ID: 1120925898

View in Genome Browser
Species Human (GRCh38)
Location 14:89796823-89796845
Sequence CCGTGGCCTGCAGTGTGGAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 346}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120925898 Original CRISPR CCGTGGCCTGCAGTGTGGAG AGG Exonic
900102088 1:966285-966307 ACGAGGCCTCCAGTGTGCAGAGG - Intergenic
900167099 1:1248199-1248221 TCCTGGCCTGTAGGGTGGAGTGG - Intergenic
900611798 1:3547352-3547374 CCCGGGCCTTCAGTGTGGTGTGG + Intronic
900694412 1:4000958-4000980 CCGTGGCCTTCAGTGACGAGAGG + Intergenic
900801200 1:4738178-4738200 CCGTGGCCTGCCATGTGGCTGGG - Intronic
901654365 1:10760915-10760937 CCTTGTCCTCCAGTGTGGGGTGG - Intronic
902764085 1:18603407-18603429 CCCTGGCCTGCTGGGAGGAGAGG - Intergenic
903474589 1:23610863-23610885 CTGTGGCCTGAAGGGTGGGGAGG + Intronic
904036945 1:27564087-27564109 CTGTGGCCTGAAGTTTGGAGAGG - Intronic
904425470 1:30419966-30419988 CCCTGCCCTGCAGTGTAGTGTGG + Intergenic
904428115 1:30444583-30444605 CCATGGTCAGCAGGGTGGAGTGG + Intergenic
904642119 1:31938558-31938580 CCGTAGCCGGGAGTGCGGAGCGG - Intronic
905017038 1:34785043-34785065 ACGTGGCCTACCGTGAGGAGCGG + Exonic
907372868 1:54014355-54014377 CCGCCGCCTGCTGTGTGGGGGGG + Exonic
907700496 1:56782458-56782480 CCGTGTCAGGCAGTGGGGAGTGG - Intronic
907781348 1:57569584-57569606 CCGGGGCCTGTTGTGTGGTGGGG + Intronic
908545063 1:65154089-65154111 CTTTTGCCTGCTGTGTGGAGAGG + Intronic
909587686 1:77309064-77309086 CTGGGGCCTGCAGGGTGGTGGGG + Intronic
910340379 1:86180459-86180481 CCGGGGCCTGTTGTGGGGAGGGG - Intergenic
913075772 1:115339082-115339104 GTGGGGCCTGGAGTGTGGAGAGG - Intergenic
913243487 1:116851224-116851246 CCGGGGCCTGTAGTGGGGTGGGG - Intergenic
913406442 1:118497375-118497397 CCGGGGCCTGTAGTGGGGTGGGG + Intergenic
913647331 1:120871014-120871036 CTGTGGCCTGCTCTGTGGTGGGG - Intergenic
913702166 1:121384099-121384121 ACGTGGCCTGAGTTGTGGAGTGG + Intronic
914042724 1:144064568-144064590 ACGTGGCCTGAGTTGTGGAGTGG + Intergenic
914135362 1:144895920-144895942 ACGTGGCCTGAGTTGTGGAGTGG - Intronic
916190488 1:162173032-162173054 CAGGGGGCTGCAGTGTGCAGTGG - Intronic
916209384 1:162347662-162347684 CAGTGGTCTGCTGGGTGGAGTGG + Intronic
916337279 1:163687067-163687089 CCTTGGCCTTGAGTTTGGAGAGG + Intergenic
916437799 1:164792803-164792825 CCGGGGCTTGCAGAGAGGAGCGG + Intronic
917501582 1:175590650-175590672 GGGTGGCCAGCAGTGAGGAGGGG + Intronic
920338770 1:205262376-205262398 CCTGGGCCTGGTGTGTGGAGGGG - Intronic
920489587 1:206402814-206402836 ACGTGGCCTGAGTTGTGGAGTGG + Intronic
921081068 1:211738722-211738744 CAGTGGGCTGCAGGGTTGAGGGG + Intergenic
922276257 1:224081673-224081695 CCCTGCCCTTCAGTGTGGGGTGG + Intergenic
922569600 1:226626162-226626184 ACATGGCATGCAGTGTGAAGAGG - Intergenic
922689449 1:227676675-227676697 CCGGGGCCTGTTGTGGGGAGGGG - Intronic
922910683 1:229213680-229213702 CTGTGGCCTGCAGTGAGCTGTGG + Intergenic
923390498 1:233510342-233510364 CCGGGGCCTGTAGTGGGGTGGGG - Intergenic
1063120957 10:3105413-3105435 CCTTGGCCTGCGGTGCGGACTGG + Exonic
1066021592 10:31309225-31309247 CCGGGGCCTGTTGTGTGGGGTGG - Intergenic
1067406732 10:46030383-46030405 CCCGGGCCTGGCGTGTGGAGGGG + Intronic
1068553167 10:58428440-58428462 CCGGGGCCTGTTGTGGGGAGGGG - Intergenic
1069823592 10:71242102-71242124 CCCTGGAGTGCAGTGGGGAGAGG + Intronic
