ID: 1120930739

View in Genome Browser
Species Human (GRCh38)
Location 14:89845761-89845783
Sequence AGGGAGAAGCAGGCTGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 883
Summary {0: 1, 1: 0, 2: 6, 3: 73, 4: 803}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120930735_1120930739 4 Left 1120930735 14:89845734-89845756 CCAAAGGACACTGTGATTCTGTG 0: 1
1: 0
2: 3
3: 20
4: 229
Right 1120930739 14:89845761-89845783 AGGGAGAAGCAGGCTGAAGATGG 0: 1
1: 0
2: 6
3: 73
4: 803
1120930734_1120930739 5 Left 1120930734 14:89845733-89845755 CCCAAAGGACACTGTGATTCTGT 0: 1
1: 0
2: 3
3: 26
4: 277
Right 1120930739 14:89845761-89845783 AGGGAGAAGCAGGCTGAAGATGG 0: 1
1: 0
2: 6
3: 73
4: 803

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120930739 Original CRISPR AGGGAGAAGCAGGCTGAAGA TGG Intronic
900140784 1:1138816-1138838 AGGGAGAAGCTCTCTGAAGACGG + Intergenic
900693533 1:3995947-3995969 TGGGGGAAGCAGGCTGTGGAGGG + Intergenic
900859434 1:5217632-5217654 AGGGAGAAGCAGACTTTGGAGGG - Intergenic
900879546 1:5370844-5370866 AGGACGAAGCAGGTGGAAGAAGG + Intergenic
900919986 1:5663934-5663956 ATGGAGATGGAGACTGAAGAGGG + Intergenic
900989596 1:6092268-6092290 GGGCAGAAGCAGGCTGGACAGGG - Intronic
901050066 1:6421506-6421528 TGGGAGAAAAAGGCTGAAGGAGG + Intronic
901089539 1:6632250-6632272 AGGGAGAAGCTGGCTGTGGAGGG + Intronic
901465146 1:9416675-9416697 AGTGAGACGCAGGCTGAGGGTGG + Intergenic
901651158 1:10743900-10743922 GGGGGGAGGCAGGCAGAAGAGGG + Intronic
901748673 1:11392141-11392163 AGAGAGGAGCAGAATGAAGAAGG - Intergenic
902343382 1:15799100-15799122 AGGGAGGGGCTGGCTGAAGCAGG + Intergenic
902528522 1:17075548-17075570 AGGAGGAAGTAGGCTGAAGCTGG - Intronic
902528897 1:17077678-17077700 AGGGAGAAGGAGGCAAAAGTGGG + Intronic
902539000 1:17139067-17139089 AGGGAGAAGAAGGCTGCTGGGGG + Intergenic
902621622 1:17654170-17654192 AGGGGGGAGCAGGCGGAAGGTGG + Intronic
902654826 1:17859961-17859983 AGGGAGGAGCAGGTGGAGGAAGG + Intergenic
902777192 1:18682541-18682563 TGGGAGGAGCAGCCTGAAGTGGG + Intronic
903212864 1:21828491-21828513 AGGGAGAAGAATGCAGCAGAGGG + Intronic
903332002 1:22601223-22601245 CAGAAGAAGCAGGCTGAGGAAGG - Intronic
903693863 1:25193275-25193297 AGGGAGGAGGAGACTGAAGGAGG + Intergenic
903753502 1:25645005-25645027 AGGGAAAAGCAGGCTGGATGTGG - Intronic
903905536 1:26683353-26683375 AGGAAGAAGCAGGCTGGGCATGG - Intergenic
904286197 1:29454590-29454612 AGGGTGAAGCAGGGGGAAGCAGG + Intergenic
904609460 1:31717113-31717135 AGGCAGAAGCTAGCTGCAGAGGG + Intergenic
904709085 1:32414870-32414892 AGGGGAGTGCAGGCTGAAGATGG - Intergenic
904769518 1:32872891-32872913 AGAGAGAAGGCGGCTGAAGGAGG + Intergenic
904933419 1:34108683-34108705 AGAGGGAAAGAGGCTGAAGAGGG + Intronic
905886262 1:41493740-41493762 TGGGAGAGGCAGGTGGAAGAGGG + Intergenic
906009576 1:42511000-42511022 AGAGAGGTGCAAGCTGAAGATGG + Intronic
906097410 1:43233745-43233767 AGGTAAAAGCATGATGAAGAGGG + Intronic
906205256 1:43983221-43983243 TGGGAGCACCAGGATGAAGACGG + Intronic
906348710 1:45038577-45038599 AGGGAGAAAAGGGCTGACGAGGG + Intronic
906728015 1:48058147-48058169 AGGGAGAAACAGGCAGGAGAGGG + Intergenic
907620489 1:55972993-55973015 AGTGAGAAAAAGGCTGGAGAGGG + Intergenic
907755333 1:57305318-57305340 AGGGAGAAAGAAGCTGAAAAGGG + Intronic
