ID: 1120908482

View in Genome Browser
Species Human (GRCh38)
Location 14:89642972-89642994
Sequence TTTCTCACCAGACTATAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120908482_1120908485 -2 Left 1120908482 14:89642972-89642994 CCTCCTTATAGTCTGGTGAGAAA No data
Right 1120908485 14:89642993-89643015 AACATTATGTGACTTGAAGGTGG No data
1120908482_1120908484 -5 Left 1120908482 14:89642972-89642994 CCTCCTTATAGTCTGGTGAGAAA No data
Right 1120908484 14:89642990-89643012 AGAAACATTATGTGACTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120908482 Original CRISPR TTTCTCACCAGACTATAAGG AGG (reversed) Intergenic
No off target data available for this crispr