1071016684 10:81005601-81005623 CCGGGGCCTGTTGTGTGGTGGGG + Intergenic
1071600801 10:86957924-86957946 TCCTGGCCAGCAGTGTGGATGGG - Intronic
1073647306 10:105318764-105318786 CCGTGGCCTGTTGTGGGGTGGGG - Intergenic
1075714804 10:124550009-124550031 CCTTGGCATGCAGGGTGGATGGG + Intronic
1076696151 10:132248368-132248390 GCCTGCCCTGCAGTGGGGAGGGG + Intronic
1076811600 10:132889120-132889142 CTGTGGCCTGCAGAGTGCTGGGG - Intronic
1076921868 10:133458475-133458497 CCGGGAGCTGCAGTGTGGGGCGG + Intergenic
1077019972 11:413019-413041 CTGTGGCATCCAGTGAGGAGAGG - Intronic
1077218057 11:1403319-1403341 CTGTGGCCTGCGGTGAGGGGTGG - Intronic
1077241822 11:1514653-1514675 CCGTGGCCTGCGGTGATGAAGGG - Intergenic
1077251827 11:1564187-1564209 CCATGGCTTGCTGTGTGGTGTGG - Intronic
1077472086 11:2768828-2768850 CCGCAGCCTGCAGTGGAGAGAGG - Exonic
1077783812 11:5360977-5360999 CCAGGGCCTGCAGTGGGGTGGGG + Intronic
1077805233 11:5584429-5584451 CCGAGGCCTGTAGTGTGGTGGGG - Intronic
1077836133 11:5929624-5929646 GCATGGGCTGCAGTTTGGAGGGG - Intronic
1080815707 11:35754658-35754680 CCGGGGCCTGCTGTGGGGTGGGG - Intronic
1081702616 11:45161578-45161600 CCTTGGCCTGCAGGGTGGGCAGG + Intronic
1082311629 11:50656646-50656668 CCGGGGCCTGTTGTGTGGTGGGG - Intergenic
1083309623 11:61777632-61777654 CTGGAGGCTGCAGTGTGGAGAGG - Intronic
1083413774 11:62512254-62512276 CCGTGCCCTCCAGTGGAGAGAGG + Intronic
1084704224 11:70806587-70806609 CCGGGGCCTGCAGTGTTCAAAGG - Intronic
1084831750 11:71774921-71774943 CCGAGCCCTGCCTTGTGGAGAGG - Intergenic
1087616769 11:100494655-100494677 CCGGGGCCTGTTGTGGGGAGGGG + Intergenic
1088982308 11:114874850-114874872 CCAGGGTCTGAAGTGTGGAGAGG - Intergenic
1089572436 11:119419425-119419447 CCGTGGCCTGGAGGAGGGAGAGG + Exonic
1095482807 12:42653185-42653207 CCGGGGCCTGTTGTGTGGTGGGG - Intergenic
1095739696 12:45593393-45593415 CCTAGACCTGCAGAGTGGAGGGG + Intergenic
1095962493 12:47844340-47844362 GCGGGGCCTGCAGTGGGGGGAGG + Exonic
1096934025 12:55249909-55249931 CCGGGGCCTGCTGTGAGGTGGGG - Intergenic
1097545831 12:61000512-61000534 CCGGGGCCTGTAGTGGGGTGGGG - Intergenic
1098173034 12:67765621-67765643 TGTTGGCCTGCAGTGAGGAGTGG + Intergenic
1098798977 12:74928911-74928933 CCAAGGGCTGCAGAGTGGAGTGG + Intergenic
1099488695 12:83260130-83260152 CCGTGGCCTGTAGTGGGGTAGGG - Intergenic
1099892141 12:88602957-88602979 CCGGGGCCTGCAGGGGGGTGGGG - Intergenic
1102508193 12:113397289-113397311 CGGGGGCCTGCTGTGTGGAGTGG - Exonic
1102867734 12:116387358-116387380 TCAGGGCCTGCAGTGTGCAGTGG - Intergenic
1103987022 12:124774181-124774203 CCGTTGGCTGTAGAGTGGAGGGG - Intergenic
1104038394 12:125114246-125114268 GCGTGGCTTGTAGTCTGGAGAGG - Intronic
1105325657 13:19368716-19368738 CCCTGGCTTGTAGTGTGGAAGGG - Intergenic
1105801244 13:23904293-23904315 CCTTGGGCTGCACTGGGGAGGGG - Intergenic
1106005447 13:25765909-25765931 CCGACCCCTGCAGTGTGAAGTGG + Intronic
1106175754 13:27329809-27329831 CCGTGGACTGCAGAGTGAAGGGG + Intergenic
1106414842 13:29537961-29537983 CCCTGAGCTGCAGTGTGGGGAGG - Intronic
1106476794 13:30105782-30105804 CCATGGGCTTCAGTGGGGAGAGG + Intergenic
1106591804 13:31104701-31104723 CTGTTGCCAGCAGTGTGGTGAGG + Intergenic
1108806026 13:54157653-54157675 CCGTGGCCTGTTGTGGGGTGGGG - Intergenic
1109409730 13:61946225-61946247 CCGGGGCCTGTAGTGGGGTGTGG + Intergenic
