ID: 1120929538

View in Genome Browser
Species Human (GRCh38)
Location 14:89834931-89834953
Sequence CATTGTGACCAGAATGAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 237}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120929538 Original CRISPR CATTGTGACCAGAATGAAGC GGG Intronic
900729096 1:4240347-4240369 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
903789105 1:25880737-25880759 CAGTGGGAGCACAATGAAGCAGG + Intergenic
904026099 1:27504693-27504715 CATTCTCACCAGAGGGAAGCAGG - Intergenic
906164918 1:43678992-43679014 CACTGTCACCAGAATGCAGATGG + Intronic
906909113 1:49927081-49927103 CAATGTGGCCAGAATGTTGCAGG - Intronic
907408203 1:54266954-54266976 CATTGTGGCAAGAATGAAACTGG - Intronic
908107688 1:60862069-60862091 CATGATGACCTGAATGAGGCTGG + Intergenic
909032569 1:70559748-70559770 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
909212924 1:72847042-72847064 TACTGTGACTTGAATGAAGCTGG + Intergenic
909605936 1:77508384-77508406 CATGGTTACCAGAGTGAAGCTGG - Intronic
911296043 1:96116206-96116228 CATTGTTAGAACAATGAAGCTGG + Intergenic
912109132 1:106318487-106318509 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
912173828 1:107134092-107134114 CATTGTGACCAGAAAGCAGGTGG - Intergenic
913968598 1:143396982-143397004 CATTTTGCCCAGGATGAAGCTGG + Intergenic
914062977 1:144222581-144222603 CATTTTGCCCAGGATGAAGCTGG + Intergenic
914116173 1:144743773-144743795 CATTTTGCCCAGGATGAAGCTGG - Intergenic
915590334 1:156866838-156866860 CACTCTGACCAGAATGAGGGAGG - Intronic
915873103 1:159582985-159583007 GATTGTGAACAGCATGAAGATGG + Intergenic
917085371 1:171299528-171299550 CCATGTGACCAGGATGAAGGGGG - Intergenic
919442151 1:197649175-197649197 CAATGTGACCAGAATAGAGGAGG + Intronic
921405030 1:214769314-214769336 CACTGTGATCAGAATGGTGCAGG + Intergenic
922208676 1:223470462-223470484 CATGGTGACCTGAAAGAATCAGG - Intergenic
922742012 1:228019256-228019278 CACTATGACCAGCATGGAGCCGG - Intronic
924306914 1:242698861-242698883 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
924903560 1:248428050-248428072 CATTTTGGCCTGAATGAATCAGG + Intergenic
924924309 1:248663927-248663949 CATTTTGGCCTGAATGAATCAGG - Intergenic
1062898733 10:1125690-1125712 CATTGTGGCCAGGCAGAAGCTGG + Intronic
1063577330 10:7273761-7273783 CATTGGGACATGGATGAAGCTGG - Intronic
1065226845 10:23552272-23552294 CAGTGTGGCCAGAATAAAGCAGG + Intergenic
1071673613 10:87634893-87634915 CAGTGTGACTAGAACAAAGCAGG - Intergenic
1071959264 10:90793952-90793974 CAGTGTGGCTAGAATAAAGCAGG - Intronic
1076368534 10:129937050-129937072 CCTTGGGGCCCGAATGAAGCTGG - Intronic
1076477597 10:130763408-130763430 CATTGAGAACAGGATGAGGCAGG - Intergenic
1077561709 11:3266906-3266928 CTTTGTTACCAGGATGATGCTGG + Intergenic
1077567603 11:3312726-3312748 CTTTGTTACCAGGATGATGCTGG + Intergenic
1079598996 11:22288282-22288304 CTTTGGTACCAGAATGATGCTGG - Intergenic
1081810322 11:45910649-45910671 TACTGTGACCAGAAAAAAGCTGG + Intronic
1083119992 11:60502313-60502335 GAGTGTGACCAGACTGAACCAGG - Intronic
1085231501 11:74975153-74975175 TAATGTGAACAGAATGAAGTGGG - Intronic
1089260020 11:117217922-117217944 CATGGTGGCCAGCATGAACCAGG - Intronic
1094206768 12:27848661-27848683 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
