ID: 1120929682

View in Genome Browser
Species Human (GRCh38)
Location 14:89836140-89836162
Sequence GAGAAAACACAGATGGTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 1, 2: 2, 3: 43, 4: 354}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120929679_1120929682 -3 Left 1120929679 14:89836120-89836142 CCACAAGAGGTTTACAGTCTGAG 0: 1
1: 0
2: 3
3: 38
4: 263
Right 1120929682 14:89836140-89836162 GAGAAAACACAGATGGTCAAGGG 0: 1
1: 1
2: 2
3: 43
4: 354
1120929675_1120929682 25 Left 1120929675 14:89836092-89836114 CCAGGCTAGACAGGGAAAGAAGG 0: 1
1: 1
2: 1
3: 20
4: 221
Right 1120929682 14:89836140-89836162 GAGAAAACACAGATGGTCAAGGG 0: 1
1: 1
2: 2
3: 43
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120929682 Original CRISPR GAGAAAACACAGATGGTCAA GGG Intronic
900700793 1:4047531-4047553 GAGAACACAGAGATGGGGAAGGG + Intergenic
900785600 1:4647898-4647920 AAGAAAAGATAAATGGTCAAGGG - Intergenic
900870547 1:5299169-5299191 GAGAAACCACAGACGGGCTAGGG + Intergenic
901653230 1:10755051-10755073 GAGAAAACTCAGGTGGTGAGTGG + Intronic
901879079 1:12183337-12183359 GAGATAACAGAGATGGAAAAAGG - Intronic
902131657 1:14266799-14266821 GAGAAAACCCAGGTGGACATTGG + Intergenic
902504081 1:16928252-16928274 GAGAGCACACAGTGGGTCAAGGG - Intronic
903712519 1:25337094-25337116 GAAAGAACACAGAGGGTGAAGGG - Intronic
903850427 1:26302521-26302543 CTGCAAACACAGATGGTCTACGG - Intronic
904341858 1:29840480-29840502 GAGGATACAGAGATGATCAAAGG - Intergenic
905203658 1:36330488-36330510 GGGAAGACAGAGACGGTCAAGGG - Intergenic
905969495 1:42130770-42130792 TAGAAAACACAGATTGACACTGG - Intergenic
906339311 1:44964346-44964368 GAGTAAATACAGTTGGTCAAGGG - Intronic
907266432 1:53264402-53264424 GAGAAAACAGAGATGACCATGGG + Intronic
910232971 1:85005783-85005805 GAAAAAACACAGACGATCTAAGG + Intronic
910769499 1:90816720-90816742 GATAAAACACATATGGCAAAAGG + Intergenic
911096997 1:94062756-94062778 GAGAAGACACAGAGGGACAAAGG + Intronic
911520838 1:98927854-98927876 GAGAAAACACAAATTATAAAGGG - Intronic
911568567 1:99494717-99494739 GAGAAATCCCAGAAGGTAAAGGG + Intergenic
913349393 1:117841505-117841527 GAGAAAACTGAGATGTACAAAGG - Intergenic
914838553 1:151228682-151228704 GACAAACCACAGATGCTAAATGG - Intronic
915945748 1:160150451-160150473 GAGACACCAGAGAAGGTCAATGG + Intergenic
916026563 1:160838306-160838328 GAGAAAAGATAGATGGGGAAGGG + Intronic
916356904 1:163920614-163920636 GAGTAAACACATAATGTCAATGG + Intergenic
916805401 1:168255149-168255171 GAGAAAACCTAGATGATCTAGGG - Intergenic
916860232 1:168795676-168795698 GAGAAAACTCAGGTGGTTGATGG - Intergenic
920215095 1:204357369-204357391 CTGAACAGACAGATGGTCAAGGG + Intronic
920293464 1:204940617-204940639 GACAAAACACAGATTGTCTTTGG - Intronic
920715703 1:208338175-208338197 GAGAAAGCACAGTGGGTCAAAGG - Intergenic
921629865 1:217420291-217420313 GAGAAAAGACAGATGATTAAAGG - Intergenic
922162390 1:223088268-223088290 AAGAAAACAGACATGGGCAAGGG - Intergenic
923998013 1:239518498-239518520 GAGAAAACAAATATGACCAAAGG + Intronic
1062944380 10:1449438-1449460 GAGAAAACACACAGGACCAATGG - Intronic
1064917307 10:20474272-20474294 AAGAAACCACAGATGTGCAAAGG + Intergenic
1064949454 10:20831815-20831837 GAAAAAACACAGCTAGCCAAGGG + Intronic
1066046479 10:31599868-31599890 CAGAGAACACACATGGTAAAGGG + Intergenic
1066466535 10:35655440-35655462 GAGAAAAAAAAAATGGACAAAGG - Intergenic
1066548937 10:36533626-36533648 GAGAAACCAGAGAATGTCAAGGG + Intergenic
1066596188 10:37052567-37052589 GAGAAAAAACAGAGGGAGAAAGG + Intergenic
1066649878 10:37643955-37643977 GATAAAACAGAAAGGGTCAAGGG - Intergenic
1067032767 10:42889503-42889525 GATAAAACAGAAAGGGTCAAGGG - Intergenic
