ID: 1120925804

View in Genome Browser
Species Human (GRCh38)
Location 14:89796135-89796157
Sequence AACAGGGTGATGAGGGTACT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120925804_1120925810 2 Left 1120925804 14:89796135-89796157 CCCAGTACCCTCATCACCCTGTT 0: 1
1: 1
2: 0
3: 7
4: 132
Right 1120925810 14:89796160-89796182 TCCTCTGTATATAGCCCGAGAGG 0: 1
1: 0
2: 0
3: 2
4: 47
1120925804_1120925812 3 Left 1120925804 14:89796135-89796157 CCCAGTACCCTCATCACCCTGTT 0: 1
1: 1
2: 0
3: 7
4: 132
Right 1120925812 14:89796161-89796183 CCTCTGTATATAGCCCGAGAGGG 0: 1
1: 0
2: 0
3: 4
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120925804 Original CRISPR AACAGGGTGATGAGGGTACT GGG (reversed) Exonic
903653400 1:24934428-24934450 AGCAGGGTGGTGAGGGTGTTAGG + Intronic
904993136 1:34610046-34610068 AACATTCTGATGTGGGTACTTGG + Intergenic
907280733 1:53345638-53345660 TACAGGGTGATGAGGGCCATGGG - Intergenic
907467893 1:54651577-54651599 AAAAGGGTGAAAAGGGGACTGGG + Intronic
912033265 1:105276636-105276658 AACAGTGAGAGGAAGGTACTAGG + Intergenic
913536521 1:119778129-119778151 AACAAGGAGTTGAGGGTAATTGG + Intergenic
915925806 1:160018631-160018653 CAAAGGGTGATGAGAGGACTTGG - Intergenic
1063183901 10:3633106-3633128 TTCAGAGTGATGACGGTACTAGG + Intergenic
1063881910 10:10540315-10540337 ATAAGGGTAATGAGGGTGCTAGG - Intergenic
1068503307 10:57867540-57867562 AACAGGGTGATGAGAGAATGAGG - Intergenic
1071819654 10:89266743-89266765 AACAGATTTATGAGGTTACTTGG - Intronic
1072618115 10:97063114-97063136 AAGAGGGTGATGAGTGGACAAGG + Intronic
1073994390 10:109299137-109299159 AACAGAGTGATGTTGGTTCTTGG - Intergenic
1074316503 10:112366303-112366325 AACAGAGTGATGACGGTGGTGGG - Intergenic
1077284250 11:1758813-1758835 AGCAGGGTGAGGAGGGGTCTGGG - Intronic
1077717015 11:4591523-4591545 ACTAGGGTGATGAGGGTTTTAGG + Intergenic
1078104362 11:8349499-8349521 AAAGGGGACATGAGGGTACTGGG - Intergenic
1080122519 11:28693683-28693705 AAGAGGGTGGTGAGGATTCTGGG + Intergenic
1081659553 11:44879645-44879667 AACAGGGTGAGGAGGGTGGTCGG + Intronic
1081967810 11:47180078-47180100 AATAGGGTAATAAGGGTGCTGGG + Intronic
1083026683 11:59557177-59557199 AATAGGGTGATTACGGAACTGGG + Intergenic
1083285587 11:61656615-61656637 TGCAGGGTGGTGAGGGTACAGGG + Intergenic
1083428110 11:62599746-62599768 CACAAGGTGATGAGAGTACCTGG - Intronic
1083893604 11:65609279-65609301 CACAGTGTGATGTGGGCACTAGG - Intronic
1084772785 11:71354845-71354867 AGCAGGGTGATGGGGTGACTGGG - Intergenic
1087175696 11:95092882-95092904 AAAAAGGTGATGTGGGTACAAGG - Intronic
1087239339 11:95757602-95757624 AACATGGTGTTGAGGTTCCTTGG - Intergenic