1109833608 13:67826361-67826383 CCGGGGCCTGCCGTGGGGTGGGG + Intergenic
1110418212 13:75275463-75275485 CCGTGGCCTGTCGTGGGGTGGGG - Intergenic
1111267991 13:85844281-85844303 CCGGGGCCTGCTGTGGGGTGGGG + Intergenic
1112431541 13:99354790-99354812 CCGTGGCATGCAGATTGGATTGG + Intronic
1113386118 13:109849955-109849977 CCGTGGCCTGTGGTGGGGTGGGG - Intergenic
1113796853 13:113063380-113063402 CCGTGGGCAGCTGTGTGGACAGG - Intronic
1113948740 13:114059570-114059592 CCGCAGGCTGCACTGTGGAGAGG - Intronic
1115301656 14:31892368-31892390 AAGTGGCCTGCAGTGAGAAGGGG - Intergenic
1116161506 14:41271601-41271623 CCGTGGCCTGTTGTGGGGTGGGG - Intergenic
1116183533 14:41566946-41566968 CCGGGGCCTGCTGTGGGGTGGGG + Intergenic
1116471935 14:45295587-45295609 CCGGGGCCTGTTGTGGGGAGCGG + Intergenic
1116684154 14:48016660-48016682 CTGTGGCCTGTCGTGTGGTGGGG - Intergenic
1117894778 14:60472555-60472577 CCGGGGCCTGTTGTGGGGAGGGG - Intronic
1118941663 14:70345095-70345117 CTGTGGCCTGCTGTCTGGGGTGG - Intronic
1119401477 14:74365541-74365563 CTGGGGCTTGCAGTATGGAGTGG - Intergenic
1119635483 14:76269860-76269882 CAGTAGCCCGCATTGTGGAGAGG - Intergenic
1120839127 14:89067746-89067768 CCGTGGCCACCAGAGTAGAGAGG + Intergenic
1120925898 14:89796823-89796845 CCGTGGCCTGCAGTGTGGAGAGG + Exonic
1122468226 14:101948720-101948742 CCGTGGGCTGGGTTGTGGAGCGG + Intergenic
1122717384 14:103703662-103703684 CCCTGCCCTGCAGTGGGGAACGG - Intronic
1122880328 14:104687958-104687980 CCGTGCCCTCCAGGGTGGGGTGG + Intergenic
1123783716 15:23648107-23648129 CACTGTACTGCAGTGTGGAGTGG + Intergenic
1124892761 15:33748166-33748188 CTGTGGGCTGGACTGTGGAGAGG + Exonic
1127959786 15:63882258-63882280 TCGTGGCTTGCACTGGGGAGAGG + Intergenic
1127964473 15:63913675-63913697 GCGTGGCCAGCAGTGTGCACTGG - Intronic
1128471989 15:67962181-67962203 CGGTAGCCTGCACTGGGGAGTGG - Intergenic
1130571731 15:85051976-85051998 CCGGGGCCTGCTGTGGGGTGTGG - Intronic
1131228704 15:90645556-90645578 CCGTGGGCAGGGGTGTGGAGCGG - Intergenic
1132113837 15:99121257-99121279 CCAGGGCCAGCACTGTGGAGGGG + Intronic
1132465641 16:76287-76309 CTGTGGCCTGCAGAGTGGGCTGG - Intronic
1132469805 16:96074-96096 CCGTGGCCTTGACTGGGGAGAGG - Intronic
1132674962 16:1117690-1117712 CCCTGTCCTGCGGTGGGGAGTGG - Intergenic
1132949002 16:2549880-2549902 GTGTGGCCTGCGGTGTGGCGAGG + Intronic
1133229740 16:4360837-4360859 GCGGGGCCAGCAGTGAGGAGAGG - Intronic
1133229752 16:4360881-4360903 GCGGGGCCAGCAGTGTGGAGAGG - Intronic
1133229758 16:4360903-4360925 GTGGGGCCAGCAGTGTGGAGAGG - Intronic
1133301915 16:4787770-4787792 CAGAGGCATGAAGTGTGGAGGGG - Intronic
1133558313 16:6926403-6926425 CTGAGGCCTGCTGTGTGGTGAGG - Intronic
1136655459 16:31706616-31706638 CTGTGGACTGCAGTGTGGAGAGG + Intergenic
1137454619 16:48609168-48609190 CAGTGGAGTGCAGTGTGGCGCGG - Intronic
1137548171 16:49418367-49418389 CCATGGCTGGCAGTGAGGAGCGG + Intergenic
1137748565 16:50841664-50841686 CCGTGTCCTGCAGGGCTGAGGGG - Intergenic
1138340344 16:56285055-56285077 CCGTGGCGTGCAGAGTTGAGTGG + Intronic
1139363474 16:66418393-66418415 TCGGAGGCTGCAGTGTGGAGAGG + Intergenic
1139595986 16:67958561-67958583 GAGTGGGCTGGAGTGTGGAGAGG - Intronic
1141869242 16:86773311-86773333 ACGTGGCCAGCAGGGAGGAGAGG + Intergenic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1147658044 17:42102095-42102117 CCATGGCCTCCAGTCTGAAGAGG - Intronic