1070900209 10:80022118-80022140 CAGAAAACACTGAGGGTCAATGG + Intergenic
1070901963 10:80037988-80038010 CAGAAAACACTGAGGGTCAATGG + Intergenic
1072524196 10:96257203-96257225 GAGCAGAGACAGATAGTCAAGGG + Intronic
1072899999 10:99398889-99398911 GAGATTGCACAGCTGGTCAATGG + Intronic
1073170617 10:101504712-101504734 GAGAAAAGAAAGAGAGTCAAAGG - Intronic
1073681495 10:105709064-105709086 GACAGAACACAGCTGGTCAATGG - Intergenic
1074127519 10:110541045-110541067 GTGTTAACACAGATGGCCAAAGG - Intergenic
1074191112 10:111138537-111138559 AAGAACACACAGCTGGTAAATGG + Intergenic
1074709740 10:116167334-116167356 GAGAAAATACGGAGGGGCAAAGG - Intronic
1074931807 10:118134143-118134165 GAGAAAACAAAGATAGCCACTGG + Intergenic
1076944394 10:133635700-133635722 AAAAAGACACTGATGGTCAATGG + Intergenic
1077776688 11:5279987-5280009 GAGAAAAAACAGGAGGTCAAGGG - Intronic
1080342831 11:31287260-31287282 GAGAAAACACAGACTGTACAAGG + Intronic
1081780379 11:45706559-45706581 GAGAAAACAGAGATAGTAAAAGG + Intergenic
1082766837 11:57175571-57175593 GAGAAAAGAAAGACAGTCAATGG - Intergenic
1083034871 11:59627778-59627800 GAGAAGAGACAGATGTGCAAAGG - Intergenic
1083727248 11:64635001-64635023 CAGAAAACACAGGTGGTCTCAGG + Intronic
1087091333 11:94276473-94276495 GAGGTCACACAGATAGTCAATGG + Intergenic
1087158800 11:94929359-94929381 GATAAAACAAAGATAATCAAGGG - Intergenic
1087256555 11:95961948-95961970 GAAAAAACACAGCTGTTAAAGGG - Intergenic
1087834295 11:102856107-102856129 GAAATAACCCAGATGGTCATTGG + Intergenic
1088340785 11:108763925-108763947 CAGAAAATACAGATTGACAAAGG + Intronic
1089350767 11:117820435-117820457 GAGAAAAGTGAGATGGACAAGGG - Intronic
1091064672 11:132498308-132498330 AAGAAAAAACAGATGACCAATGG - Intronic
1091523405 12:1271383-1271405 GAGAAAACAAAGATGGCCATTGG + Intronic
1092124782 12:6067323-6067345 GAGAAAACACAGAAAGGCAGGGG - Intronic
1092165126 12:6337603-6337625 GAGGAAACAGACATCGTCAATGG - Intronic
1092388581 12:8054950-8054972 CAGAAGACACAGATGAACAAGGG - Exonic
1093001780 12:14005191-14005213 GAAAAAGCACAGATGATCTAAGG - Intergenic
1094719711 12:33052044-33052066 GAGGATACACAGATGATAAATGG + Intergenic
1095218052 12:39573290-39573312 GAGAAAACACAGGTGGTGGTGGG - Intronic
1097037025 12:56130764-56130786 GAGGAAAGAGAGATGGTCAGAGG - Intronic
1097565909 12:61268005-61268027 GAGAAAACACATCTGATCAATGG + Intergenic
1098198489 12:68028305-68028327 GCCAAAACACACAAGGTCAAGGG + Intergenic
1098258086 12:68638042-68638064 GATAAAACACAGTTGAACAATGG - Intronic
1098423882 12:70336767-70336789 GAGAAACTAGAGATGGTCCAAGG - Intronic
1098627935 12:72696466-72696488 GTGAAAAGACAGATGGGCAGAGG - Intergenic
1098700225 12:73614503-73614525 GAGAAAAAACAGCTATTCAAAGG + Intergenic
1099714312 12:86271383-86271405 AAGAAAACACAAATGGCCACAGG + Intronic
1100066972 12:90660533-90660555 GAGATCACACAGATAGTAAAAGG + Intergenic
1100346317 12:93734934-93734956 GAGAAAGCACATATGGTACAGGG - Intronic
1100993832 12:100281004-100281026 AAAAAAACACTGATGGTAAAGGG - Intronic
1102557137 12:113734462-113734484 GAGAATACACAGCTGGTCCTTGG + Intergenic
1106135843 13:26972918-26972940 GAGAAAGCACAGCTGGAAAATGG + Intergenic
1106822589 13:33482405-33482427 GACAAAATACTGATGGGCAACGG - Intergenic
1108463904 13:50695273-50695295 GAAAATACACAAATGGACAATGG + Intronic
1108517266 13:51215120-51215142 GAGATAACAAATATGGACAATGG + Intergenic
1108775498 13:53761052-53761074 GGGAAGACACAGATGTTGAAGGG + Intergenic
1108880967 13:55115347-55115369 TAGAGTACACACATGGTCAAAGG - Intergenic
1109784782 13:67159260-67159282 GAGAAAACAAAGATGGTCATAGG + Intronic