908459006 1:64331070-64331092 AGGCAGAACCAGGCAGCAGAGGG - Intergenic
908491414 1:64647996-64648018 AGAGAAGGGCAGGCTGAAGACGG - Exonic
908562411 1:65319853-65319875 AGGGATAAGGAAGTTGAAGATGG - Intronic
908745265 1:67370455-67370477 AGGAAGAAGAAGGCATAAGAGGG - Intronic
908766065 1:67555587-67555609 AGGCAGAGGCAGCCAGAAGATGG + Intergenic
909042541 1:70671134-70671156 TGTGACAAGCAGGCTGAACATGG + Intergenic
909152757 1:72029188-72029210 AGGTAGAAGAAGGCTGGACATGG + Intronic
909931604 1:81504303-81504325 AGGCTGAAGAAGGCTGAAGAAGG - Intronic
909931605 1:81504313-81504335 GGGCTGAAGAAGGCTGAAGAAGG - Intronic
910039699 1:82834869-82834891 AGTGAGAAGCAGGAAGAAGAAGG - Intergenic
910373483 1:86543521-86543543 AGGGAGAAGCAGGGAGCAGGAGG + Intergenic
911016685 1:93341000-93341022 AGGAAGAAGCAGGGTCAAGGAGG - Intergenic
911291856 1:96066010-96066032 TGGAAAAAGCAGGCAGAAGAAGG + Intergenic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
912255108 1:108050367-108050389 AGTAGGCAGCAGGCTGAAGAGGG + Intergenic
912745036 1:112239135-112239157 AGGGAGAATCAGGCTGAAAATGG + Intergenic
913090528 1:115473750-115473772 AGAGAGAAGCAGGGTAAGGAAGG + Intergenic
914676049 1:149908362-149908384 AGGGAGGAGCAGGGAGAAGCTGG - Intronic
914991748 1:152504917-152504939 AGGGAGAGGCTGGCTGCAAAGGG - Intergenic
915023011 1:152798674-152798696 AGTGAGAAGGAGGATGAAGTCGG - Intronic
915561348 1:156690017-156690039 AGTGAGGAGGAGGCAGAAGACGG + Intergenic
915650124 1:157303567-157303589 AGGGAGAAGGTGCATGAAGATGG + Intergenic
915802275 1:158807108-158807130 AGAGAGAATGAGGCTGAGGAGGG + Intergenic
916175110 1:162031583-162031605 TGGGAGAGTCAGGCTGAAGTAGG + Intergenic
916281610 1:163057855-163057877 AAGGAGAACCAAGCTGAGGAGGG - Intergenic
916688802 1:167171631-167171653 TGGCACAAGCAGGCAGAAGAAGG - Intergenic
917174419 1:172217163-172217185 AGGTGTAAGGAGGCTGAAGAAGG - Intronic
917514952 1:175699548-175699570 AGGGCTAAGCAGGCTAAGGAGGG + Intronic
917725820 1:177826209-177826231 AAGGAGAAGAAACCTGAAGATGG - Intergenic
917965076 1:180173581-180173603 AGGGAGCAGAAGGTTGCAGATGG + Intronic
918990909 1:191696130-191696152 AGGTAGAAGCAAGATGGAGATGG - Intergenic
919261719 1:195204489-195204511 AGCGAGAAAGAGGCAGAAGAAGG + Intergenic
919301941 1:195781423-195781445 AGGGAAAAGGAAGCAGAAGAAGG + Intergenic
919513140 1:198491159-198491181 AGAGAGCAGCAGGAAGAAGATGG + Intergenic
919594706 1:199547369-199547391 AGGGACAAGCAGGCAGAAAGAGG + Intergenic
919682950 1:200454272-200454294 AGGAAGAATGAGGCTGAGGAGGG - Intergenic
919869888 1:201812365-201812387 AGTGAGAAGCAGGCAGAAGGAGG + Intronic
920757525 1:208748549-208748571 AGGGAGAAGGAAGGTGAAGAGGG - Intergenic
922022864 1:221721748-221721770 AGGGAAAAGAAGGCTCAGGAGGG + Intronic
922245682 1:223795268-223795290 GGGGAGGAAGAGGCTGAAGAGGG + Intronic
922341051 1:224655386-224655408 AGGGTGGAGAAGGGTGAAGAGGG + Intronic
922612178 1:226938934-226938956 GGGGAAAAGCAGGCTGGAGGGGG + Intronic
922776990 1:228219362-228219384 AGGGAGGTGCAGGCTGAGGTGGG + Exonic
922781928 1:228259539-228259561 AGGGAGGTGCAGGCTGAAGCAGG + Exonic
922782502 1:228264154-228264176 AGGGAGGTGCAGGCTGAGGCGGG + Exonic
922783024 1:228268568-228268590 AGGGAGGTGCAGGCTGAGGCGGG + Exonic
922783524 1:228271984-228272006 AGGGAGGTGCAGGCTGAGGCAGG + Exonic