1147938078 17:44024988-44025010 CAGTGAGCTGCAGTGTGGGGTGG - Intergenic
1149102988 17:52928288-52928310 CCGTGGCCTGAAGTGAGAAGAGG - Intergenic
1149199470 17:54165864-54165886 CCGGGGCCTGCTGTGGGGTGGGG + Intergenic
1149656319 17:58311207-58311229 CCATGATCTGCAGGGTGGAGGGG + Exonic
1150295100 17:64003214-64003236 CCGTGGCCTGGAGGGTGGCATGG + Intronic
1151477762 17:74353478-74353500 CCGGGGCCTGTGGGGTGGAGTGG - Exonic
1152046841 17:77942344-77942366 CTGTGGCCTGCCGAGTGGTGGGG + Intergenic
1152500165 17:80702786-80702808 CCGTGGCCTTCTGTGTGGCGTGG + Intronic
1152881057 17:82815490-82815512 CAGTGGCCAGCAGTGGGGTGGGG + Intronic
1153161552 18:2210387-2210409 CCGGGGCCTGTTGTGTGGTGGGG + Intergenic
1153920359 18:9783378-9783400 CCCTTACCTGCACTGTGGAGGGG + Intronic
1154000157 18:10475874-10475896 TCTTGGCCTGCAGTGTGCAGCGG + Intronic
1154950553 18:21205333-21205355 CCGGGGCCTGCCGTGGGGTGGGG + Intergenic
1155131049 18:22934669-22934691 CCGGGGCCTGCCGTGGGGTGGGG - Intronic
1155599005 18:27522314-27522336 CCGGGGGCTGAAGTGTGGGGTGG - Intergenic
1157701603 18:49764364-49764386 CCAGGGCCTGGAGTGGGGAGGGG + Intergenic
1158883288 18:61801540-61801562 CCGTGGGATGCAGTGGTGAGTGG + Intergenic
1160622328 18:80180055-80180077 CAGTGGTCTGCAGAGAGGAGAGG + Intronic
1160960433 19:1718476-1718498 CAGTGGGGTGCAGTGGGGAGGGG + Intergenic
1161294005 19:3510560-3510582 CAGTGGCCTGCAGGCTGGTGGGG - Intronic
1161664682 19:5568107-5568129 CTGGGGCCAGCAGTGGGGAGCGG - Intergenic
1161771933 19:6235590-6235612 CTGTGGCCAGGAGTGTGGAGAGG - Intronic
1162033523 19:7927300-7927322 CCTTGTCCTGCAGGGTGGGGTGG + Exonic
1162413386 19:10519319-10519341 CTGTGGCCAGGAGTGTGGAGTGG - Intergenic
1163025084 19:14506123-14506145 CCATAGCCCGCAGCGTGGAGGGG - Intergenic
1163153476 19:15428066-15428088 CCAGGGCCCGCAGTGAGGAGGGG + Intronic
1163158493 19:15451688-15451710 ACTTGGCCTACAGTGGGGAGTGG - Exonic
1163327928 19:16617245-16617267 CCCTGGCCTGGAATGGGGAGGGG - Intronic
1164075800 19:21816944-21816966 CCCTGGCCTGTAGTGAAGAGGGG - Intronic
1164132573 19:22378590-22378612 CCGTGGCCTGTCATGGGGAGGGG - Intergenic
1168272691 19:55258625-55258647 CCGGGTCCTGCAGAGTTGAGGGG + Exonic
1168329666 19:55559963-55559985 CACTGGGCTGCAGTGTGGCGGGG + Intergenic
1168690432 19:58373422-58373444 CCGTGGCCTGGACTGTGCACAGG + Intronic
925139662 2:1541218-1541240 CAGTGGCCTCCAGAGGGGAGTGG + Intronic
925215764 2:2094759-2094781 CCGGGGCCTGCTGTGGGGTGGGG + Intronic
925298842 2:2795684-2795706 CAGAGGCCTGCTGTGGGGAGCGG + Intergenic
926896342 2:17693532-17693554 CCGGGGCCGGCTGTGTGGTGGGG + Intronic
927480069 2:23446478-23446500 ACTTAGCCTGCAGCGTGGAGTGG + Intronic
927578596 2:24221406-24221428 TCATGACCTGCAGTTTGGAGTGG - Intronic
927616102 2:24597932-24597954 CCGGGGCCTGTTGTGGGGAGGGG - Intronic
929913428 2:46113659-46113681 CCCTGGCTTGCAGTGGGAAGGGG + Intronic
930777983 2:55194094-55194116 TGGTTGCCTGCAGTTTGGAGAGG + Intronic
930947174 2:57089356-57089378 CCGGGGCCTGCTGTGGGGTGGGG - Intergenic
930958114 2:57228470-57228492 CCGGGGCCTGCTGTGGGAAGGGG + Intergenic
931160860 2:59688844-59688866 CCGGGGCCTGTTGTGTGGTGGGG + Intergenic
931200802 2:60095768-60095790 CCATGGCTTGCAGTGCGGATGGG + Intergenic
931722306 2:65076088-65076110 CTGTTTCCTGCAGTGTGGAGAGG - Intronic
931903940 2:66822079-66822101 CGGTGGCCAGCAGTGTACAGGGG - Intergenic
932963250 2:76440845-76440867 CCGTGGCCTGTTGTGGGGTGGGG - Intergenic