1109885914 13:68544174-68544196 AAGAAAAATCAGATGTTCAAAGG + Intergenic
1110038586 13:70719631-70719653 GATAAAACAAAAATGGTGAAAGG - Intergenic
1111063654 13:83060038-83060060 GAGAAAACTCAGGAGGGCAAGGG + Intergenic
1111271659 13:85894702-85894724 GAGAGAACACAAATACTCAAAGG - Intergenic
1111347865 13:86985688-86985710 GAAAACATACAGTTGGTCAAAGG + Intergenic
1112569898 13:100584499-100584521 GGGAAAGCAGAGATGGTTAATGG + Intronic
1112883797 13:104143813-104143835 CAGAAAACACAGGTGATTAACGG + Intergenic
1113353266 13:109550618-109550640 GAAAGAAAACAGATTGTCAAAGG - Intergenic
1113887574 13:113668935-113668957 GAGAACACGCAGATGTTCCAGGG - Intronic
1114671058 14:24411317-24411339 CAGAAGACAGAAATGGTCAAGGG - Intronic
1116181823 14:41544126-41544148 GAAAAAACACTGAAAGTCAATGG - Intergenic
1117200825 14:53388365-53388387 GAGAAAGCACAGCTGGAGAACGG - Intergenic
1117562752 14:56959331-56959353 GTGAAGACACAGATGGTGATGGG + Intergenic
1118711785 14:68525517-68525539 GAGAATTCCCAGATGGTCAGTGG - Intronic
1118754532 14:68830203-68830225 AAGAAAAGACAGATATTCAAGGG - Intergenic
1119326785 14:73764582-73764604 GAGAAGACACAGCTGGTGGAGGG - Intronic
1119497236 14:75090344-75090366 GAGAAAATACAAATGGGCAAAGG + Intronic
1120929682 14:89836140-89836162 GAGAAAACACAGATGGTCAAGGG + Intronic
1202926834 14_KI270724v1_random:33546-33568 AAAAAGACACTGATGGTCAATGG - Intergenic
1123766539 15:23484576-23484598 AAGAAAACACAGATAGTCTATGG - Intergenic
1123811051 15:23926643-23926665 GAGACACCACAGCTGGCCAAAGG - Intergenic
1125317199 15:38443660-38443682 GAGCAACCACACCTGGTCAATGG - Intergenic
1126892192 15:53218433-53218455 GAGAAACCAGGGATGGTAAAGGG + Intergenic
1127294491 15:57597575-57597597 GAGAAAACACAGGTGGATGAAGG - Intronic
1128297853 15:66540181-66540203 GTGAAAATTCAGATGGTCTATGG - Exonic
1128774937 15:70313136-70313158 GAGAAAAGAGAGGAGGTCAACGG + Intergenic
1129113673 15:73352930-73352952 GGGAACACACAGTTGGGCAAGGG + Intronic
1129146746 15:73655025-73655047 GAGAAAAAACAGATTAACAAGGG - Intergenic
1129237238 15:74231039-74231061 GACAAAACACAGATACACAAGGG + Intergenic
1131731680 15:95288003-95288025 GGGAAATCTAAGATGGTCAAAGG + Intergenic
1132393922 15:101458581-101458603 GAGAAGATACACATGGTGAAAGG - Intronic
1133167407 16:3957958-3957980 GAGAAAATAAAGAAGGTCAGAGG + Intronic
1134873050 16:17668967-17668989 GCCAAAAAACAGATGGCCAAAGG + Intergenic
1137851953 16:51754871-51754893 GAGAAAACCTAGAAGCTCAAGGG - Intergenic
1138423863 16:56917399-56917421 GAGCAAACACATAAGGTCAAGGG + Intergenic
1138719565 16:59063532-59063554 AAGAAAACACAGCAGGTAAATGG - Intergenic
1139174905 16:64675049-64675071 GAAAAAAGACAGATGCTCAAGGG + Intergenic
1140265384 16:73416170-73416192 GAGAGAAAACAGAAGCTCAAAGG + Intergenic
1140623249 16:76762301-76762323 CAGAAAACTCAGAAGGTAAAGGG - Intergenic
1141379210 16:83560635-83560657 GAGAAAACAAAAATGGTCATTGG + Intronic
1141751771 16:85962942-85962964 GAGAAAGGACAGATGGTTAGAGG - Intergenic
1143331361 17:6138155-6138177 GAGATAACACAGATACTCAGTGG + Intergenic
1143426391 17:6842497-6842519 GATAAAACACAGATTAACAAAGG + Intergenic
1143855950 17:9849568-9849590 GAAATAACCCAGATGGTCATAGG - Intronic
1146041684 17:29460572-29460594 GAGAAAAGAAAGATAATCAAGGG + Intronic
1147017053 17:37500334-37500356 GAGACATCAAAGATGATCAAAGG + Intronic
1150041722 17:61869624-61869646 GAGAAAACACAAATGATCCATGG - Intronic
1150269926 17:63857288-63857310 AAGAAAACTCAGGTGGGCAAAGG + Intergenic
1151133152 17:71919220-71919242 CAGAAAACACTGATGGTACAGGG + Intergenic
1153583134 18:6595605-6595627 AAGGTAACACAGATGGTAAATGG + Intergenic
1153611130 18:6886304-6886326 AAGAAAATACAGAGGGACAAAGG + Intronic