922802328 1:228370166-228370188 AGGGAGAGGAAGGCTCAGGAGGG - Intronic
922824815 1:228510431-228510453 AGGGAGGAGGGGGCTGGAGATGG + Intergenic
923286583 1:232501914-232501936 AGGGAGAAGCAGCCGAAGGAAGG - Intronic
924046939 1:240041535-240041557 AGGGAGAAATGGGCTTAAGAAGG - Intronic
924823960 1:247521316-247521338 AGGGAGAGGGAGACTGGAGAGGG - Intronic
1062941707 10:1426803-1426825 AGGGAGAAGCAGGGTATAGAAGG - Intronic
1063981475 10:11455432-11455454 GGGGAGAAGAAGGGTCAAGATGG - Intronic
1064246536 10:13672149-13672171 AGGGAGAAGCAGGCGAGTGACGG - Intronic
1064272705 10:13879773-13879795 AGGGAGGAGGAGGAGGAAGAAGG - Intronic
1064485746 10:15787321-15787343 AGGAAGAAGAAGGCAGAAGAAGG + Intronic
1064523831 10:16231989-16232011 AAGGAGAAGCAAGTTGATGATGG - Intergenic
1064804352 10:19113593-19113615 AGGGAGAAGAAGGAAGAAAAAGG - Intronic
1065761582 10:28987805-28987827 AAGGAGAAGTAGGAAGAAGAAGG - Intergenic
1065765652 10:29026997-29027019 GAGGAGAAGGAGGATGAAGAAGG + Intergenic
1065962621 10:30746279-30746301 ACGGCGATGCAGTCTGAAGATGG - Intergenic
1066228898 10:33412640-33412662 AGGGAGAAACTGGCTGATGGAGG + Intergenic
1066649067 10:37638710-37638732 AGGCAGAGCCAGGCTGGAGAAGG + Intergenic
1066993842 10:42543696-42543718 TGTGGGAAGCAGGCTGAAAATGG + Intergenic
1067474260 10:46556010-46556032 AGGGAGAAGGGGGCTCAATACGG + Intergenic
1068816276 10:61318210-61318232 AGTGAGAAGCAAGCTGATGATGG + Intergenic
1069262050 10:66410730-66410752 TGGGAGAAGTAGGCAAAAGATGG - Intronic
1069713872 10:70508414-70508436 GGGGAGCAGCAGGTTGGAGAAGG + Intronic
1069788265 10:71003656-71003678 AGTGAGAAGCAGTTTCAAGAGGG - Intergenic
1070571787 10:77645455-77645477 TGGGATAACAAGGCTGAAGAAGG - Intergenic
1070892257 10:79949737-79949759 AGGGAGAACAAGCCTGAACAAGG - Intronic
1072535090 10:96356200-96356222 AGGGAGACCGAGGCTGAAGGAGG - Intronic
1072624843 10:97104667-97104689 AGGGAGAGGGAGGCTGTAGCTGG - Intronic
1073096312 10:100982213-100982235 AGGGAGCAGCAGGCAGAGGGAGG + Intronic
1073631973 10:105158424-105158446 AGAGACAATCTGGCTGAAGAAGG + Intronic
1073941688 10:108706530-108706552 ATTGGGAAGCAGGCAGAAGATGG - Intergenic
1073961996 10:108942647-108942669 ATTGAGAAAGAGGCTGAAGACGG - Intergenic
1074866706 10:117548104-117548126 AGGCAGAAGCTGGAGGAAGAAGG + Exonic
1075125214 10:119693965-119693987 AGGGAGAAGAAGGTAGAAGGGGG - Intergenic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1075406674 10:122200103-122200125 AGGGAGCAGCCGGCCCAAGAGGG - Intronic
1075441125 10:122480124-122480146 AGGGAGACTGAGGCTGAAGCAGG + Intronic
1075721608 10:124590765-124590787 ACAGAGAAGCAGGCTCAGGAAGG - Intronic
1075923942 10:126235655-126235677 AGGGATGAGGAGGCTGGAGAAGG - Intronic
1076338735 10:129728328-129728350 GGTGAGAAAAAGGCTGAAGAAGG + Intronic
1076718487 10:132381171-132381193 TGGAAAAAGCAGGCAGAAGAAGG + Intergenic
1076861640 10:133140712-133140734 AGCAAGAAGCAGGCTGATGTTGG + Intergenic
1077606214 11:3614637-3614659 AGGGAGAAGCTGGGTGAGGTGGG - Intergenic
1078507169 11:11960909-11960931 AGGGAGGATGAGGTTGAAGAGGG - Intergenic
1079102025 11:17547743-17547765 AGGGAGATCCTGGCTGGAGAAGG + Intronic
1079130764 11:17745645-17745667 AGAGAGAAGCAGACAGCAGAGGG - Intronic
1079449560 11:20588044-20588066 AAGGAGAAGGAGGAAGAAGAGGG + Intergenic
1079922530 11:26450413-26450435 AGGGAGAAGCAGGCTAACAAAGG + Intronic