1095590310 12:43895960-43895982 CAGTGTGGCTAGAATAAAGCAGG - Intronic
1098041899 12:66361280-66361302 CACTGTTGCCAGAATGAAGCAGG - Intronic
1099583449 12:84483844-84483866 CAGTGTGACTAGAATAAAGCAGG + Intergenic
1101078156 12:101152632-101152654 CTTTGTTATCAGAATGATGCTGG - Intergenic
1104772910 12:131375446-131375468 CACTGTGCCCAGAAGGAAGATGG - Intergenic
1107103730 13:36622006-36622028 AGTTGTGACTTGAATGAAGCTGG - Intergenic
1107214282 13:37897645-37897667 AATTGTGTACAGAATTAAGCAGG - Intergenic
1107971644 13:45648555-45648577 CTTTGGTATCAGAATGAAGCTGG - Intergenic
1108726811 13:53191901-53191923 CTTTGTGACCACAACTAAGCTGG + Intergenic
1109177465 13:59173990-59174012 CTTTGTTACCAGAAAGAAGCAGG - Intergenic
1110225304 13:73113412-73113434 CCATGTGACCAGCATTAAGCTGG - Intergenic
1111236093 13:85410254-85410276 GACTGTGACCATAATGAAGTAGG + Intergenic
1112524702 13:100133809-100133831 CAGCGTGGCTAGAATGAAGCAGG + Intronic
1115434489 14:33357684-33357706 AATTGGGACCAGAATGCAGAAGG - Intronic
1115467606 14:33732820-33732842 CATCGTGCCCTGAATGAGGCAGG - Intronic
1115988226 14:39125015-39125037 TATTGTTAGCAGAATGAATCAGG + Exonic
1116084817 14:40221535-40221557 CATTGTGTCCAGAATTAATCTGG + Intergenic
1116213647 14:41981315-41981337 CATTGTGAAAATAATGTAGCTGG - Intergenic
1116226411 14:42159135-42159157 CATTGTAAAAAGAATGAAGGGGG + Intergenic
1117007119 14:51432248-51432270 TAGTCAGACCAGAATGAAGCTGG - Intergenic
1117934778 14:60890770-60890792 CAGTGTGGCTAGAATAAAGCAGG - Intronic
1118266211 14:64296957-64296979 AATTGTGACCACAATGATGAAGG + Intronic
1118358301 14:65034207-65034229 CAATCTGTCCAGACTGAAGCAGG - Intronic
1118675792 14:68183397-68183419 CAGTGTGGCTAGAAAGAAGCAGG - Intronic
1119641212 14:76316316-76316338 CATTGTTTCCTGATTGAAGCAGG + Intronic
1120100952 14:80445207-80445229 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
1120278239 14:82405786-82405808 CATTGTAAACAGAAAGACGCAGG - Intergenic
1120929538 14:89834931-89834953 CATTGTGACCAGAATGAAGCGGG + Intronic
1125028059 15:35050584-35050606 CATTGAGAAGAGAATGAAACAGG - Intergenic
1125795898 15:42403690-42403712 CAGTGTCACCAGAAGCAAGCAGG - Intronic
1128380599 15:67109310-67109332 CATTTTGCCCTGATTGAAGCTGG + Intronic
1129527742 15:76232306-76232328 CCTGGTAAACAGAATGAAGCAGG - Intronic
1130634378 15:85603329-85603351 CATTGGTGCCAGAATGAATCAGG - Intronic
1131724317 15:95205321-95205343 CAGTATGGCCAGAATAAAGCAGG + Intergenic
1136615064 16:31393546-31393568 GAGTGTGACCTGAATGAAGAGGG + Intronic
1137316182 16:47325979-47326001 CATTGTTATCAGGATGATGCTGG - Intronic
1137462788 16:48680529-48680551 CATTGGGAGCAGAAGGAAGGTGG - Intergenic
1137582751 16:49643935-49643957 CTTGGTGACCAGCATGGAGCAGG + Intronic
1138078359 16:54065014-54065036 CATTGTGACCAGAGTCAGGCGGG - Intronic
1139030469 16:62875028-62875050 CATAGTGACAATCATGAAGCAGG - Intergenic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140108130 16:71979749-71979771 GATTGTGATCAGAATGAAAATGG - Intronic
1140380130 16:74479378-74479400 TATAGTGACCAGAAAGATGCCGG + Intronic
1140406466 16:74714448-74714470 TATTGTCCCCAGCATGAAGCTGG + Intronic
1143768736 17:9154296-9154318 CATGGTGCCCAGAATGCACCAGG + Intronic
1143983418 17:10890607-10890629 CATCGTGACCAGAGTGCCGCTGG + Intergenic