1153815332 18:8785812-8785834 AAGAAAACAAAAATGGACAAGGG - Intronic
1154276993 18:12970398-12970420 AAGAAAAAACAGATGGACAGGGG - Intronic
1155331340 18:24721646-24721668 TAGAAAAAACAGATGGGCCAAGG - Intergenic
1155663860 18:28283250-28283272 GAGAAAACCTAGAAGATCAAGGG - Intergenic
1156288207 18:35721068-35721090 GAGAAAGCACTGAGAGTCAATGG + Intergenic
1156479447 18:37426971-37426993 AAAAAAAAAAAGATGGTCAAGGG + Intronic
1156985507 18:43346152-43346174 CAGAAAACCCTGATGTTCAAGGG - Intergenic
1156992123 18:43421607-43421629 GAGACACCACAGGAGGTCAAAGG - Intergenic
1157428450 18:47603626-47603648 AAGAACACACAGATGATAAATGG + Intergenic
1157628303 18:49070562-49070584 TAGAGAACACAAATGGGCAAAGG - Intronic
1157902204 18:51529450-51529472 GAGGAAACACAAATGGCAAATGG + Intergenic
1158422657 18:57309729-57309751 GAGAAAAGATAGAAGGTCCAAGG + Intergenic
1159716067 18:71824724-71824746 AAGAAAACAAAGAAGGTAAAGGG + Intergenic
1160156461 18:76437432-76437454 GAAAAAAAAAATATGGTCAAGGG - Intronic
1160311812 18:77799651-77799673 GAGAAAGAACAGAGTGTCAAGGG - Intergenic
1161515456 19:4693788-4693810 GAGAAAAAGCAGATGGTGCAGGG - Intronic
1161808226 19:6457432-6457454 CAGAAGACAGAGATGGCCAAGGG + Intronic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1166713032 19:44949131-44949153 GAGAAAGCACAGATGGTTAGAGG - Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1168487612 19:56777861-56777883 GAGATCACAGAGATAGTCAAGGG - Intronic
1168587531 19:57605644-57605666 GAGAAAACACAGATTTACTATGG - Intronic
1202665483 1_KI270708v1_random:115240-115262 AAGAAAACACAGTTGGGCCAGGG + Intergenic
925036262 2:688802-688824 GAGAGAACACAAATGGACCACGG + Intergenic
925085474 2:1104574-1104596 GGGAAAACACAAATGGAGAAAGG + Intronic
925377858 2:3400948-3400970 GGGAAGACACAGAAGGGCAAGGG - Intronic
925634160 2:5926457-5926479 GAGAAAGCACATTAGGTCAATGG + Intergenic
926080598 2:9983116-9983138 GTAAGAACACAGATGATCAAGGG - Intronic
927221094 2:20710975-20710997 GAGAAAACTCAGATTTTAAAGGG - Intronic
927342069 2:21993662-21993684 GGGAAAACACAGTAGGTAAAAGG - Intergenic
927555855 2:24031484-24031506 GAGTAAACATGGATGTTCAAAGG - Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
930073685 2:47389832-47389854 GAGAAAACACCCATGGGCAGTGG + Intergenic
933484655 2:82903974-82903996 GAGAAAACACTGAAAGTCAAGGG + Intergenic
933732562 2:85468579-85468601 GAGAAAACACATTTGGTGATAGG - Intergenic
935202874 2:100873591-100873613 GAGAAAATACAGAGGTTTAAAGG - Intronic
936768427 2:115882267-115882289 AAGAAAATACAGAAGGTTAAAGG + Intergenic
937699713 2:124850599-124850621 GAGACAAAACAGATGGTAAATGG + Intronic
938450623 2:131415870-131415892 GTGAAAACACATATGATCAAGGG + Intergenic
938693003 2:133809499-133809521 GAGAAAACAGAAATGATGAAAGG + Intergenic
940246364 2:151621672-151621694 GACAAAACACAAATGTTCCATGG + Intronic
940275700 2:151938423-151938445 GGAAAGACACAGATGGGCAATGG - Intronic
940604020 2:155897216-155897238 TAGAAAACACAGATGGTGAGAGG + Intergenic
940874970 2:158889251-158889273 GAGGATATACAGATGGTTAAAGG + Intergenic
942317947 2:174711696-174711718 GAGAAAACCCACATAGACAAGGG - Intergenic
942702116 2:178723999-178724021 GAGAAAACCAAGATTGTCAGTGG - Exonic
942767485 2:179473717-179473739 GAGAACACACACATGGTCACAGG - Intronic
944225033 2:197341148-197341170 GACAAAATACAGAAGGACAAAGG - Intergenic
945113636 2:206389415-206389437 GAGAAAGCACAGAGGGTGACTGG + Intergenic
945289951 2:208117040-208117062 GTGTACACACAGATGATCAAGGG + Intergenic
945448761 2:209969527-209969549 GAAAAAACAGAGATGATGAATGG - Intronic
945997398 2:216449570-216449592 GAGAAGGAAGAGATGGTCAAAGG - Intronic
946672210 2:222117031-222117053 GTGAAAACACAAATGTTGAATGG + Intergenic