1080788006 11:35493596-35493618 TGGGAGAAGCAGACTAAACAAGG - Intronic
1081563428 11:44240346-44240368 AGGAACAGGCAGGCTGGAGAAGG + Intronic
1081637463 11:44729943-44729965 CGGAGGAAGCAGGCTCAAGAGGG - Intronic
1082282826 11:50288494-50288516 AAGGAGAAGCAGGATGATAATGG - Intergenic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083373984 11:62205050-62205072 AGGGAGAGGTAGGTTAAAGATGG - Intergenic
1083514727 11:63246337-63246359 ACAGAGAAGCAGGGTGAACAGGG + Intronic
1083621170 11:64050145-64050167 TGGGAGTGGCAGGGTGAAGACGG - Intronic
1083682594 11:64358329-64358351 AGGGAAAGGCAGGAAGAAGACGG + Intergenic
1083902870 11:65652186-65652208 AAGGAGAGGCAGGCTGGGGATGG + Intergenic
1084124876 11:67092801-67092823 AGGCTGAAGCAGGCTGGACACGG - Intergenic
1084448164 11:69216365-69216387 AGGCAGAAGCATGGTGAAGGGGG + Intergenic
1084468452 11:69341066-69341088 ATGGAGAAGCACGTTGGAGAAGG + Intronic
1084601564 11:70148875-70148897 AGACAGATGCAGGCTGAAGAAGG + Intronic
1084710615 11:70841655-70841677 AGGGAGAAGCAGACGGAAAGGGG - Intronic
1085087411 11:73679458-73679480 AACGAGAAGCAGGCTGCAAAGGG + Intronic
1085201747 11:74706174-74706196 GGGGAGACACAGGCTGTAGATGG + Intronic
1085202099 11:74708062-74708084 AGGGAAAGGCAGAGTGAAGAAGG - Intronic
1085684580 11:78610119-78610141 AAGGAGAAGGAGGAAGAAGAAGG - Intergenic
1086518262 11:87639886-87639908 AGGGAGAAGAAACCTGCAGAGGG - Intergenic
1087184152 11:95168886-95168908 AGGAAGAAGCAGGCAGAAAAGGG + Exonic
1087239200 11:95756654-95756676 AGGGAGAAGCAGGATTATGAGGG + Intergenic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1088692033 11:112336494-112336516 AGGGAGAAGGAGGCTTCAGCAGG + Intergenic
1089042234 11:115462910-115462932 GGGATGAAGCAGGATGAAGAGGG + Intronic
1089067279 11:115671368-115671390 AGGGAGGAGAAGGGTGAAGGAGG - Intergenic
1089242709 11:117096631-117096653 ACGGACAAAAAGGCTGAAGAGGG + Intronic
1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG + Intronic
1089564074 11:119361630-119361652 GGGGAGGAGCAGGCTGAAGGAGG + Intronic
1089690966 11:120186505-120186527 GGGGAGGAGCAGGCAGATGAAGG - Intergenic
1089746912 11:120623970-120623992 AGGGAGAGGGAGGAGGAAGAGGG - Intronic
1089858021 11:121564224-121564246 AGAGAGAAGCTGGAAGAAGATGG - Intronic
1091057145 11:132429930-132429952 AGCTAGAAGCAGACTGAGGAAGG + Intronic
1091075728 11:132614250-132614272 TGGGGGAAGCAGGGAGAAGATGG - Intronic
1091308260 11:134554652-134554674 AGGAAAAAGCAGGTTGAAAATGG - Intergenic
1091363974 11:135001661-135001683 ACGGAGAAGCAGGAAGGAGAGGG + Intergenic
1091591408 12:1845070-1845092 AGGGAGAAGCAGGGTGGGGGTGG + Intronic
1091603157 12:1930007-1930029 AGGGAGGAGGAGGAAGAAGAGGG + Intergenic
1091647980 12:2288242-2288264 AGAGAGAAGCTGGCTGGAGAGGG - Intronic
1091784204 12:3232473-3232495 AGGGAGCAGAAGGCAGGAGACGG - Intronic
1091846221 12:3658117-3658139 AGGGAGAAGGAGGGAGCAGAAGG + Intronic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092305638 12:7297861-7297883 GGGGAAAAGCAGGCTGGAGGGGG + Intergenic
1092334681 12:7620519-7620541 AGGGAGAAGCAAGGTAAAAATGG - Intergenic
1092672610 12:10881179-10881201 AAGGAGAAGGGGGCTGTAGAAGG - Intronic
1092915422 12:13184839-13184861 AGCTAGAAGCAGGCTGCAGAGGG + Intergenic
1093073726 12:14735375-14735397 GGGGAGGAGCAGGATTAAGAAGG - Intergenic
