ID: 1120915321

View in Genome Browser
Species Human (GRCh38)
Location 14:89705345-89705367
Sequence TAGTGGCAAGTTAATTAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120915321_1120915323 -10 Left 1120915321 14:89705345-89705367 CCTACTTAATTAACTTGCCACTA No data
Right 1120915323 14:89705358-89705380 CTTGCCACTAAGTCTCTGGTTGG No data
1120915321_1120915328 17 Left 1120915321 14:89705345-89705367 CCTACTTAATTAACTTGCCACTA No data
Right 1120915328 14:89705385-89705407 CTCAAGGAATGGTCCTATACTGG No data
1120915321_1120915325 1 Left 1120915321 14:89705345-89705367 CCTACTTAATTAACTTGCCACTA No data
Right 1120915325 14:89705369-89705391 GTCTCTGGTTGGTGTCCTCAAGG No data
1120915321_1120915326 6 Left 1120915321 14:89705345-89705367 CCTACTTAATTAACTTGCCACTA No data
Right 1120915326 14:89705374-89705396 TGGTTGGTGTCCTCAAGGAATGG No data
1120915321_1120915329 18 Left 1120915321 14:89705345-89705367 CCTACTTAATTAACTTGCCACTA No data
Right 1120915329 14:89705386-89705408 TCAAGGAATGGTCCTATACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120915321 Original CRISPR TAGTGGCAAGTTAATTAAGT AGG (reversed) Intergenic
No off target data available for this crispr