947766884 2:232643644-232643666 AAAAAAACACAGATGGACATTGG - Intronic
947981270 2:234412020-234412042 GAGACCACACAGCTCGTCAATGG - Intergenic
1169627088 20:7583042-7583064 AAGAGAACACAGATAGTCCATGG - Intergenic
1169692257 20:8344950-8344972 AAGAAAACACAGATCATTAAGGG - Intronic
1171127985 20:22621270-22621292 GGGAAAATACAGAAGTTCAAAGG - Intergenic
1171535747 20:25887313-25887335 GAGCAAGGGCAGATGGTCAATGG - Intergenic
1171572111 20:26262585-26262607 GAGCAAGGACAGATGGTCAATGG + Intergenic
1171781752 20:29425687-29425709 AAAAAGACACTGATGGTCAATGG + Intergenic
1175880926 20:62258554-62258576 CAGAAAATACAGATGAGCAAAGG - Intronic
1177530938 21:22356952-22356974 CAGAAAACACACATGATGAAAGG - Intergenic
1177759708 21:25389599-25389621 GAGAAAAAACTGATGGCAAAAGG - Intergenic
1177862715 21:26473660-26473682 GAGAAAACAGACAGGGTCAGAGG - Intronic
1177892427 21:26822610-26822632 GTGAAAACACTGAAGGTGAAAGG + Intergenic
1178912930 21:36690759-36690781 GAGAAAACACAGATGTTTTCTGG + Intergenic
1179041892 21:37810667-37810689 GAGGAAGCACAAATGATCAAGGG - Intronic
1183305162 22:37079101-37079123 CAGAAAACTCAGATGGGCCAAGG - Intronic
1184035608 22:41916486-41916508 GAAAAAACACAGATGAACAAAGG + Intergenic
1184265132 22:43342654-43342676 GAGAAAAGACAGATGCGGAAGGG - Intronic
1184344372 22:43904011-43904033 GAGAAAAGACAGCTGGGCCAGGG + Intergenic
949385392 3:3496672-3496694 GAGAGGAGACAGATGGTCATGGG - Intergenic
949740439 3:7227209-7227231 ATGAAAACACAAATGGTCAATGG - Intronic
949787050 3:7753352-7753374 GGGAAAACACAGATAATCCAAGG - Intergenic
955052114 3:55423135-55423157 GAGAAAACATGGAAGGACAAGGG - Intergenic
955707171 3:61739757-61739779 GTGCAAACACAGATGGCCACAGG + Intronic
956958093 3:74364574-74364596 GAGAGAACACAGATAGAAAATGG - Exonic
957083755 3:75660713-75660735 AAAAAGACACTGATGGTCAATGG - Intergenic
957849765 3:85792072-85792094 GTGAAAACACAAATGCTAAATGG - Intronic
958116256 3:89221912-89221934 GAGAAAAAAAAGATTGGCAATGG + Intronic
960726157 3:120672418-120672440 GACAAAATACAGAAGGACAACGG + Intronic
960882146 3:122355947-122355969 GAGAATGCACAGATGTTCAGAGG + Intergenic
961817640 3:129559486-129559508 GAGAACACACAGCTGGGAAATGG + Intronic
962844288 3:139261445-139261467 GAGAAAAGACAGATAGTTGAGGG + Intronic
963173546 3:142275617-142275639 GGGAACACACAGATGGTGAATGG - Intergenic
963768111 3:149359648-149359670 GAGATAACAAACATTGTCAAGGG + Intergenic
963821483 3:149899558-149899580 GAGAGAACACTGAAGGTGAAAGG + Intronic
964336524 3:155660501-155660523 GAGAATACAGAGATTGACAAAGG + Intronic
964655364 3:159061052-159061074 GAGAACACAGAGATGGTAAAGGG - Intronic
965817500 3:172652281-172652303 GAGAAAAGACAGATTGTCTTAGG - Intronic
966920280 3:184606594-184606616 GAGACAACACAAATGTTCAGTGG - Intronic
967350799 3:188511547-188511569 AAGAAAACACAAAAGGTGAAAGG - Intronic
967584850 3:191200165-191200187 GAGAAAACACAGAATGTCCCTGG - Intronic
967879063 3:194286438-194286460 GAGAAAACACTGTTGAACAAGGG - Intergenic
968253573 3:197245670-197245692 AAGAAAACTCAGAAGGTAAATGG - Intronic
968364820 3:198176050-198176072 TAGAAAAGATAGATGGTAAATGG + Intergenic
969130162 4:4985227-4985249 GAGAAATCACACAAGGTCATAGG - Intergenic
969996083 4:11314790-11314812 AAGGTAACACAGATGTTCAATGG + Intergenic
971420383 4:26468817-26468839 GAGAGAACACAAATGGCTAAGGG - Intergenic
971664557 4:29465264-29465286 GACTAAATACCGATGGTCAAAGG + Intergenic
972176869 4:36419166-36419188 AAGAAAACACAGATGGCAGATGG + Intergenic
972408184 4:38766200-38766222 GTCAAAACACAGATGGGCATAGG + Intergenic
973115595 4:46454400-46454422 TATAAAACACAGATGATTAAGGG - Intronic
975058487 4:69966568-69966590 GAGAAAACAGAGATGCCAAAAGG + Intergenic