933832817 2:86224462-86224484 CTGAGGCCTGCAGAGTGCAGGGG + Intronic
934549846 2:95252239-95252261 CTGGGGCCTGCTGTGTGGTGGGG - Intronic
935373629 2:102373447-102373469 CCGGGGCCTGTTGTGTGGGGTGG + Intronic
937572875 2:123385439-123385461 CCGGGGCCTGTCGTGTGGTGTGG + Intergenic
937887237 2:126908245-126908267 ACGTGGCTTGCATGGTGGAGGGG - Intergenic
938237751 2:129720545-129720567 CCGAGCCCTGCCCTGTGGAGGGG - Intergenic
939996940 2:148928569-148928591 CACCGACCTGCAGTGTGGAGGGG + Intronic
940351803 2:152699169-152699191 CCATGGCCTGCAGGTTGGACAGG - Intronic
941124137 2:161565840-161565862 CCGGGGCCTGCCGTGGGGTGGGG - Intronic
941589588 2:167403176-167403198 CCGGGGCCTGTAGTGGGGTGGGG - Intergenic
942936572 2:181563969-181563991 CCATGGACTGCAGGGTGGGGTGG + Intronic
946159490 2:217827508-217827530 CCGTGGCCTGGGGAGTGGAGCGG - Intronic
947712883 2:232325962-232325984 CCGTGGCCCAGAGTGTGGAGCGG + Intronic
947732567 2:232439404-232439426 CCGTGGCCCAGAGTGTGGAGCGG + Intergenic
948047175 2:234952929-234952951 CCGGGGCCTGCGGTGTAGACGGG + Intronic
948369795 2:237481393-237481415 CCGTAGCCTTCAGTGAGGACTGG + Intergenic
948671956 2:239574564-239574586 CCCTGGCCCCCACTGTGGAGTGG + Intergenic
948864594 2:240768874-240768896 TAGTGGCCTGGAGTGTGGACTGG - Intronic
1169062736 20:2673360-2673382 CCCAGGACTGCAGTGTGGACTGG + Intergenic
1170776551 20:19379705-19379727 CAGTGGCCTGGAGGGAGGAGGGG - Intronic
1171173729 20:23036067-23036089 CCGTGGCCTGCAACCTGCAGTGG + Exonic
1171209698 20:23307752-23307774 CCGGGGCCTGTTGTGTGGTGGGG + Intergenic
1171273147 20:23832074-23832096 CCCTGGGCTGCAGTCTGCAGAGG + Intergenic
1172638192 20:36424038-36424060 AAGTGTCCTGCAGTGAGGAGGGG + Intronic
1173227420 20:41170035-41170057 CCAGTGCCTGCGGTGTGGAGTGG + Intronic
1174595426 20:51679626-51679648 GCGTGGCCTGCAGGCTGCAGAGG - Intronic
1174846384 20:53947565-53947587 TCGTGGGCTGCAGTGAGGACCGG - Intronic
1174847142 20:53953521-53953543 CCGTGGCCTGCTCTGTGCACTGG + Exonic
1175202995 20:57290817-57290839 CCGGGCCATGCAGTGTGCAGTGG - Intergenic
1176047329 20:63099701-63099723 CCTTGGGCTGCAGTGTGCATTGG + Intergenic
1178293130 21:31386620-31386642 CCTTGCCCTGCAGTTTGCAGGGG - Intronic
1178581329 21:33840974-33840996 GCCTGCTCTGCAGTGTGGAGAGG - Intronic
1178592590 21:33924078-33924100 GCTTGACCTGCAGTGGGGAGAGG - Intergenic
1178958140 21:37041731-37041753 CCCAGGCCTGCTGTGGGGAGAGG - Intergenic
1179610638 21:42547886-42547908 CGGTGGCCTGCAGACAGGAGGGG - Intronic
1179719521 21:43307306-43307328 CTGTGGTCTCCTGTGTGGAGAGG - Intergenic
1181707455 22:24657602-24657624 ACGTGGGGTTCAGTGTGGAGGGG + Intergenic
1183357684 22:37368343-37368365 CCCTGTGCTGGAGTGTGGAGTGG + Exonic
1183697689 22:39432495-39432517 CCCTGCCCAGCAGAGTGGAGGGG - Intronic
950235713 3:11318551-11318573 ACTTGGACAGCAGTGTGGAGGGG - Intronic
950519268 3:13486915-13486937 CCCAGGCCTGGAGGGTGGAGGGG + Intronic
950532016 3:13557735-13557757 ACGTAGCCTGAAGTGTGAAGGGG + Intronic
950880176 3:16316977-16316999 TGGTGGCCTGCTGTGTGGGGTGG - Exonic
952817548 3:37458691-37458713 CCTTGGCCTGCAGTGTGGCTGGG + Intronic
953153305 3:40344684-40344706 GCGTTGCCTGCAGTGGGGTGGGG - Intergenic
953610693 3:44445162-44445184 GAGGGGCCTGCAGTGTGCAGGGG + Exonic
953709098 3:45254927-45254949 TCGTGAGCTGCACTGTGGAGAGG + Intergenic
953819158 3:46189285-46189307 CCTCTGCCTGCAGTGTTGAGTGG - Intronic