1093319216 12:17692009-17692031 AGAGACAAGAAAGCTGAAGAGGG + Intergenic
1093422232 12:18987589-18987611 AGGGAGTTGGAGGCTGAAGGAGG - Intergenic
1094216484 12:27948129-27948151 AGAGATAAGCAGGATAAAGAGGG - Intergenic
1094249956 12:28348275-28348297 AGGGAGACAGAGGCTGCAGATGG - Intronic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1095480005 12:42625010-42625032 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1095833176 12:46609186-46609208 AGGAAAAAGCAGTCTGAAGGTGG + Intergenic
1095938572 12:47710953-47710975 AGGGAGAGGCAGCGTGAAGTGGG - Intronic
1096046036 12:48563246-48563268 AGGGAGAGGCAGGAAGAAGAGGG - Intergenic
1096353118 12:50916682-50916704 AGGGAAGTGCAGGCTAAAGATGG - Intergenic
1096492622 12:52021040-52021062 AGCGTGCAGCAGGCTGAGGAAGG - Intergenic
1096590113 12:52652487-52652509 AGGGAGCAGCATTCTGCAGAAGG - Intergenic
1096967522 12:55639996-55640018 AGGGAGAGGCAGGTGGAACAGGG + Intergenic
1097057123 12:56257026-56257048 AGGCAGCAGCACGATGAAGAGGG + Exonic
1097409630 12:59235457-59235479 ATGGAGAGGTAGGGTGAAGAGGG - Intergenic
1097813652 12:64046651-64046673 GGGGAGAAGCAGGCTGAAGCGGG + Intronic
1097958094 12:65506685-65506707 AGGGAGAACTAGGAGGAAGATGG + Intergenic
1098221994 12:68280008-68280030 AGGGAGAATCAGGGTGAATGGGG + Intronic
1099051257 12:77783983-77784005 AGGGAGAAGCAGAGTCATGATGG - Intergenic
1099403216 12:82225799-82225821 AAGGAGAAGTAGGTTGAGGATGG - Intronic
1099438052 12:82667085-82667107 AGGGAGAGTCAGGCTGGATATGG - Intergenic
1100449930 12:94696076-94696098 AGGGGGAAGGAGGGAGAAGAGGG + Intergenic
1100592655 12:96043944-96043966 TGGGAGAAGCAGACTGGAGTGGG + Intergenic
1101794108 12:107957020-107957042 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1102095913 12:110241252-110241274 AGGGAGAAGCAGACTTAGGTAGG + Intergenic
1102442049 12:112970976-112970998 AGAGAGAAACAGGCTGAGCACGG - Exonic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1102598747 12:114012894-114012916 AGGGAGAAGGAGGAGGGAGAGGG + Intergenic
1102788246 12:115621586-115621608 AGGGATACAGAGGCTGAAGACGG + Intergenic
1102802500 12:115748819-115748841 AGGGAGACCAAGGCTGAAAAAGG + Intergenic
1102894067 12:116584542-116584564 AGGGGGAAGCAGGAGCAAGAAGG - Intergenic
1103374548 12:120445746-120445768 AGAGAGAAACAGGCTAACGAAGG + Intronic
1103590578 12:121989563-121989585 AGGGAGTAGTGGGCTGAGGAGGG - Intronic
1103931955 12:124455490-124455512 AGGCAGAAGCAGGGAGGAGATGG - Intronic
1103991933 12:124805167-124805189 AGGGAGCAGCAGGTGGGAGAGGG + Intronic
1104311189 12:127655514-127655536 AGAGTAAAGCAGGCAGAAGAAGG + Intergenic
1104773781 12:131380939-131380961 GGGGAGAGGGAGGGTGAAGAGGG - Intergenic
1105305005 13:19161977-19161999 AGGAAGCAGCAGGCTGAGCAGGG + Intergenic
1105579797 13:21684590-21684612 AGGGGGAATGAGGCTGAAGCTGG + Intronic
1106097356 13:26659845-26659867 GGAGAGAAGCAGGCTTATGAGGG + Intronic
1106128813 13:26922504-26922526 CGGGAGAGCCAGGCTGGAGAAGG - Intergenic
1107024931 13:35791053-35791075 AGGGAAAAGCATTCTGGAGAAGG + Intronic
1107141406 13:37001439-37001461 AGGGAGAAGCAGGCGGTATGTGG - Intronic
1107385601 13:39905075-39905097 AGAGTAAAGCAGGCAGAAGAAGG - Intergenic
1107589833 13:41891463-41891485 AGAGAGATGCAGCTTGAAGATGG - Exonic
1107710845 13:43149160-43149182 AGGGAGAAACAGGCTACATACGG + Intergenic