975181917 4:71355757-71355779 GAGAAGTTACAGATGTTCAACGG - Intronic
976817585 4:89167219-89167241 GAGAAAACAGAGAATGTGAAAGG + Intergenic
977073344 4:92421368-92421390 GAGGAAATACAGATGGAAAAAGG + Intronic
977665827 4:99646414-99646436 ATGGAAACACAGATGGTTAATGG + Intronic
977681948 4:99806932-99806954 GAGCACACACAGATGGTCCAAGG + Intergenic
979418300 4:120471220-120471242 TATAAAACACAGATGATCATTGG - Intergenic
979936513 4:126704297-126704319 GAGGAAAAAGAGATGGTCAAGGG - Intergenic
980552879 4:134362990-134363012 GAGAAAACTGAGATGCTGAAAGG - Intergenic
981008867 4:139903946-139903968 GTGAAAACACAGAAGAGCAAAGG + Intronic
981811988 4:148785985-148786007 GAGAAAACGGAGATGAGCAAAGG - Intergenic
982366192 4:154581895-154581917 GAGAAAAGAAAGAAGGGCAAAGG - Intergenic
983770687 4:171545242-171545264 GAGAAAAAACAAAGGGTGAAAGG + Intergenic
983973008 4:173897215-173897237 GAGGGAAGCCAGATGGTCAAAGG - Intergenic
984698614 4:182804091-182804113 GAGAAAGAAAAGATGGTGAACGG - Intergenic
985647022 5:1089772-1089794 GAGAAAACCCACATGGGCAAGGG + Intronic
985751291 5:1678016-1678038 GAAAACACACAAATGGCCAATGG - Intergenic
986033524 5:3915989-3916011 GAAAAAACACAGATGGTCAAAGG - Intergenic
986149331 5:5112639-5112661 GATAAAAAAGAGATGGTTAATGG - Intergenic
987582842 5:19819424-19819446 GAGAAAACACTCAAAGTCAATGG + Intronic
988678327 5:33457633-33457655 GAGCAAACACTGATGATCTACGG + Intronic
989256441 5:39370784-39370806 GAGATAACACACAGGCTCAACGG + Intronic
991658382 5:68926207-68926229 TAGAAAACACAATTGGACAAAGG + Intergenic
992752253 5:79872240-79872262 GAGAACACACAGATGGACTCTGG + Intergenic
993030344 5:82698550-82698572 GAAAAATCTCAGTTGGTCAAAGG - Intergenic
993135989 5:83965152-83965174 GAGAAAATATAAATGATCAATGG - Intronic
993146176 5:84096272-84096294 GAAAAGCCACAGATGCTCAAAGG + Intronic
994633060 5:102309584-102309606 GAGGAAACACGAATAGTCAAGGG - Intergenic
994828436 5:104746361-104746383 GGGAAAATACAGATGGTAAGTGG - Intergenic
994828584 5:104747379-104747401 GAAAAACCACAGATATTCAATGG + Intergenic
995217983 5:109616866-109616888 GAGAGAACTCTGAAGGTCAAAGG - Intergenic
996682026 5:126238138-126238160 CAGAAAACACAGAAAGCCAACGG + Intergenic
997503741 5:134399279-134399301 GAGTAAACACAGATCTTCAGAGG - Intergenic
997762442 5:136462762-136462784 GTGAAAACTCAGATAGTCAGTGG - Intergenic
999021018 5:148165323-148165345 TAGCAAACACAGATGGCCTATGG - Intergenic
999024492 5:148211630-148211652 AAGATAACACAGACAGTCAATGG + Intronic
999373743 5:151072103-151072125 GAGAATACACAGCTGGTTAGTGG + Intronic
999451542 5:151681981-151682003 GAGAAAGTACAGATGTTCCAAGG - Intronic
999776195 5:154814605-154814627 GACAAACCCCAGATGATCAAGGG - Exonic
1000969323 5:167696608-167696630 TAGGAAAAACAGATGGTGAAAGG + Intronic
1001055013 5:168442025-168442047 GAGGAAACACAGATGTGGAAGGG - Intronic
1002703022 5:181140514-181140536 GGGAAATCACAGAAGCTCAATGG - Intergenic
1004251414 6:14026048-14026070 GAGTACACAGAGATGGACAAGGG + Intergenic
1006932126 6:37694881-37694903 GAGAAAACACAGAGAGAAAAGGG + Intronic
1007663182 6:43498896-43498918 GAAAAAACAAAGATGGTGAAAGG - Intronic
1007692401 6:43711201-43711223 GAGAGAAGACAGAGTGTCAAGGG + Intergenic
1009196188 6:60688487-60688509 AGGAAAACACAGATGTTCATTGG - Intergenic
1010932182 6:81816560-81816582 GATAAACAACAGAAGGTCAACGG - Intergenic
1011106726 6:83789944-83789966 GACAAAACTCATATGGTTAAAGG - Intergenic
1012293245 6:97485243-97485265 GAAAATACACAAATGGCCAAGGG - Intergenic
1012493476 6:99808986-99809008 CAGATAACACGGATGGACAATGG + Intergenic
1012844006 6:104366987-104367009 CAGAAAAGACAGATGGCTAAAGG - Intergenic
