134006577 16:10822236-10822258 CCCCCTACCCACACTGGTCTTGG + Intergenic
1134257753 16:12625844-12625866 CCCCCCACCCCAATTGCTGGGGG + Intergenic
1134332985 16:13267392-13267414 CACCACACCCCCATCAGTTTGGG - Intergenic
1134648233 16:15888170-15888192 CCCACAACCCCTATTGGGTTAGG - Intronic
1134759398 16:16700492-16700514 TCCTCCACCCGCATTTGTTTAGG + Intergenic
1134796290 16:17039997-17040019 CCACCCACACCCACTGGTTGAGG - Intergenic
1134824832 16:17276039-17276061 CTCCCCACCCCAAATGGTTCCGG - Intronic
1134986673 16:18658704-18658726 TCCTCCACCCGCATTTGTTTAGG - Intergenic
1135252176 16:20910016-20910038 TCCCTCACACCCATTGGGTTGGG - Intronic
1135372884 16:21921030-21921052 CCCCCCCCCCCCTTTTTTTTTGG - Intergenic
1135627387 16:24007956-24007978 TCCCCCACCTCCAGTGGTCTAGG + Intronic
1138344391 16:56311329-56311351 CCCCCTGCCCCCACTGGGTTAGG + Intronic
1138435561 16:56997694-56997716 CCCCCAACCCCCAGTTGCTTAGG + Intronic
1138554816 16:57765029-57765051 CCTCCCACCACCATGGCTTTGGG - Intronic
1142144565 16:88487521-88487543 TCCCCCACCCCCGTTGGCCTTGG - Intronic
1142349823 16:89574995-89575017 CCCCCCACCCCCGTGGCTTTTGG + Intergenic
1143334460 17:6162026-6162048 CCCCTGACCCCCATATGTTTGGG + Intergenic
1143634452 17:8156398-8156420 CCCCCCACGCTTATTGGCTTAGG + Intronic
1144724449 17:17494868-17494890 CCCGCCACCCCCATAACTTTGGG - Exonic
1144945716 17:18968558-18968580 CCCCCACCCCCCAGTGGGTTTGG - Intronic
1146496812 17:33329940-33329962 CCTCTCACCCCCTATGGTTTAGG + Intronic
1146534984 17:33642216-33642238 CCCCCCACACACAATGGTTATGG + Intronic
1148154229 17:45413560-45413582 CCCCCAATCCCCATGGGTGTGGG - Intronic
1150010037 17:61494843-61494865 CCCCCCACTGCCAGGGGTTTGGG + Intergenic
1151323631 17:73365988-73366010 GCCCCCACCCCCATGATTTTGGG - Intronic
1151475485 17:74342494-74342516 CCCCCCACCCCCACTTATCTTGG + Intronic
1152339015 17:79714242-79714264 CCCCCCAGCCCCACTGCCTTGGG + Intergenic
1152492742 17:80648697-80648719 CCCCCCACCCCCAAATGTTTTGG + Intronic
1157320624 18:46631311-46631333 CCCCCCACCACCATCAGTCTTGG + Intronic
1157821646 18:50775775-50775797 CCCCCCACCCCCATCGCTCCTGG + Intergenic
1157967254 18:52222350-52222372 CCCCCCTCCCCCATTCCTGTGGG + Intergenic
1158566904 18:58561726-58561748 ACTCCCACCCCCATTGGTGGAGG + Intronic
1158893635 18:61894454-61894476 CCCCCCACCCCCTTTGGTGCCGG - Intergenic
1162032539 19:7923689-7923711 CCCAGCACCCCCAGGGGTTTGGG - Intergenic
1163102895 19:15108417-15108439 CCCCCCACGCTCAATGCTTTGGG - Intronic
1163736987 19:18987735-18987757 CCCCCCATCCCCATATGTTTGGG - Intergenic
1165884096 19:39064944-39064966 CCCCCCACCCCCAGGGGTAACGG - Intergenic
1165885663 19:39076507-39076529 CCCCTCACCCACACTGGTTCAGG - Intergenic
