ID: 1120922839

View in Genome Browser
Species Human (GRCh38)
Location 14:89770801-89770823
Sequence TCCTCGTGTTTGGTTTAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120922839_1120922842 1 Left 1120922839 14:89770801-89770823 CCAGCCTAAACCAAACACGAGGA No data
Right 1120922842 14:89770825-89770847 ATCTCCCACTCCCTGCTTAAAGG No data
1120922839_1120922843 2 Left 1120922839 14:89770801-89770823 CCAGCCTAAACCAAACACGAGGA No data
Right 1120922843 14:89770826-89770848 TCTCCCACTCCCTGCTTAAAGGG No data
1120922839_1120922844 3 Left 1120922839 14:89770801-89770823 CCAGCCTAAACCAAACACGAGGA No data
Right 1120922844 14:89770827-89770849 CTCCCACTCCCTGCTTAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120922839 Original CRISPR TCCTCGTGTTTGGTTTAGGC TGG (reversed) Intergenic