ID: 1120916453

View in Genome Browser
Species Human (GRCh38)
Location 14:89714879-89714901
Sequence ATCTGCTGGTACCTTGATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120916453_1120916456 14 Left 1120916453 14:89714879-89714901 CCAGGATCAAGGTACCAGCAGAT No data
Right 1120916456 14:89714916-89714938 AAGCTCACTCTCTACTTCATAGG No data
1120916453_1120916457 17 Left 1120916453 14:89714879-89714901 CCAGGATCAAGGTACCAGCAGAT No data
Right 1120916457 14:89714919-89714941 CTCACTCTCTACTTCATAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120916453 Original CRISPR ATCTGCTGGTACCTTGATCC TGG (reversed) Intergenic
No off target data available for this crispr