1166101000 19:40571285-40571307 ACCCCTACCCTCATTAGTTTGGG - Intronic
1166213718 19:41322873-41322895 ACCCCCACCCCCACTGTTTCTGG + Exonic
1166767720 19:45262337-45262359 CCCCCCGCCCCCTTTTCTTTTGG - Intronic
1166807187 19:45494480-45494502 CCACCCACCCCTCTTGGCTTTGG + Intronic
1166947883 19:46408388-46408410 CCCCCCCCCCCCATAGCTCTGGG + Intergenic
1167426299 19:49431442-49431464 CCCCCCGCCCCCGTAGGCTTCGG - Exonic
1168358728 19:55719845-55719867 CCTCCCACCCCCATTGTGTGTGG - Intronic
1202631506 1_KI270706v1_random:4239-4261 CACCTCACTCCCATTGTTTTGGG + Intergenic
925769267 2:7266412-7266434 CCACCCACACCCATCGGTTTAGG - Intergenic
926117219 2:10221175-10221197 CCCCCCACCCCCAGAGGAATTGG - Intergenic
926117919 2:10224944-10224966 GCCCCCACCCCCACAGGCTTCGG + Intergenic
927019615 2:19003002-19003024 ACACCCACTCCTATTGGTTTAGG + Intergenic
928673430 2:33626158-33626180 CCCCCCACCCCTTTGGGTCTTGG + Intergenic
928940450 2:36721818-36721840 CCCTCCACCCCCTTTAGGTTGGG + Intronic
929430312 2:41880710-41880732 TCCCCCACCCTGAGTGGTTTTGG - Intergenic
929545872 2:42854998-42855020 CCCACCACCCCCATTGTGTAAGG - Intergenic
933280141 2:80323808-80323830 CCACCCACCCCTAGTGGTCTAGG - Intronic
933885991 2:86719949-86719971 CTCCCCGCGCCCATTGGTTGGGG + Intronic
936341314 2:111635093-111635115 CAACCCCACCCCATTGGTTTTGG + Intergenic
936662412 2:114556930-114556952 CACCCCACTCCAGTTGGTTTTGG - Intronic
937361915 2:121235387-121235409 CCCCCCACCCCCAGTGCTATGGG - Intronic
938065358 2:128279162-128279184 CCCCGCACCCCCATCAGCTTCGG - Intronic
938791976 2:134684596-134684618 CCCCACACCCTCAGTGTTTTGGG + Intronic
943590440 2:189789796-189789818 CCCCCAGCCCCCATTTTTTTTGG + Intronic
944174626 2:196816279-196816301 CCCTCCTCCCCCATTGGTATAGG + Intergenic
945572442 2:211485697-211485719 CCCCCCACCCCACTGAGTTTGGG - Intronic
946098953 2:217302290-217302312 CCCCCCACCCCTGCTGTTTTGGG - Intronic
947575401 2:231269872-231269894 CCCTCCCCCCCTATTTGTTTTGG + Intronic
948152928 2:235758720-235758742 CCCCCAACCCCCATTTGTATTGG - Intronic
948199885 2:236121950-236121972 CCCCCCACCCCCTTCTTTTTGGG + Intronic
948220149 2:236262874-236262896 CCGCCCCCCCCCCTTGGTTTGGG - Intronic
948380874 2:237549294-237549316 TCCCCCACCCCCATGGGCCTGGG + Intronic
1169117610 20:3076072-3076094 CCCCCCACCTCCACTCGTATGGG + Intergenic
1169290125 20:4342538-4342560 TCCCCCACCCCCATTTCTTGAGG + Intergenic
1170906014 20:20515828-20515850 CGCCCCACTCCCATTGGTTCTGG - Intronic
1171317410 20:24207112-24207134 CCCCCCACCCCCAGAGGATAAGG - Intergenic
1172313604 20:33936467-33936489 CCCCCCACCCCCACGGCTTAGGG - Intergenic
1173454388 20:43190992-43191014 CCCCCCACCCCCATCCTTGTTGG + Intergenic
1173951849 20:46999677-46999699 CGCCCCAACCCCAGTGGTTTGGG + Intronic