953867323 3:46595568-46595590 CCCTGGGCTGCAGAGTGGAGCGG + Intronic
954069519 3:48132677-48132699 GGGTTGCCTGCAGTTTGGAGTGG - Intergenic
954304026 3:49716200-49716222 CCGAGGCCTGTAGTGTGTTGGGG - Intronic
954409885 3:50365856-50365878 CGGTGGGCTGCAGTGGAGAGAGG + Exonic
957172221 3:76752275-76752297 CCGGGGCCTGTAGTGGGGTGGGG + Intronic
957574808 3:81993599-81993621 CAGTGAGCTGCAGTGTGAAGTGG + Intergenic
960226616 3:115176824-115176846 CCGGGGCCTGTAGTGGGGTGGGG - Intergenic
961344638 3:126256157-126256179 CAGAAGCCTGCAGTGTGGAGGGG + Intergenic
962269298 3:133966467-133966489 CCTGGGGCTGCAGTGCGGAGAGG - Intronic
962350094 3:134650427-134650449 CTGTGCCCTGCAGTGTGCTGTGG + Intronic
963693615 3:148536596-148536618 CCATGTCTTGCAGTGGGGAGTGG - Intergenic
965073110 3:163941206-163941228 CCGGGGCCTGCCGTGGGGTGGGG - Intergenic
966678964 3:182619773-182619795 CCGGGGCCTGCCGTGGGGTGGGG + Intergenic
968523499 4:1045122-1045144 CCCTGGCCTGCACTGTGGGGAGG - Intergenic
968576447 4:1368521-1368543 CCCTGGGCTTCAGTGGGGAGGGG - Intronic
968702924 4:2065259-2065281 CCCTGGCCTGCAGTGTGGGCAGG + Exonic
968730887 4:2268715-2268737 CCTTGGCCTGCCTTGTGCAGGGG - Intergenic
968921726 4:3525701-3525723 GCGTGGCCTGCCCTGCGGAGAGG - Intronic
969125365 4:4943936-4943958 CCCTGGCCTCCAGGGTGCAGAGG - Intergenic
969425366 4:7121087-7121109 CCGTGGCCTACAGGGAGCAGTGG - Intergenic
970565292 4:17326136-17326158 CCGTGTCCTGTAGTGGGGTGGGG - Intergenic
971096856 4:23416380-23416402 CCGGGGCCTGTTGTGGGGAGGGG - Intergenic
972174140 4:36382461-36382483 CCGTGGCCTGTTGTGGGGTGGGG + Intergenic
972437265 4:39045397-39045419 TGGTGGCCGGCAGTGAGGAGCGG + Intronic
973637956 4:52877292-52877314 CTGGGGCCTGCTCTGTGGAGGGG + Intronic
977140730 4:93368558-93368580 CCGGGGCCTGTTGTGGGGAGAGG - Intronic
982893388 4:160884257-160884279 CTGGGGCCTGCAGTGGGGTGGGG + Intergenic
983056861 4:163107754-163107776 CCTTGGCAAGCAGGGTGGAGGGG - Intergenic
983282054 4:165693491-165693513 CCGGGGCCTGCTGTGGGGTGGGG + Intergenic
984770227 4:183430828-183430850 CCCAGGCCTGCACTTTGGAGAGG + Intergenic
984949280 4:184994727-184994749 GCGTGTCCTGAGGTGTGGAGAGG + Intergenic
985766979 5:1785289-1785311 CCGAGGGCAGCTGTGTGGAGGGG - Intergenic
986310287 5:6546219-6546241 CCGCAGCCTGCTGTGTGAAGTGG + Intergenic
986410623 5:7475301-7475323 CCGTGGTCTGGAGAATGGAGAGG + Intronic
986877186 5:12126060-12126082 CTGCGGCCTGGAGTGGGGAGGGG + Intergenic
987857268 5:23437152-23437174 CTTTGGCCAGCAGTGTTGAGTGG - Intergenic
988312288 5:29575828-29575850 CCGGGGCCTGTCGTGGGGAGGGG + Intergenic
989395596 5:40952648-40952670 CCGGGGCCTGTAGTGGGGTGGGG - Intronic
989418800 5:41211224-41211246 CCGGGGCCTGTAGTGGGGTGGGG + Intronic
990621774 5:57567711-57567733 CCCTGGAATGCAGTGAGGAGAGG + Intergenic
990753632 5:59043709-59043731 CCGGGGCCTGCTGTGGGGTGGGG - Intronic
991816252 5:70511642-70511664 ACGTGGGGTGCAATGTGGAGGGG - Intergenic
991934217 5:71785938-71785960 CCCAGGCCTGCAGTGCAGAGAGG + Intergenic
992631714 5:78687906-78687928 CCGTGGCCTGTTGTGGGGTGGGG + Intronic
993117727 5:83737271-83737293 CCGGGGCCTGTTGTGTGGTGGGG - Intergenic
993774168 5:91970499-91970521 CCGGGGCCTGCCGTGGGGTGGGG - Intergenic
993781827 5:92075851-92075873 CCGGGGCCTGCCGTGGGGTGGGG - Intergenic
994119455 5:96097487-96097509 CTGTGGCCTTCAGAGTGGGGAGG - Intergenic