1013114126 6:107087752-107087774 ACAAAAAAACAGATGGTCAATGG + Intronic
1014042282 6:116842511-116842533 TGGAAAACACAGATGATCAAAGG + Intergenic
1014328672 6:120031804-120031826 GAGAATACACACGTGGTCTATGG - Intergenic
1015132407 6:129828302-129828324 AAGAACATACAAATGGTCAAAGG - Intergenic
1015413789 6:132925065-132925087 AAGAAAACATAGATGATGAATGG - Intergenic
1019268011 7:129575-129597 GAGCCAACACAGATGGCCATGGG - Intergenic
1020258746 7:6518292-6518314 AAGAAAACAAAAATGGACAAAGG + Intronic
1020742187 7:12035019-12035041 GAGAAAACAGAGAAGGTGAAAGG + Intergenic
1020982203 7:15084989-15085011 GAGAAAAGACAGAGGGTGACTGG + Intergenic
1021277661 7:18674423-18674445 GAGAAATCACAGATGGCATATGG - Intronic
1021896849 7:25244600-25244622 GGGAGAACTCTGATGGTCAAGGG - Intergenic
1023102916 7:36737172-36737194 GAGAAGACACAGAGGGTCCTTGG + Intergenic
1023180449 7:37477034-37477056 GACAAAACAGTGAAGGTCAAGGG + Intergenic
1023219425 7:37903638-37903660 ATGAAAACACATATGATCAAGGG + Intronic
1023737157 7:43245354-43245376 GAGAAAACACCGAAGTCCAAGGG - Intronic
1023944923 7:44796075-44796097 GAGAAAACAGCGATGCTCAAAGG + Intergenic
1024056785 7:45664525-45664547 GAGAACACAAAGATGCACAAGGG + Intronic
1024089630 7:45924547-45924569 GAGAAAACAGAGAGGTTCACCGG + Intergenic
1024155113 7:46614246-46614268 GAGAAAGGAAAGATGGCCAATGG - Intergenic
1024633857 7:51270664-51270686 GAGAAAACAGAGGTGCTAAAAGG + Intronic
1025089891 7:56053074-56053096 GAGAAAACCCAGCTGGGCACGGG - Intronic
1025707405 7:63880259-63880281 AAGAAGAGACATATGGTCAATGG + Intergenic
1026341987 7:69442400-69442422 CAGAAAACACAGAATGTCAGTGG - Intergenic
1027459227 7:78431600-78431622 AAGAAAATGCAGATGGTAAATGG + Intronic
1027545050 7:79517125-79517147 GAAATAATACAGATGGTCTAAGG - Intergenic
1027631738 7:80614876-80614898 AAAAAAACACAAAAGGTCAAAGG - Intronic
1028963239 7:96773416-96773438 GAGAAAACAAAGATTTTGAAAGG + Intergenic
1029660806 7:101960105-101960127 GGGCAAACACAGTTGGTCACTGG - Intronic
1030318899 7:108144088-108144110 TAGAAAAGACAGAAGGCCAAAGG + Intergenic
1030440511 7:109583556-109583578 GAGAAAACACCGAGGGTGGATGG + Intergenic
1031270861 7:119647287-119647309 GAGGAAAAGCAGTTGGTCAATGG - Intergenic
1031549935 7:123097205-123097227 GAGAAAACACTGAAAGTAAATGG + Intergenic
1032955581 7:136968207-136968229 GGGAACAGAGAGATGGTCAAGGG - Intronic
1033786844 7:144742241-144742263 CAGAAATGACAGATGATCAATGG - Intronic
1033849028 7:145471861-145471883 AAGAAATGACAGATGGTCCAGGG - Intergenic
1034263100 7:149769233-149769255 GAGACATCACAGATGGCCAAAGG + Intronic
1034586196 7:152094730-152094752 GAGAAAACAAACAAGGTCCAGGG + Intronic
1034972830 7:155429838-155429860 GAGAAATCCCAGAGGGTCATGGG + Intergenic
1035001717 7:155617683-155617705 GAGAAAACTCAAATGCTTAATGG - Intronic
1037512441 8:19597681-19597703 GAGAAAATACAGATGTTAAAAGG + Intronic
1037610329 8:20470589-20470611 GAGAAAGGAGAGAGGGTCAATGG - Intergenic
1037842448 8:22254909-22254931 GAAAAAACAGAGATGGTGATGGG + Intergenic
1038331903 8:26615652-26615674 AAGAAAACACAGATGGCAATTGG + Intronic
1038727099 8:30091492-30091514 GAGAAAAGAGAGGTGGCCAATGG - Intergenic
1038813694 8:30879054-30879076 GAGAATACACTGATGGCAAATGG - Intronic
1039564279 8:38539041-38539063 GATAAAGCAGAGATGGTTAATGG - Intergenic
1039837341 8:41267217-41267239 GAGAAAGCAGAGTTGGTGAATGG - Intronic
1040676897 8:49761322-49761344 GTAAAAACACAGAAGGTCATAGG - Intergenic
1040860116 8:51990422-51990444 GAGAAAGGAAAGATGGTCAAAGG + Intergenic
1040931114 8:52736263-52736285 GAGAAAACATAGATGTTGGATGG - Intronic
1041132699 8:54719020-54719042 GAAACAACACAGATGGTCTATGG + Intergenic
1042047638 8:64671789-64671811 CAGAAAACCCAGATGATAAAAGG + Intronic