1089380908 11:118030759-118030781 AGCAGGATGAGGAGGGTTCTAGG + Intergenic
1089755119 11:120680860-120680882 TACAGGGAGAAGAGGGTCCTTGG - Intronic
1092130865 12:6112235-6112257 AACAGGGTGACAAGGGTGATGGG + Intronic
1100815042 12:98378770-98378792 ATCAGGGGGAGGAGGGTTCTGGG - Intergenic
1103134024 12:118492109-118492131 AACAGAGTGAAGAGAGGACTAGG - Intergenic
1104003454 12:124875298-124875320 GACAGGGAAATGAGGGGACTCGG + Intronic
1116692304 14:48124633-48124655 AATAGGAGGAAGAGGGTACTGGG - Intergenic
1119844354 14:77817344-77817366 AGCAGAGGGATGAGGGTACAAGG + Intronic
1120491753 14:85186913-85186935 AACAGGTTGATGTGAGTACTTGG - Intergenic
1120925804 14:89796135-89796157 AACAGGGTGATGAGGGTACTGGG - Exonic
1121901089 14:97694043-97694065 CACAGGGTGATGAGGGGCTTTGG + Intergenic
1125712705 15:41799751-41799773 AAGAAGGTGCTGAAGGTACTTGG - Intronic
1125817231 15:42596604-42596626 AATGGGGTTAAGAGGGTACTTGG - Intronic
1128377970 15:67090742-67090764 AACAGGGAGATGGGAGTGCTGGG - Intronic
1129787963 15:78321858-78321880 CACAGGGTGATGGGGGTGCTGGG - Intergenic
1129913962 15:79251614-79251636 AACACGGTGAGGAGGGTGTTTGG - Intergenic
1134027914 16:10968458-10968480 AACTGGGTGATGAGGGCCCAAGG - Intronic
1134835592 16:17358019-17358041 TCCAGGGTGATGAGCGGACTTGG + Exonic
1135480670 16:22818222-22818244 ACCAGGCTGATGAGGGAACCAGG + Intronic
1135608700 16:23846013-23846035 CACAGGGTGAGGAAGGTATTTGG - Intronic
1137875920 16:51996701-51996723 AAGAGGGGGAGGAGGGTACCAGG - Intergenic
1139111672 16:63899166-63899188 AAAATGGTGTTGAGGGTAGTTGG + Intergenic
1141799315 16:86296280-86296302 ATCAGGGTGATGGGGGAACATGG + Intergenic
1152436164 17:80277812-80277834 ACCATGGTGAGGAGGGTGCTAGG + Intronic
1156471071 18:37377578-37377600 AACACGGTGATGAGAGAACATGG + Intronic
1156564307 18:38167056-38167078 AACAGGGTGCTAAGTGTGCTTGG - Intergenic
1160116664 18:76085162-76085184 AAGAGGGGGCTGAGGGTAGTTGG - Intergenic
1163105155 19:15119111-15119133 AACAGGGTGAGGGGGTTCCTGGG + Intronic
1163327149 19:16612072-16612094 AACAGGGTGATGCAGGTTGTTGG + Intronic
1163390693 19:17028098-17028120 AACAGGGTGTTGGAGGAACTAGG - Intergenic
1165359491 19:35327104-35327126 ACAAGGGTGATGATGGAACTTGG + Intronic
1165362535 19:35345715-35345737 AACTGGGTACTGAGGGTACCAGG + Exonic
1166017167 19:39991022-39991044 ACCAGGGTGATAAGGGGACAGGG + Intronic
1168267422 19:55230421-55230443 GTCAGGGTGATGAGGGCAATGGG + Exonic
927411334 2:22829665-22829687 AACAGGGTGGTGGGGGTGCCAGG - Intergenic
933635179 2:84700977-84700999 AACTAGGTGAAGAGGGGACTGGG + Intronic
939179146 2:138783661-138783683 AATAGGGAGATGTGGGTACAAGG + Intergenic
944636797 2:201682536-201682558 AACCAGGTGATGAGGGAGCTGGG + Intronic