1153101161 18:1471244-1471266 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
1153118468 18:1690376-1690398 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
1154308951 18:13253030-13253052 CAGGGTGCCCAGAGTGAAGCAGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156169861 18:34469613-34469635 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
1157251158 18:46097545-46097567 CACTGTGACAACAGTGAAGCTGG - Intronic
1157327599 18:46680249-46680271 CGCAGTGACCAGAATGAGGCCGG + Exonic
1159679579 18:71331192-71331214 CCTTGATACCAGAATGATGCTGG - Intergenic
1160005491 18:75065841-75065863 TATTGTCACCAGAATGCATCTGG - Intergenic
1160166240 18:76515067-76515089 CATTGGGATTAGGATGAAGCAGG - Intergenic
1161064103 19:2229123-2229145 CTTTGAGACCAGAAGGAAGTTGG + Intronic
1161287025 19:3473874-3473896 CATTGTGGCCAGGCTGAGGCTGG + Intergenic
1164310256 19:24039749-24039771 TAATGTGATCAGAATGAAGAAGG + Intronic
1165246883 19:34503040-34503062 CATGGTGACCGGGATGGAGCAGG - Exonic
1168652219 19:58098399-58098421 CATGGTGCCCAAAATGACGCAGG - Intronic
1202702387 1_KI270712v1_random:174452-174474 CATTTTGCCCAGGATGAAGCTGG + Intergenic
924968509 2:100953-100975 CATTCTGACCAGGATGGAGTTGG - Intergenic
925847562 2:8047516-8047538 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
926647218 2:15302822-15302844 CAGTGTGCCTAGAATAAAGCAGG + Intronic
926672815 2:15591689-15591711 CATGGTGCCCAGAACGAAGGCGG + Exonic
927355660 2:22170184-22170206 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
928621252 2:33090529-33090551 CATTGTGATGAGAATGAAATGGG - Intronic
930480857 2:51946737-51946759 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
930911845 2:56638316-56638338 CATTGAGACCAGGAGGAAGAAGG + Intergenic
932904992 2:75739448-75739470 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
932969680 2:76525429-76525451 CTCTGTGTCAAGAATGAAGCAGG + Intergenic
933008767 2:77029541-77029563 CAGTGTGGCTAGAATAAAGCAGG - Intronic
933116992 2:78486440-78486462 GAAAGTGATCAGAATGAAGCAGG + Intergenic
934173299 2:89557906-89557928 CATTTTGCCCAGGATGAAGCTGG + Intergenic
934283614 2:91632259-91632281 CATTTTGCCCAGGATGAAGCTGG + Intergenic
936098691 2:109555328-109555350 CATTGTTCCCAGAACGAACCTGG + Intronic
937366850 2:121268848-121268870 AGCTGTGACAAGAATGAAGCAGG - Intronic
938663011 2:133506519-133506541 CAGTGTGAGGAGAATGAAGTGGG + Intronic
938769425 2:134488343-134488365 CAGTGTGGCTAGAATAAAGCAGG + Intronic
938997198 2:136692700-136692722 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
940672052 2:156682570-156682592 AATTGAGACCAGAGTGATGCAGG + Intergenic
941465422 2:165820512-165820534 CATTATGCCCAGAATAAAACTGG + Intergenic
941858916 2:170258226-170258248 CATTGGTATCAGAATGATGCTGG - Intronic
942410291 2:175702523-175702545 CATTGGTATCAGAATGATGCTGG + Intergenic
942773765 2:179555652-179555674 CATTTTGAGCAAAATCAAGCTGG - Intronic
943347336 2:186754933-186754955 CATTTTGAACAGAAGGAAGATGG + Intronic
943403470 2:187448466-187448488 CATTGTTACCAGTAAAAAGCTGG + Intergenic
943603357 2:189947504-189947526 CTTTGTCACCAGAAAGATGCAGG + Intronic
946145752 2:217729680-217729702 CATTGTGACTTGAAGGCAGCAGG - Intronic
946533804 2:220605399-220605421 CAGTGTGCCCAAAATAAAGCAGG - Intergenic
946765399 2:223035885-223035907 CATTTTGACCAAAATGAATGAGG + Intergenic