1108192751 13:47959415-47959437 AGGGAGAAGGAGGAGGGAGAAGG + Intronic
1108584974 13:51863239-51863261 AGGGAGAAGCAAGCTGGAGTTGG + Intronic
1108734041 13:53263877-53263899 TGAGACAAGCAGGCAGAAGATGG - Intergenic
1109058614 13:57583130-57583152 AGTGAAGTGCAGGCTGAAGAGGG - Intergenic
1109273903 13:60283356-60283378 TAGGAGAAAAAGGCTGAAGAAGG - Intergenic
1109805358 13:67433198-67433220 AGGAAAAATCAGGCTGTAGATGG - Intergenic
1110242245 13:73282295-73282317 AGTGAGAAGAAGGCAGAAGGAGG - Intergenic
1110391383 13:74978765-74978787 AGGGTGCAGCAGACCGAAGAGGG + Intergenic
1110484850 13:76026724-76026746 TAGGAGAAGCAGTCTGGAGAGGG - Intergenic
1110597665 13:77336931-77336953 AAGTGGAAGCAGGCTGAAAATGG + Intergenic
1112185645 13:97125531-97125553 AGGGAGAAGCAGGCTCATGGGGG - Intergenic
1112391114 13:98985192-98985214 TGGGAGAGTCAGGCTGACGAAGG + Intronic
1112468104 13:99662832-99662854 AGGGAGAAGAATGCTGATAAGGG - Intronic
1112504824 13:99969471-99969493 TGGGAGACGCACGCAGAAGAAGG + Intronic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113672225 13:112183052-112183074 GTGGAGAAGGAGGCTGACGATGG - Intergenic
1113933452 13:113980860-113980882 AGGGAGAAGAAGGGTGGAGGAGG + Intronic
1114368111 14:22052528-22052550 AAGGATAAGCAGGCCCAAGAGGG - Intergenic
1115256667 14:31409624-31409646 AGGGAGATGGAGGCTGCAGTGGG + Intronic
1116027240 14:39530056-39530078 TGGGAAAAGCAGTATGAAGAGGG - Intergenic
1116475081 14:45330866-45330888 AAGGAGAAGGAGGAGGAAGAAGG - Intergenic
1116481838 14:45400461-45400483 AGGAAAAAGCAGGCAGAGGATGG + Intergenic
1116799393 14:49427421-49427443 AGTGAGAGGGAGGCAGAAGATGG + Intergenic
1117119409 14:52552389-52552411 ACGGAGGAGGAGGCAGAAGACGG + Exonic
1117339128 14:54778881-54778903 AAGGGGAAGGAGGCTGCAGAAGG + Intronic
1117783364 14:59257717-59257739 AGGAAGGAAGAGGCTGAAGATGG - Intronic
1118105218 14:62650941-62650963 AGGCAGAAGGAGGAAGAAGATGG - Intergenic
1118230276 14:63941685-63941707 AGGGAGAAGTGTGCTGCAGAAGG - Exonic
1118444278 14:65837552-65837574 CAGGAGAAGCAGGCTTTAGAGGG + Intergenic
1118538113 14:66791288-66791310 AGGGAGATGCTGCCTGAACAGGG + Intronic
1118675791 14:68183387-68183409 AGAAAGAAGCAGGCAGAAGTTGG - Intronic
1118774770 14:68966902-68966924 AGGAAGGGGCAGGATGAAGAGGG + Intronic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1120625965 14:86827026-86827048 AGGAAGAGGAAGGCAGAAGAGGG + Intergenic
1120930739 14:89845761-89845783 AGGGAGAAGCAGGCTGAAGATGG + Intronic
1121227705 14:92333631-92333653 TGGGAGAAGCGGGCTGATGCAGG + Intronic
1121456404 14:94041542-94041564 AAGAAGATGCAGGCTGAGGAGGG - Intronic
1121777036 14:96598023-96598045 AGGGAGGAGAAGGGGGAAGATGG - Intergenic
1121777151 14:96598361-96598383 AGGGAGGAGGAGGAGGAAGACGG - Intergenic
1121785861 14:96660655-96660677 AGGGAAAACAAGGCTGATGATGG - Intergenic
1121788533 14:96681221-96681243 TGGAAGCTGCAGGCTGAAGATGG + Intergenic
1121789340 14:96687227-96687249 AGGGAGCCCCAGGCTGGAGATGG - Intergenic
1122288603 14:100667567-100667589 AGGGAGACTGAGGCTGGAGAGGG + Intergenic
1122874494 14:104657414-104657436 AGGGAGAGGCAGGGTTAGGAGGG - Intergenic
1122880232 14:104687596-104687618 AGGCCGGAGCAGGGTGAAGAAGG - Intergenic
1202855931 14_GL000225v1_random:52379-52401 AGGGAGAAACCGGCTAGAGAGGG - Intergenic