1175765672 20:61590866-61590888 ACCCCCCCCCCCATAGATTTAGG - Intronic
1176643716 21:9330144-9330166 CACCTCACTCCCATTGTTTTGGG + Intergenic
1176643782 21:9330570-9330592 CACCTCACTCCCATTGTTTTGGG + Intergenic
1180369199 22:11968971-11968993 CACCTCACTCCCATTGTTTTGGG - Intergenic
1180420543 22:12810524-12810546 CACATCACCCCCATTGTTTTGGG - Intergenic
1181523213 22:23460962-23460984 CCCCCCACCACCATGGGCTGAGG + Intergenic
1184449462 22:44574471-44574493 CTCCCCACCCCCAGTGATCTCGG - Intergenic
1184490754 22:44807390-44807412 CCCGCCACCCCCTATGGTGTAGG - Intronic
1184946498 22:47807750-47807772 CCCCCCACCCCCATCCTTTGGGG - Intergenic
952267167 3:31797841-31797863 CCCCCCATCCCCATTTTTATAGG - Intronic
954366933 3:50151272-50151294 CCCTCCATCCCCATTGGATGAGG - Intergenic
954976931 3:54704885-54704907 CCCCCCACCCCCATTTCTACAGG + Intronic
954992541 3:54853855-54853877 CCCCCCACCCCCATAGGCTGTGG - Intronic
957095930 3:75777521-75777543 CCCATCACTCCCATTGTTTTGGG - Intronic
957096137 3:75778923-75778945 CACCTCACTCCCATTGTTTTGGG - Intronic
957096150 3:75778993-75779015 CACCTCACTCCCATTGTTTTGGG - Intronic
961624994 3:128255518-128255540 CCCCTCACCCCCATTGCTCTTGG + Intronic
961840331 3:129705364-129705386 CCCCAGACCCCTACTGGTTTTGG - Intronic
963952622 3:151219893-151219915 CCCCCCCCCCCCCTTGGATATGG + Intronic
965613679 3:170570845-170570867 CCACCCACCCCAATAGCTTTAGG + Intronic
965653711 3:170961181-170961203 CACCCTACCCCCATTGGGGTAGG - Intergenic
1202743104 3_GL000221v1_random:74496-74518 CACCTCACTCCCATTGTTTTGGG - Intergenic
1202743166 3_GL000221v1_random:74885-74907 CACCTCACTCCCATTGTTTTGGG - Intergenic
968756231 4:2417828-2417850 GCCCCCACCCCCATTGTCCTGGG - Intronic
971002333 4:22337328-22337350 TATCCCACCCCCATTGGTATTGG + Intergenic
973361232 4:49166739-49166761 CACGTCACCCCCATTGTTTTGGG + Intergenic
975211833 4:71710135-71710157 CACCCCACCCTCTTAGGTTTTGG + Intergenic
977123832 4:93139209-93139231 CCCCTCACCCCTCTGGGTTTAGG - Intronic
977783859 4:101009835-101009857 CCATCCACTCCCATTGGTTGAGG - Intergenic
980569232 4:134589053-134589075 CCTCCCACCCTCACAGGTTTTGG + Intergenic
982607044 4:157528318-157528340 CTCCCCACCACCATTGCTCTCGG - Intergenic
986989986 5:13540690-13540712 TCCTCCAGCCACATTGGTTTTGG - Intergenic
988104597 5:26728086-26728108 CCCACAACCTCCATTTGTTTTGG + Intergenic
989710413 5:44389850-44389872 CCCCCCACCCCCATTTCTTTTGG + Intergenic
991492757 5:67199128-67199150 CCCTCACCCCCCAATGGTTTTGG + Intergenic
991578226 5:68127015-68127037 CCCCACTCCTCCAGTGGTTTTGG - Intergenic
993095645 5:83474695-83474717 CGCCCCGCCCCCATTGGCCTCGG - Intronic
994141019 5:96341346-96341368 CCCTCCACCCTGCTTGGTTTTGG + Intergenic
994894744 5:105688409-105688431 CCCCCCACCCCTAGTGGCTATGG + Intergenic