947440278 2:230114548-230114570 CTTTGTTACCAGGATGATGCTGG + Intergenic
947921049 2:233874569-233874591 CAGCGTGGCCAGAATAAAGCAGG + Intergenic
1172492511 20:35351412-35351434 CTTTGTGACAATAATGAAACAGG + Intronic
1173460712 20:43241080-43241102 CAATGGGACCAGGCTGAAGCTGG + Intergenic
1174117534 20:48237605-48237627 CACAGTGAGAAGAATGAAGCTGG + Intergenic
1176892808 21:14338909-14338931 CAGAGAGACTAGAATGAAGCAGG + Intergenic
1177378232 21:20302107-20302129 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
1177489592 21:21805179-21805201 CTGTGTGACTAGAATAAAGCAGG + Intergenic
1177998865 21:28135403-28135425 CAGTGTGGCTAGAATGAAGCAGG + Intergenic
1178183104 21:30187003-30187025 CATTGTTTGCAGAATGAAGGCGG + Intergenic
1181006113 22:20014489-20014511 AATTAAGACCAGAATGAGGCCGG - Intronic
1181936095 22:26440003-26440025 CACTGTGACCACAATGACCCTGG - Intronic
1184963763 22:47951467-47951489 CACTGTGGCCAGGATAAAGCAGG - Intergenic
1184963839 22:47951944-47951966 CAGTGTGGCCAGGATAAAGCAGG + Intergenic
950714333 3:14837033-14837055 CACAGTGACCAGACTGCAGCAGG + Intronic
950988273 3:17400722-17400744 CAGTGTGGCTAGAATAAAGCAGG + Intronic
952500764 3:33959720-33959742 CCTTGTGACCAGAATGAGTTTGG + Intergenic
952684633 3:36133853-36133875 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
953115218 3:39986259-39986281 AAGTGTAACCAGAATGAGGCTGG - Intronic
954621000 3:51995526-51995548 CATTCTGACCAGAATGGGGGGGG - Intronic
955814903 3:62831976-62831998 CATCTTGACCAGAGGGAAGCTGG - Intronic
956933024 3:74067605-74067627 CATTTTGCCCAGATTGAAGCTGG + Intergenic
958821764 3:98982662-98982684 CTTTGTGACCAGTATGTAGAAGG + Intergenic
959770380 3:110088235-110088257 AATTGTAACCAGAAGAAAGCAGG - Intergenic
959868777 3:111302777-111302799 CAATGTGGCTAGAATAAAGCAGG - Intronic
961263180 3:125618920-125618942 CAGTGTGGCTAGAATGAAGCAGG + Intergenic
961511058 3:127403997-127404019 TATAGTGACCAAAATGAAGGAGG + Intergenic
962721461 3:138179068-138179090 CATTGTGTCCAGAGTGATGTTGG + Intergenic
963439889 3:145325754-145325776 AATAGTGACTAGAATGAAGAAGG + Intergenic
963817257 3:149845398-149845420 CATAGTGAACAGGATGAAGTTGG + Intronic
965100806 3:164295042-164295064 CTTTGTTATCAGAATGATGCTGG - Intergenic
965707379 3:171522631-171522653 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
967713490 3:192736712-192736734 CATTGTGCCCAGCATATAGCAGG + Intronic
967745215 3:193047479-193047501 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
968800626 4:2741257-2741279 CAGCGTGGCCAGAATAAAGCAGG + Intergenic
969827152 4:9766716-9766738 CAGTTTGCCCAGGATGAAGCCGG + Intergenic
969971921 4:11056667-11056689 AAATGTGACAAGAATGAAGAAGG + Intergenic
970213091 4:13731244-13731266 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
971126759 4:23762883-23762905 CAGTGTGGCTAGAATAAAGCAGG + Intronic
971525947 4:27618845-27618867 CATTGTGCCCATCATGAATCTGG - Intergenic
971888101 4:32479656-32479678 CATTGAGGCCAGTAAGAAGCAGG - Intergenic
973011788 4:45084577-45084599 CATTGTAACCACAATCAACCAGG + Intergenic
973704496 4:53568151-53568173 CTTTGGTATCAGAATGAAGCTGG - Intronic
975000265 4:69216880-69216902 CATTGTGTCAACAATGAGGCAGG + Intergenic
975005499 4:69278326-69278348 CATTGTGTCAACAATGAGGCAGG - Intergenic