1123773031 15:23548288-23548310 AGGGACAAGCAGGAGGCAGAGGG - Intergenic
1123969107 15:25488424-25488446 AGGAAGAAGTAAGCTGAGGAAGG + Intergenic
1124103795 15:26718884-26718906 GGGGAGAGGCAGGCTGAAGAGGG - Intronic
1124381731 15:29172997-29173019 AGGCAGAAATAGGCTGCAGAGGG - Intronic
1124403400 15:29371181-29371203 GGGATGAAGCAGGCTCAAGAGGG - Intronic
1124545872 15:30626219-30626241 AGGTAGAGGCAGGCTGATGGGGG + Exonic
1124598715 15:31113268-31113290 AGGGAGGAGCAGGCAGAATCAGG - Intronic
1124637328 15:31373555-31373577 AAGGAGAAGCAGGAGGAAAAGGG - Exonic
1124779390 15:32615606-32615628 AGGTAGAGGCAGGCTGATGGGGG + Exonic
1125227629 15:37413042-37413064 ATTGAGAAGCAGGCAGAAGGGGG - Intergenic
1125360510 15:38859843-38859865 AGGGAAAAGCAGGTATAAGATGG - Intergenic
1125727893 15:41877398-41877420 GAGGAGAAGGAGGCTGACGAGGG - Intronic
1126052331 15:44697311-44697333 AAGGAGAAGAAGGAAGAAGAAGG - Intronic
1126424801 15:48515730-48515752 AGAGAAAAGCAGGCTGCAGCTGG - Intronic
1127122105 15:55780596-55780618 AGGGAGAAGAAGAAGGAAGAAGG + Intergenic
1127126661 15:55818920-55818942 AGGGAGAAGCACAATGAAAATGG - Intergenic
1127755032 15:62083935-62083957 AGTGTGAAACAGACTGAAGAAGG + Intergenic
1128095670 15:64952813-64952835 AGGAAGAAGGAGGAGGAAGAAGG - Intronic
1128250452 15:66160176-66160198 AGGGAGAAGTAGGCTAGAAAGGG + Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128979833 15:72178175-72178197 AGGGTGAAGAAGGCTCAGGAGGG - Intronic
1129116935 15:73369626-73369648 AGGGACAAGCCGGCTGCAGCGGG + Intergenic
1129295826 15:74599526-74599548 CGGAGGAAGCAGGCTGAGGAGGG + Intronic
1129313033 15:74725613-74725635 AGGGAGAAGCAGCCTGAACCGGG + Intergenic
1129360170 15:75019549-75019571 AGGGAGGAGGAGGCTGAAGGAGG - Exonic
1129887002 15:79045553-79045575 AGAGAGAAGCAGGCAGGAGGAGG - Intronic
1129953774 15:79614824-79614846 AGAGAGAAGGCGGCTGAGGATGG + Intergenic
1130036757 15:80368049-80368071 AGGGGAGTGCAGGCTGAAGATGG - Intronic
1131066390 15:89437263-89437285 AGGTAGAAGAAGGAGGAAGAGGG - Intergenic
1131390478 15:92044029-92044051 GGAGAGAACCAGGCTGAAGCTGG - Intronic
1131482937 15:92797660-92797682 AGGAAGAAGCAGCCTGATGCGGG + Intronic
1132012226 15:98286178-98286200 AAGAAGAAGAAGGCAGAAGAAGG + Intergenic
1132281212 15:100617489-100617511 AGAGAGAAGCAGGCAGAGCAAGG - Intronic
1132389039 15:101425331-101425353 AGGGAGAACCAGGAGGAAGCGGG - Intronic
1132986991 16:2772391-2772413 AGGGTGATGCTGGCTGCAGATGG - Intronic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133255777 16:4514763-4514785 AGGGAGAAGCCGGATGTGGAAGG - Exonic
1135066537 16:19314898-19314920 AGGGAGAAGAAGGGAGAGGAAGG + Intronic
1135298320 16:21301915-21301937 AGGGGGACGCCGGCAGAAGAAGG - Intronic
1135515737 16:23131687-23131709 AGAGAAAAGCAAGCTGATGATGG - Intronic
1136539093 16:30918682-30918704 AAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1137824479 16:51479401-51479423 AGGGAGCAGAGGGCTGAAGGAGG - Intergenic
1138493097 16:57388368-57388390 AGAGAGAAGGAGGCTGAGGCGGG - Intergenic
1138541630 16:57691158-57691180 AGGGAGAAGGAGGGAGAAGGAGG + Intergenic
1139189014 16:64840115-64840137 AAAGAGAAGGAGGCTGAAGGTGG - Intergenic
1139872131 16:70116148-70116170 AGGGAGATGGAGGCTGCAGTGGG - Intronic
1140041622 16:71412113-71412135 AGGGAGAAGCAGGCCCACAAAGG + Intergenic