1170330885 20:15209228-15209250 AACACGGTGATGAGTTTTCTGGG - Intronic
1171135919 20:22694283-22694305 AACAGGGTTATGAGGATATCTGG - Intergenic
1174699593 20:52594605-52594627 AGCAGGATGGTGAGGGTAATGGG - Intergenic
1175290638 20:57872880-57872902 AATAGAGTGATGATGGTAATAGG + Intergenic
1175518658 20:59585526-59585548 AACAGGGTGATTACTGTGCTGGG - Intronic
1176017698 20:62944503-62944525 AACAAAGTGCTGAGGGGACTGGG - Intronic
1176888631 21:14286646-14286668 CACAGGGTAATGAGAGTACCAGG + Intergenic
1181949518 22:26543971-26543993 AGCAGGGTGATGAGGGTGTTGGG - Intronic
1183501260 22:38181093-38181115 ACCAGGGTGATCATGGGACTGGG - Intronic
1184849327 22:47111004-47111026 AACAGGGAAATGATGCTACTCGG - Intronic
954427378 3:50450499-50450521 AGCAGGGTGATGGGGGTGCAGGG - Intronic
956488932 3:69751149-69751171 AACAGGGTGATGGTGGTTTTGGG + Intronic
956755695 3:72383766-72383788 AAAAGGGTGATGAGGGTACTAGG + Intronic
957093455 3:75754729-75754751 AACAGGGTAATGAGAATACCAGG + Intronic
958787892 3:98618394-98618416 AAAAGGGTCATGCGGGTATTAGG - Intergenic
963993380 3:151679285-151679307 AACAGAGTTAAGAGGGTATTAGG + Intergenic
965268326 3:166578005-166578027 AACAGGGTAGTCAGGGTAGTTGG - Intergenic
966215728 3:177500307-177500329 AGCAGGGTTATGAGGGCACAGGG + Intergenic
976250791 4:83050176-83050198 AATAGGGTGATTGGGGTAGTAGG + Intronic
977644947 4:99401902-99401924 AAGAGGGTAATGGGGGTAATAGG + Intergenic
978462662 4:108974367-108974389 AACAAGGTGATCAGGGACCTAGG - Exonic
980972171 4:139576907-139576929 CTCAAGGTGATGATGGTACTAGG - Intronic
981550170 4:145936022-145936044 AACAGGGCGGTGAGGTTATTTGG - Intronic
983104100 4:163664047-163664069 AATAGGGTAGTGAGAGTACTCGG - Intronic
985535627 5:464427-464449 GTCAAGGTGATGAGGGAACTAGG - Intronic
992375449 5:76183849-76183871 TACAGGGTGATGGTTGTACTGGG - Intronic
993866438 5:93202216-93202238 GACAGGGTGATGAGGGGAAAGGG - Intergenic
997300217 5:132798201-132798223 AACAGGTTGAAGAGGGTGGTTGG - Intronic
1000483738 5:161812472-161812494 AACAGGGTGATCCGGGAACCTGG + Intergenic
1001051604 5:168418643-168418665 AAGAGGATGATGAGGGGTCTGGG - Intronic
1005602846 6:27445443-27445465 ACCAGGGTGATTAGGTTATTAGG + Intergenic
1005887163 6:30105997-30106019 AACTGGGAGATGAAGGCACTCGG - Intronic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1011532159 6:88334586-88334608 AGAAGGGTGATGAGGGTAGTGGG + Intergenic
1011654053 6:89533508-89533530 TACAGAGTGAAGAGGGTACCAGG - Intronic
1013338026 6:109185177-109185199 AACAGGGATATGAAGGTCCTGGG - Intergenic
1019162587 6:170079065-170079087 GACATGGTGATGAAGGAACTCGG - Intergenic
1021889343 7:25172354-25172376 AGCAGGATGGTGAGGCTACTGGG + Intronic
