ID: 1120913673

View in Genome Browser
Species Human (GRCh38)
Location 14:89690743-89690765
Sequence AAGGGCAAAGAGGAGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120913665_1120913673 6 Left 1120913665 14:89690714-89690736 CCTCGAGAATCCCAACATTTTAG No data
Right 1120913673 14:89690743-89690765 AAGGGCAAAGAGGAGGAAGCAGG No data
1120913669_1120913673 -5 Left 1120913669 14:89690725-89690747 CCAACATTTTAGGAATATAAGGG No data
Right 1120913673 14:89690743-89690765 AAGGGCAAAGAGGAGGAAGCAGG No data
1120913667_1120913673 -4 Left 1120913667 14:89690724-89690746 CCCAACATTTTAGGAATATAAGG No data
Right 1120913673 14:89690743-89690765 AAGGGCAAAGAGGAGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120913673 Original CRISPR AAGGGCAAAGAGGAGGAAGC AGG Intergenic
No off target data available for this crispr