975274307 4:72478197-72478219 CTTTGGTATCAGAATGAAGCTGG - Intronic
975681256 4:76878821-76878843 CATTGTGCCTAGAATAAAGCAGG + Intergenic
975934491 4:79562005-79562027 CATTGTGGCTAGAATAAAGCAGG + Intergenic
976337291 4:83905062-83905084 CAGTGGGATCAAAATGAAGCAGG - Intergenic
976993754 4:91403882-91403904 CATTGATACCAGGATGATGCTGG + Intronic
977001669 4:91512271-91512293 CAGTGTGATTAGAATAAAGCAGG + Intronic
981619137 4:146673885-146673907 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
983376056 4:166929400-166929422 CATTGTGAGCACAATCAAGAAGG - Intronic
983685839 4:170407775-170407797 TTTTGTGACCAGAATTATGCTGG + Intergenic
983785117 4:171720558-171720580 CAATGTGGCTAGAATAAAGCAGG + Intergenic
985485831 5:147949-147971 CAGTGTAAACAGAATGAAGGGGG + Intronic
986101817 5:4618944-4618966 CTTTGGTACCAGAATGATGCTGG - Intergenic
986556647 5:9016616-9016638 CATTTTGACCTGAATAAATCTGG - Intergenic
987849508 5:23332400-23332422 CATATTGACCAGAATTAAGATGG + Intergenic
992515173 5:77484328-77484350 CATCGTGCCCTGAATCAAGCGGG - Intronic
994786646 5:104173318-104173340 CACTGTGGCTAGAATAAAGCAGG + Intergenic
995119391 5:108519813-108519835 CAGTGTGTCTAGAATAAAGCAGG - Intergenic
995152925 5:108871866-108871888 AATTGTGACAGGAATAAAGCAGG + Intronic
995897763 5:117034461-117034483 CATTCTGAAAACAATGAAGCTGG + Intergenic
996313095 5:122129056-122129078 CAGTGTGGCCAGAATAAAGCAGG - Intergenic
999065413 5:148680280-148680302 CACTGTGGCTAGAATAAAGCAGG + Intergenic
999584991 5:153080331-153080353 TATAGGGACCTGAATGAAGCTGG - Intergenic
999968604 5:156836112-156836134 CCTAGTGGCCATAATGAAGCAGG - Intergenic
1002010776 5:176278936-176278958 CTTTGTTATCAGAATGATGCTGG + Intronic
1006519638 6:34563800-34563822 CAGTGGGGCCAGAATGAAGCAGG + Intergenic
1008074062 6:47127395-47127417 GTTTGTGACCAGTGTGAAGCAGG - Intergenic
1009655930 6:66544558-66544580 CATTGTTATCAGGATGATGCTGG - Intergenic
1011179359 6:84602464-84602486 CTTTGTTATCAGAATGATGCTGG - Intergenic
1011395436 6:86901229-86901251 CTTTGTTATCAGAATGATGCTGG - Intergenic
1012168116 6:95983894-95983916 CATTGGTATCAGAATGATGCTGG - Intergenic
1012497204 6:99846733-99846755 ACTTGGGACAAGAATGAAGCAGG + Intergenic
1012945992 6:105466323-105466345 CTTTGGGACCAGATAGAAGCTGG - Intergenic
1015249290 6:131109989-131110011 CATATTGACCTGAATGAAACAGG - Intergenic
1016151169 6:140744938-140744960 CAGTGTGGCTAGAATAAAGCTGG - Intergenic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017483351 6:154880044-154880066 CATGCTGACCAGGAGGAAGCCGG - Intronic
1017970725 6:159310432-159310454 CAGTGTAGCCAGAATAAAGCAGG + Intergenic
1019696911 7:2451314-2451336 CATTGTGGCCAGAATCAAAGAGG - Intergenic
1019789848 7:3004114-3004136 CATGGTAACCAGCAGGAAGCTGG - Intronic
1020854514 7:13400874-13400896 CATTCAAATCAGAATGAAGCAGG + Intergenic
1022040654 7:26578467-26578489 TATAGTGACCAGAATGAATCTGG + Intergenic
1023185271 7:37526571-37526593 CAGTGTGACCAAAAGGAATCTGG - Intergenic
1023942541 7:44779142-44779164 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
1026508644 7:71008900-71008922 TATTGTGACAAGATTAAAGCTGG + Intergenic
1026530363 7:71192190-71192212 CAGTGTGGCTAGAATGAAACAGG - Intronic
1027219272 7:76203630-76203652 CATTGTGCCCAGCATGGAGCTGG - Intronic