1022796975 7:33739645-33739667 TCCAGGGTGATGAGGTGACTAGG + Intergenic
1025806019 7:64835517-64835539 ACCAGGGTGGAGAGGGTCCTAGG + Intergenic
1026736225 7:72950304-72950326 AACAGGGTGATAAGGGAATCCGG + Exonic
1027107506 7:75414758-75414780 AACAGGGTGATAAGGGAATCCGG - Intergenic
1033792619 7:144809526-144809548 AGCAGAGAGATGATGGTACTTGG - Intronic
1034641662 7:152608778-152608800 AAAAGGGTTAATAGGGTACTTGG - Intergenic
1035299509 7:157887810-157887832 TACTGGGTGAAGCGGGTACTGGG - Intronic
1035808792 8:2474151-2474173 AACAAGGTGATGTGGGGCCTTGG - Intergenic
1036485169 8:9172888-9172910 AAGAGGGTGATGAGCGAATTTGG - Intergenic
1037691108 8:21182361-21182383 AAGAGGGGGAAGTGGGTACTGGG + Intergenic
1038674677 8:29612944-29612966 CACAGGATGATGTGGGCACTGGG - Intergenic
1042350444 8:67771985-67772007 ACCAGAGTCATGAGGGTTCTGGG + Intergenic
1042397477 8:68308903-68308925 ATCAGGGTGAAGAAGGAACTAGG + Intronic
1042954879 8:74239012-74239034 AACAGGGTGATGAGTAAAATGGG + Intronic
1045515660 8:102858507-102858529 ACTAGGTTGGTGAGGGTACTTGG - Intronic
1047190908 8:122678228-122678250 AACAGGGTGCCCAGGGTAGTAGG - Intergenic
1048755930 8:137738141-137738163 ATTAGGGAGATGAGGCTACTGGG - Intergenic
1048816116 8:138335313-138335335 AATAAGATGATGAGGGTGCTGGG - Intronic
1049292710 8:141812980-141813002 GTCAGGGAGATGAGGGTGCTGGG - Intergenic
1049292718 8:141813004-141813026 GTCAGGGAGATGAGGGTGCTGGG - Intergenic
1049292775 8:141813165-141813187 GTCAGGGAGATGAGGGTGCTGGG - Intergenic
1049292799 8:141813235-141813257 GTCAGGGAGATGAGGGTGCTGGG - Intergenic
1049292863 8:141813417-141813439 GTCAGGGAGATGAGGGTGCTGGG - Intergenic
1049292949 8:141813644-141813666 GTCAGGGAGATGAGGGTGCTGGG - Intergenic
1052909514 9:33867963-33867985 AACAGGGTGCTGAGAGGACAGGG - Intronic
1053323232 9:37119041-37119063 TAAAGGGTGATGCAGGTACTGGG - Intergenic
1055874324 9:80923957-80923979 AACCCTGTGATGAGGGTACTAGG - Intergenic
1060367523 9:123033582-123033604 AACAGGGAGAAGAGGGGGCTTGG - Intronic
1061042445 9:128148056-128148078 AACAGGGTCATGAGGGGAAGAGG + Intergenic
1186817832 X:13255584-13255606 ATCAGGGTGAGGAGGTTACTGGG - Intergenic
1188495829 X:30781980-30782002 AACAGGGTAATGATGATATTGGG - Intergenic
1190056621 X:47185006-47185028 CCCAGGGTCATGAGGGTTCTGGG + Intronic
1193765828 X:85528088-85528110 AACAGTATGAAGAGGGTCCTCGG - Intergenic
1193803427 X:85965306-85965328 AATAGAGTGATGAGTGTAATTGG - Intronic
1193869863 X:86783828-86783850 CAGAGGGTGATAAGGGTAGTGGG + Intronic
1195351889 X:104004272-104004294 AAGAGGTTGATGAGGGAATTGGG + Intergenic
1199482539 X:148312858-148312880 ATCTGGGTGAAGAGGGTACATGG - Intergenic
1201375644 Y:13315969-13315991 CCCAAGGTGATGAGGGTAGTTGG - Intronic