1042173311 8:66013931-66013953 GAGAAAAAATAGATGCTCTATGG - Intergenic
1043524173 8:81078541-81078563 GAGAAAACACACATTGACAAGGG + Intronic
1044122115 8:88410841-88410863 GAGGAAACACAGAAGGTGGATGG + Intergenic
1044293923 8:90505059-90505081 GAGAAACCACAAGTGGTCTAGGG - Intergenic
1046150506 8:110218038-110218060 GAGAAAGCAGGGATGGTTAATGG + Intergenic
1046171759 8:110517348-110517370 AAGAACACACAGATGGTAAGTGG - Intergenic
1046376480 8:113388440-113388462 GTGACAAATCAGATGGTCAAAGG - Intronic
1047058375 8:121193505-121193527 GATAAAACACAGAAAGTCACAGG - Intergenic
1047071316 8:121347065-121347087 GAGACAACACAGAAGGTTGAGGG - Intergenic
1047266330 8:123312837-123312859 GAGAAAATACAGAGTGTAAATGG + Intergenic
1047281510 8:123450194-123450216 GAGAAAACAAGGATGCCCAAAGG + Intronic
1047952176 8:129943981-129944003 GAGAAAACGCAGGGGGCCAAGGG + Intronic
1048232677 8:132659200-132659222 GGGAAGACACAGATGGTCTGCGG - Intronic
1048778119 8:137970105-137970127 GAGTAAAAACAGATGGTAGAGGG + Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1050654048 9:7805806-7805828 GAGAAACCATAGATGGTGGAGGG - Intronic
1050772073 9:9214907-9214929 GAGATAACACAGTTGTACAATGG + Intronic
1051224943 9:14889418-14889440 GAGAACACACAAATGGCTAAGGG - Intronic
1051336613 9:16071405-16071427 GAGCAAACACTGAAGGTCGAGGG - Intergenic
1051536474 9:18164010-18164032 CAGAAAACACTGAGGTTCAATGG + Intergenic
1052179703 9:25509277-25509299 CAGAACACACAGCTGGTGAATGG + Intergenic
1052302643 9:26971486-26971508 AAGAAAACACAGAAGGAAAATGG - Intronic
1053854218 9:42321219-42321241 GAGAAAACCCAGATTATCAGAGG + Intergenic
1054697260 9:68372890-68372912 GAGAACACACTTATCGTCAAGGG + Intronic
1054822908 9:69541482-69541504 GAGGACATACAGATGGTCAATGG - Intronic
1055591047 9:77814137-77814159 TAAAAAAGACAGCTGGTCAAAGG + Intronic
1055850174 9:80617965-80617987 AAGAAAAAACAAATAGTCAATGG - Intergenic
1056452829 9:86733348-86733370 GAGAAGACCAAGATGGCCAAGGG - Intergenic
1058097835 9:100883458-100883480 GAAAAACCACAGCTGTTCAAAGG - Intergenic
1058760213 9:108123318-108123340 GAGAAATCAGAGATGGACACTGG - Intergenic
1059425212 9:114216635-114216657 GAACAATCACAGATGGTCTAAGG - Intronic
1059721668 9:116965861-116965883 TAGGAAGCACAGATGGTAAAGGG - Intronic
1059950769 9:119460409-119460431 GAGAAAACAAAAATGGTAAGGGG - Intergenic
1060212963 9:121721779-121721801 GATAAAACCCAGATGGGCAGAGG + Intronic
1060273152 9:122161787-122161809 GAAAATACACAGAAGGCCAAAGG - Intronic
1060285960 9:122252744-122252766 TAAAGAATACAGATGGTCAAGGG + Intronic
1188197503 X:27255547-27255569 AAGAAAACAAAGATGGACAAAGG - Intergenic
1189795327 X:44640516-44640538 GAGAAGACAGAAATGCTCAAGGG + Intergenic
1191956041 X:66643241-66643263 GAGTAAACACAGATGGAGACAGG - Intergenic
1192051748 X:67730827-67730849 TAGAAAGCACAGATGGACACTGG + Intergenic
1192442457 X:71184827-71184849 GAGAGCAGACAGATGGTCCAGGG + Intergenic
1192749365 X:73972536-73972558 GAAAACATACAAATGGTCAATGG - Intergenic
1193584573 X:83305077-83305099 GAGAAAACTCAAATGGGAAAAGG - Intergenic
1193901940 X:87190890-87190912 CAGAAAACACAAAAGGTTAAGGG - Intergenic
1195097368 X:101515873-101515895 AAGAGAACACGGATAGTCAATGG - Intronic
1195781184 X:108466590-108466612 AAAAAAATACTGATGGTCAAAGG - Intronic
1196718478 X:118831972-118831994 GAGAGAACACAGATGGCCTGGGG - Intergenic
1196758323 X:119177466-119177488 GAGAAACCACAGATGGGAAATGG + Intergenic
1196841998 X:119867616-119867638 GAGAAAACACAGATGATAAAAGG - Intergenic
1198401964 X:136277370-136277392 GAGGAAGCACAGATGTTCCAGGG + Intergenic
1198766731 X:140087943-140087965 GATAACAGACAGATGGTAAAGGG - Intergenic