996822919 5:127650507-127650529 CCTCCCACTCCCCTTGTTTTTGG - Intronic
999381509 5:151124465-151124487 CCACCCACGCCGCTTGGTTTGGG - Intronic
1000757709 5:165182291-165182313 CCCCCCACCACCCTCGCTTTTGG + Intergenic
1001572128 5:172736832-172736854 CCCCCCACCCCCAGTGACTCTGG + Intergenic
1003356508 6:5378268-5378290 CCCCTCACCCACAGTGGTTGAGG - Intronic
1005480428 6:26250075-26250097 CCCTCCACCCTCCTTGTTTTAGG + Intergenic
1006342116 6:33452636-33452658 CCCCCCTCCCCCAGTGTGTTGGG + Exonic
1006837416 6:37007412-37007434 CCCACCACCCCCTTGGGTGTGGG + Intronic
1007324172 6:41047805-41047827 CCCCCCACCCCCAAATGTTGAGG + Intronic
1008073048 6:47116999-47117021 CCACCACCCCCCATTAGTTTTGG - Intergenic
1008817223 6:55582460-55582482 ACCCCCACCCCCAGAGGTTATGG - Intergenic
1010001369 6:70953509-70953531 TCCCCCACCAGCATTGTTTTTGG - Intronic
1011262332 6:85482622-85482644 CTCCACAGCCCCATTGGGTTTGG + Intronic
1013589294 6:111606597-111606619 CCCCACCCCCCCAGTGGTTATGG - Intergenic
1014686953 6:124513633-124513655 ACCCCCACCTCCAATGGTTTTGG + Intronic
1016076843 6:139805519-139805541 CCCCCCATCCCCACAGGCTTGGG - Intergenic
1016851069 6:148619595-148619617 CCACTCACCCCAATTGGTTCAGG - Intergenic
1017140074 6:151182341-151182363 CCCCCCACCCCCAGCACTTTGGG + Intergenic
1017718833 6:157230934-157230956 CTCCCCATCCCCACTGGTGTTGG - Intergenic
1017991697 6:159494757-159494779 CCCCCAACCCCCATTGCAGTTGG + Intergenic
1018238939 6:161753690-161753712 CCCCCCGCCCCCATTGGGCTTGG - Intronic
1018573279 6:165233046-165233068 CACCCCATCTCCATTGGGTTAGG - Intergenic
1019763896 7:2835380-2835402 CCCCACACCCCCATTGATGTTGG + Intronic
1019856415 7:3612907-3612929 CCCCCCACCCCCCTTGTTTGTGG + Intronic
1021837440 7:24693901-24693923 CCCCCCACGCCAGTTCGTTTTGG + Exonic
1023274645 7:38505003-38505025 CCCCCCACCACCACTCTTTTGGG - Intronic
1027785795 7:82577378-82577400 CCCCCCAACCCCATGTGATTGGG + Intergenic
1028170672 7:87591693-87591715 ACCCCCACCCCCATTCCTTGAGG - Intronic
1028430865 7:90745018-90745040 CCCCTCTCCCCAATTTGTTTGGG + Intronic
1030824942 7:114143456-114143478 CCCCCCACCCCCAGTCTATTTGG + Intronic
1032096115 7:128939206-128939228 GCCCCCACCCCCAGTAGTTATGG + Intronic
1032151608 7:129434365-129434387 CCCTCCACCTCTATTGGTTACGG - Intronic
1033911859 7:146273502-146273524 ACACCCACCCCCATTTCTTTAGG - Intronic
1034162907 7:149005860-149005882 CCCCCCACCCCCGCAGGTCTTGG + Intronic
1034704371 7:153127418-153127440 CCCCCCACCCTCATGGCATTGGG + Intergenic
1034901504 7:154910527-154910549 CCCCACACCCACATTCCTTTTGG + Intergenic
1038084183 8:24175227-24175249 CACCCCACCCCCATTGTCTCTGG + Intergenic
1039150906 8:34504492-34504514 CCCCTCACCACACTTGGTTTTGG - Intergenic