1027807859 7:82852392-82852414 CAGTGTGGCTAGAATAAAGCAGG + Intronic
1028526587 7:91793224-91793246 CATTGTTACCAGGATGATGCTGG - Intronic
1028825305 7:95265636-95265658 CATTTACACCAGAAGGAAGCTGG - Intronic
1029178572 7:98683184-98683206 CTTTCTGTCCAGAATAAAGCTGG - Intergenic
1031185487 7:118474630-118474652 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
1032988458 7:137364179-137364201 CATTGTCACCATGATGATGCAGG + Intergenic
1033985365 7:147219538-147219560 CAGTGTGGCTAGAATAAAGCAGG - Intronic
1034083051 7:148298471-148298493 CAGTGTGGCTAGAATAAAGCAGG - Intronic
1034728397 7:153361919-153361941 CAGTGTGACTAGAATAAGGCAGG - Intergenic
1039917098 8:41868145-41868167 CATTGTACCCAGCCTGAAGCAGG + Intronic
1042655442 8:71090646-71090668 CATTGAGAACAGACTGGAGCAGG - Intergenic
1043338283 8:79204330-79204352 CAGTGGGATCAAAATGAAGCAGG + Intergenic
1046421765 8:113994350-113994372 CATTGTGGCTAGAACAAAGCAGG + Intergenic
1047160232 8:122369925-122369947 CAGTGTGACTAGAACAAAGCAGG - Intergenic
1047235312 8:123036459-123036481 GACAGTGACCAGAAGGAAGCAGG + Intronic
1048252322 8:132877001-132877023 CATTGTAACCAGAATGTGGAAGG + Intronic
1050497564 9:6260502-6260524 CTTTGTTATCAGGATGAAGCTGG + Intergenic
1050942826 9:11482237-11482259 TTTTGTTACCAGAATGATGCTGG + Intergenic
1052780070 9:32772935-32772957 CTTTGTTATCAGAATGATGCTGG + Intergenic
1053107890 9:35428314-35428336 AATTGTGACCAAGATGAAACTGG - Intergenic
1053827405 9:42039742-42039764 CATTGGTATCAGAATGATGCTGG - Intronic
1054603156 9:67147698-67147720 CATTGGTATCAGAATGATGCTGG + Intergenic
1055800103 9:80025308-80025330 CAGTGTGGCCAGAATAAAGCAGG - Intergenic
1055835140 9:80431003-80431025 CCCTGTGACCATATTGAAGCAGG + Intergenic
1056106549 9:83352771-83352793 GATTATGTCCAGAATGAAGCTGG - Intronic
1060015133 9:120080472-120080494 CACTGTCACCAGAATCAAGAAGG + Intergenic
1060520852 9:124293109-124293131 CTTGGTGACCACAATGCAGCTGG - Intronic
1187927617 X:24264327-24264349 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
1188012589 X:25073592-25073614 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
1189739022 X:44099896-44099918 CATTATGACCAGAATGTGGCAGG + Intergenic
1190462085 X:50686893-50686915 TCTTGTGAACAGAAGGAAGCAGG + Intronic
1191095427 X:56668685-56668707 CAGTGTGGCCAGGATAAAGCAGG - Intergenic
1192435247 X:71139358-71139380 CATGGGGACCAGAATGAGGATGG + Intronic
1193160361 X:78221778-78221800 CTTTGTTACCAGAATGATGCTGG + Intergenic
1193566760 X:83086182-83086204 CATTGGTATCAGAATGATGCTGG - Intergenic
1194039424 X:88921444-88921466 CATTCTGAGCAGGATGGAGCAGG + Intergenic
1194233167 X:91348872-91348894 CAGTGTGACTAGAATAATGCAGG + Intergenic
1197381665 X:125750430-125750452 CATAGTGACCAAAAAGGAGCTGG + Intergenic
1197498618 X:127217394-127217416 CTTTGTTATCAGAATGATGCTGG - Intergenic
1197975109 X:132158633-132158655 CTTTGTTATCAGAATGAGGCTGG + Intergenic
1198132770 X:133715116-133715138 CAGTGTGACTAGAATAAAGCAGG + Intronic
1198596454 X:138241173-138241195 AATGGAAACCAGAATGAAGCAGG - Intergenic
1198743916 X:139869963-139869985 CATTGTGACATGAATGAACCTGG + Intronic
1199544159 X:148989768-148989790 CATTGTGGGCAGTATGAGGCAGG - Intronic
1200741225 Y:6855937-6855959 CTTTGGTATCAGAATGAAGCTGG - Intergenic
1201615155 Y:15888955-15888977 CTTTGTCATCAGAATGACGCTGG - Intergenic