996146651 5:119985308-119985330 CCGGGGCCTGCAGGGGGTAGGGG - Intergenic
997116705 5:131133081-131133103 CCGGGGCCTGTTGTGTGGTGGGG - Intergenic
997417520 5:133740463-133740485 ACGTGGCCTGCGGTGAGGAGTGG - Intergenic
997692118 5:135834074-135834096 AAGTGGCCTGCTGTGCGGAGAGG - Intergenic
998926750 5:147135185-147135207 CCGGGGCCTGTAGTGGGGTGGGG - Intergenic
1001740982 5:174052436-174052458 GCCTGGCCTGCAGTGGGCAGTGG + Intronic
1003828136 6:9975056-9975078 CCCTGGCCTCCAGGGAGGAGAGG - Intronic
1005779639 6:29176752-29176774 CCGGGGCCTGTTGTGTGGTGGGG - Intergenic
1011598943 6:89042126-89042148 CCGGGGCCTGCTGTGGGGTGGGG + Intergenic
1012232186 6:96772896-96772918 CCGGGGCCTGTTGTGTGGTGGGG + Intergenic
1012778608 6:103528204-103528226 CCGGGGCCTGCTGTGGGGTGGGG + Intergenic
1013869791 6:114743168-114743190 CCGGGGCCTGTTGTGTGGAGGGG - Intergenic
1013950658 6:115777632-115777654 CCGGGGCCTGTTGTGGGGAGAGG - Intergenic
1015484407 6:133752144-133752166 CCCTGGCCTGCAGTGGGTACAGG + Intergenic
1016610233 6:145980815-145980837 CCGTGGACTGTTGTGTGGTGGGG - Intergenic
1018655183 6:166027390-166027412 CCGAGGGCAACAGTGTGGAGTGG - Intergenic
1018948880 6:168365468-168365490 CCTTGGCCTGCAGAGAGGGGAGG + Intergenic
1019147464 6:169984456-169984478 CTGTGGCCTGCAGGAGGGAGGGG - Intergenic
1019293358 7:261137-261159 CCGAGGCCAGCAGTGGGAAGGGG - Intergenic
1019437127 7:1028102-1028124 CCGGGGTCTGCAGGGCGGAGCGG + Intronic
1019441466 7:1049632-1049654 CCGTGCCCTGCTGTCTGCAGGGG - Intronic
1019564799 7:1673994-1674016 CCGTGGCCTGGAGCAGGGAGCGG - Intergenic
1019652595 7:2168517-2168539 CCCTGGCCTGCTGTGTGGCCTGG + Intronic
1019944452 7:4315441-4315463 CCTTGGCCTGGAGTGGAGAGGGG + Intergenic
1021214844 7:17902983-17903005 CCATGGCCTGCGAGGTGGAGGGG - Intronic
1021435048 7:20604433-20604455 CCGGGGCCTGTTGTGTGGTGGGG - Intergenic
1023856715 7:44188664-44188686 CAGTGGCCTCCACTGGGGAGGGG - Intronic
1024044053 7:45575401-45575423 CCCTGGCGTGAAGTGTGGAGAGG + Intronic
1024209782 7:47193187-47193209 GCGTGGTCTGGAGTGGGGAGTGG - Intergenic
1024444459 7:49460642-49460664 CCGGGGCCTGCTGTGGGGTGGGG + Intergenic
1024688537 7:51774525-51774547 TTGTGGCATGCAGTGTGAAGTGG - Intergenic
1025109314 7:56200147-56200169 CCGGGGCCTGTTGTGGGGAGGGG - Intergenic
1026319971 7:69259815-69259837 CTGTGGGCTACAGTGAGGAGGGG - Intergenic
1029641680 7:101824583-101824605 CCGTGGGCTGCAGTGAGGGAAGG + Intronic
1029980026 7:104870078-104870100 CCGGGGCCTGCTGTGGGGTGGGG + Intronic
1031760832 7:125711243-125711265 CCGGGGCCTGTCGTGTGGTGGGG + Intergenic
1033284959 7:140033505-140033527 AGGTGGCCTGCATGGTGGAGAGG - Intronic
1033563608 7:142557857-142557879 GGGTGGCCTGCAGTTTGGAGGGG + Intergenic
1033962787 7:146934428-146934450 CCGTGGCCTGTTGTGGGGTGGGG + Intronic
1034158711 7:148976603-148976625 CATGGCCCTGCAGTGTGGAGAGG + Intergenic
1034267486 7:149788316-149788338 CCCAGCCCTGCAGTGTGAAGGGG + Intergenic
1034436356 7:151064510-151064532 CGGTGGTCTGCAGGGAGGAGGGG - Exonic
1037786269 8:21905196-21905218 GAGGGGCCTACAGTGTGGAGTGG - Intergenic
1038990186 8:32859441-32859463 CCGTGGGCTGAAGGGTGGGGAGG + Intergenic
1039862260 8:41468975-41468997 CCCTGAGCTGCAGTGTGGAGGGG - Intergenic
1043324330 8:79032251-79032273 CCGAGGACTGCTGTGGGGAGTGG + Intergenic
1043328778 8:79086960-79086982 TCGTGGCCGGAAGTGTGGAGGGG + Intergenic
1044718035 8:95119178-95119200 CCGGGGCCTGTAGTGGGGTGGGG - Intergenic
