ID: 1120916674

View in Genome Browser
Species Human (GRCh38)
Location 14:89716583-89716605
Sequence CTCTAACTGCAGTGCCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120916667_1120916674 21 Left 1120916667 14:89716539-89716561 CCCTGGAGGAAGAGGGAATTCAG No data
Right 1120916674 14:89716583-89716605 CTCTAACTGCAGTGCCTCCCTGG No data
1120916668_1120916674 20 Left 1120916668 14:89716540-89716562 CCTGGAGGAAGAGGGAATTCAGC No data
Right 1120916674 14:89716583-89716605 CTCTAACTGCAGTGCCTCCCTGG No data
1120916666_1120916674 24 Left 1120916666 14:89716536-89716558 CCTCCCTGGAGGAAGAGGGAATT No data
Right 1120916674 14:89716583-89716605 CTCTAACTGCAGTGCCTCCCTGG No data
1120916672_1120916674 -2 Left 1120916672 14:89716562-89716584 CCGGTAGACTCGGCCTTTGGACT No data
Right 1120916674 14:89716583-89716605 CTCTAACTGCAGTGCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120916674 Original CRISPR CTCTAACTGCAGTGCCTCCC TGG Intergenic
No off target data available for this crispr