1039246906 8:35618907-35618929 CTCCACACCCCCATTGGTGCTGG + Intronic
1039998566 8:42557078-42557100 CCCCCCACCCCCAACTATTTGGG + Intergenic
1040107663 8:43549616-43549638 CCCCCCACCCACACTGGGGTGGG + Intergenic
1041978173 8:63823614-63823636 CCCCCAACCCTCATTAATTTTGG + Intergenic
1043486635 8:80704585-80704607 CCCACCACCCCCAGAGGTTGGGG - Intronic
1044565589 8:93658580-93658602 CACCCCACCACCATTTATTTAGG + Intergenic
1045722450 8:105129516-105129538 CCCCCCACCCCCCATTCTTTAGG - Intronic
1047565078 8:126035110-126035132 CTCCCCACCCACAGTGGTATTGG - Intergenic
1049135697 8:140896778-140896800 CCCCCCCCCCCCGTTTTTTTGGG - Intronic
1049470545 8:142773342-142773364 GCCCCTACCCCCAGTGGTTGTGG - Intronic
1049959193 9:721987-722009 GTCCCCACCCCCTTGGGTTTCGG - Intronic
1051056784 9:12996794-12996816 CTCCCCTTCCCCATTGGCTTGGG - Intergenic
1051253002 9:15181111-15181133 CCCCAGCCCCCCATTGGTTGGGG - Intronic
1051451884 9:17206173-17206195 TACCCCACCCCCATTGGTATCGG - Intronic
1053313599 9:37034878-37034900 ACCCCCACCCCAATTTGTTGGGG + Intergenic
1055305398 9:74924061-74924083 CCCCCCACCCCCATGGAGCTGGG - Intergenic
1058519816 9:105806473-105806495 ACCCCCACCCCCAGCGATTTTGG + Intergenic
1059176358 9:112173271-112173293 GCCCCCACCCCCATTCTCTTTGG - Intronic
1059985297 9:119815137-119815159 CCCCCCAACCCTACTGGGTTGGG - Intergenic
1060121420 9:120993946-120993968 CACACCATCCTCATTGGTTTAGG - Intronic
1062397391 9:136357959-136357981 CCCCCCAGCCCCAGTGGTCCGGG - Intronic
1203690221 Un_GL000214v1:35514-35536 CACCTCACTCCCATTGTTTTGGG + Intergenic
1203711737 Un_KI270742v1:104422-104444 CACCTCACTCCCATTGTTTTGGG - Intergenic
1203711803 Un_KI270742v1:104848-104870 CACCTCACTCCCATTGTTTTGGG - Intergenic
1203555344 Un_KI270743v1:202729-202751 CACATCACCCCCATTGTTTTGGG - Intergenic
1203646054 Un_KI270751v1:68539-68561 CACCTCACTCCCATTGTTTTGGG - Intergenic
1185516351 X:701816-701838 CCCTCCACCTCCATAGGTTCTGG - Intergenic
1187296127 X:18002478-18002500 CCCCCCGCCCCCATTATTTTGGG - Intergenic
1188425958 X:30046995-30047017 CCAGCCACGCCCATTTGTTTTGG - Intergenic
1190141183 X:47846434-47846456 CCCCCCACCCTCATTTTTATTGG + Intronic
1191715154 X:64189263-64189285 CTCCCCACCCCTATTCCTTTTGG - Exonic
1192603400 X:72488345-72488367 CCCCCCACCCCCATTCCATAAGG + Intronic
1193227255 X:78998500-78998522 CCCCCCACCATTAGTGGTTTAGG - Intergenic
1196006132 X:110839227-110839249 TCCCCCACCCCCATGCCTTTTGG + Intergenic
1196175733 X:112637431-112637453 CCCACCACAAGCATTGGTTTGGG - Intronic
1198682860 X:139201389-139201411 CCTCCCACCCCCATCAGTTAGGG - Intronic
1199552863 X:149077152-149077174 CCCCCCACCCCCATTCCTGATGG + Intergenic
1200355979 X:155551362-155551384 CCCCCCACCCCAAATCCTTTGGG + Intronic