1045509608 8:102804757-102804779 CAGTGGGCTGCTGGGTGGAGAGG + Intergenic
1046383240 8:113476815-113476837 CCGGGGCCTGTAGTGGGGTGGGG - Intergenic
1046520455 8:115318826-115318848 CCGGGGCCTGTAGTGGGGTGGGG - Intergenic
1046698991 8:117378295-117378317 CCGGGGCCTGCTGTGGGGTGGGG + Intergenic
1048743784 8:137590992-137591014 CCGTGGCCTGTTGTGGGGTGGGG + Intergenic
1049030745 8:140035719-140035741 CAGTGGCCTTCAGTGTGGTTAGG - Intronic
1049221692 8:141431516-141431538 CCGTGGCCGTGTGTGTGGAGTGG + Exonic
1049348718 8:142152764-142152786 CCCTGGAATACAGTGTGGAGGGG - Intergenic
1049925278 9:401340-401362 CATAGGCCTGCAGTGAGGAGGGG + Intronic
1050744825 9:8863162-8863184 CCCTCACCTGCAGTGTGTAGAGG + Intronic
1053434029 9:38063429-38063451 CCATGGCCTGGAGGCTGGAGAGG - Intronic
1053754857 9:41295609-41295631 CCAGGGCCTGCTGTGTGGTGGGG - Intergenic
1054260381 9:62859906-62859928 CCAGGGCCTGCTGTGTGGTGGGG - Intergenic
1054984067 9:71241483-71241505 CCGGGGCCTGCCGTGGGGTGGGG + Intronic
1056035454 9:82600404-82600426 CTATGGCTTGCAGTATGGAGAGG - Intergenic
1056270815 9:84946544-84946566 CTCTGGCCTGCAGTGCAGAGGGG + Intronic
1057138695 9:92713780-92713802 GCGTGTCCTGGAGTCTGGAGGGG + Exonic
1057186301 9:93059126-93059148 CCGGAGCCTGCGGCGTGGAGAGG - Intronic
1057196832 9:93120128-93120150 CCATGGCCTGCAGTGTGGGCTGG - Intergenic
1059313017 9:113401330-113401352 GCGTGGCCTGGACTGTGGAGGGG - Exonic
1060553049 9:124494760-124494782 CCCTGGCCCCCAGTGGGGAGTGG - Intronic
1060992700 9:127857871-127857893 CCGTGGCCTTCAGTGGAGGGAGG - Intergenic
1061627234 9:131848274-131848296 CCCTGGGGTGCAGTGGGGAGGGG + Intergenic
1061896885 9:133652841-133652863 CCGTGGCATGCACAGTGGCGTGG + Intronic
1062218798 9:135403442-135403464 CCGTGGCAGGCAGTGGGGCGTGG - Intergenic
1062405249 9:136393158-136393180 CCCTGGCCTGCTCTGGGGAGTGG - Intronic
1062449663 9:136610169-136610191 CCGAGGGCTGCTGTGTGGAGTGG + Intergenic
1202798767 9_KI270719v1_random:153016-153038 CCAGGGCCTGCTGTGTGGTGGGG + Intergenic
1186397968 X:9229490-9229512 CCGGGGCCTGCTGTGGGGTGGGG - Intergenic
1186523845 X:10229548-10229570 CCGGGGCCTGTAGTGGGGTGGGG - Intronic
1186933263 X:14418282-14418304 CCGGGGCCTGTTGTGGGGAGGGG - Intergenic
1188113982 X:26222227-26222249 CCTTGGCCTGGAGTGGGCAGGGG + Intergenic
1189333909 X:40158453-40158475 GCGTGGCCCGCAGCGGGGAGGGG - Intronic
1193606740 X:83578435-83578457 CCGGGGCCTGTAGTGGGGTGGGG + Intergenic
1194544427 X:95215042-95215064 CCGGGGCCTGTCGTGTGGTGTGG + Intergenic
1195171097 X:102269278-102269300 CCGGGGCCTGTTGTGTGGTGGGG + Intergenic
1195187763 X:102417821-102417843 CCGGGGCCTGTTGTGTGGTGGGG - Intronic
1195579680 X:106487277-106487299 CCGTGGCCTGTTGTGGGGTGGGG - Intergenic
1196280120 X:113814251-113814273 CCGGGGCCTGTTGTGTGGTGGGG + Intergenic
1196482784 X:116169148-116169170 CTGTGGCCTGCAGCATGGACAGG + Intergenic
1199338558 X:146648142-146648164 CCTTGGCCTGCAGGGTGGATAGG - Intergenic
1199721329 X:150544611-150544633 CCAGGGCCTGCATTCTGGAGTGG - Intergenic
1199928095 X:152490713-152490735 CCGGGGCCTGTTGTGGGGAGTGG + Intergenic
1200043130 X:153384298-153384320 AGGTGGCAGGCAGTGTGGAGAGG - Intergenic
1200067616 X:153511596-153511618 CCGTGGCCTGGAGAGGGGAAGGG + Intergenic
1201246339 Y:12007541-12007563 CCGGGGCCTGTAGTGGGGTGGGG - Intergenic
1202574796 Y:26312246-26312268 CCGGGGCCTGCTGTGGGGTGGGG + Intergenic