1140196447 16:72859434-72859456 TGGGAGAAGAAGGCTGAGGTGGG - Intronic
1140824277 16:78691458-78691480 AGGCTGAAGTAGGCTGAAGTGGG + Intronic
1141362217 16:83406286-83406308 AGGTAGGAGAAGGCAGAAGAGGG - Intronic
1141631637 16:85291277-85291299 AGGGAGGAGGAGGGTGAGGAGGG - Intergenic
1141655414 16:85413360-85413382 AGGGAGGAGCTGCCTGAAGTTGG + Intergenic
1141775773 16:86121797-86121819 AGGGACAAGCAGGAGGAGGAAGG - Intergenic
1141810737 16:86373717-86373739 AGGGAGGAGCAGGCGGCACAGGG + Intergenic
1141902695 16:87003016-87003038 GGGGAGGTGCAGGGTGAAGATGG + Intergenic
1142704139 17:1683793-1683815 AGGGAGAAGCAGGCACCAGCAGG + Intronic
1142767903 17:2075968-2075990 AGGGAGGGACAGGCTGCAGAGGG + Intronic
1142808779 17:2385670-2385692 CGGGAGAAGCAGGGTGTTGAGGG + Exonic
1142887294 17:2920645-2920667 AGGAGGAAGCAGGCGGACGAGGG + Intronic
1142958160 17:3535190-3535212 AGGGAGAAGGAGGAGGGAGAGGG - Intronic
1143254423 17:5544965-5544987 AGGGGGAAGGAGGCTGAAGGTGG + Intronic
1143262937 17:5613865-5613887 AAGGAAAAGCAGGAGGAAGAGGG + Intronic
1143391506 17:6561578-6561600 AGGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143395409 17:6590998-6591020 AGGAAGAAGAAGGAAGAAGAAGG + Intronic
1144047864 17:11469688-11469710 AGGGAGAGGCAGGGAGAAGGGGG - Intronic
1144621566 17:16821778-16821800 GGGGATGAGCAGGCTGGAGAAGG + Intergenic
1144753018 17:17663103-17663125 AGGGGGAAACAGGCTGAGAAAGG + Intergenic
1145798411 17:27668782-27668804 AGGGAGAGGCTGGCTGCATAGGG - Intergenic
1145993339 17:29092131-29092153 GGGGAGGAGCGGGCAGAAGAGGG - Intronic
1146173746 17:30651692-30651714 CGGGAGAGGCAGGCTGAGCAGGG - Intergenic
1146315356 17:31802678-31802700 AGGGAGAAACAGGCTGTGGCTGG - Intergenic
1146347202 17:32067713-32067735 CGGGAGAGGCAGGCTGAGCAGGG - Intergenic
1146395355 17:32460790-32460812 TGGGAATAGCAAGCTGAAGATGG - Intronic
1147330494 17:39696334-39696356 AGGGTGGAGCAAGCTGGAGAGGG - Intronic
1148153908 17:45411929-45411951 AGGGAGGAGCTGGGTGGAGAGGG + Intronic
1148459880 17:47833370-47833392 AGGAAGAAGGAGGAGGAAGAAGG - Intronic
1148953843 17:51337264-51337286 GGGGACAAACAGGCAGAAGAAGG + Intergenic
1149138168 17:53395525-53395547 AAGTATCAGCAGGCTGAAGATGG - Intergenic
1149140594 17:53428548-53428570 AGGAAGAAGCTTGCTGAAGGAGG + Intergenic
1149387557 17:56156966-56156988 AGGGAGAAGAATGGTGTAGATGG - Intronic
1149633706 17:58148898-58148920 TGAGAGAAGCAGGCAGGAGAAGG - Intergenic
1150578608 17:66452418-66452440 GGGAAGAAGCAGGGTGAGGAGGG + Intronic
1150599204 17:66636026-66636048 AGGCAGGAGAAGGCAGAAGAGGG - Intronic
1151174458 17:72275658-72275680 AGGATGAAGCAGGTGGAAGAGGG - Intergenic
1151470189 17:74313271-74313293 AGGGGGAGGGAGGCAGAAGAGGG - Intronic
1152208057 17:78986768-78986790 GGGGAAAAGCAGGCTGGAGGGGG + Intergenic
1153169576 18:2300629-2300651 AGGGAGAATAAGGCTGAAATTGG + Intergenic
1153557725 18:6333617-6333639 ATGGAGAAGCAGGATGCAGGTGG + Intronic
1153914499 18:9733737-9733759 ACGGAGAGGCTGGCTGCAGAAGG - Intronic
1154056327 18:11016048-11016070 AGGAAGAATGAGGCTGAAGGAGG - Intronic
1154096700 18:11423531-11423553 AGGGATTAGAAGGCAGAAGATGG - Intergenic
1155868327 18:30994242-30994264 AGTGAAAAGCAGGAAGAAGATGG - Exonic
1155985630 18:32227813-32227835 AGGAAGGAGGAGGATGAAGAGGG + Intronic
1156012858 18:32514028-32514050 GGGAAGAAGCAGGGTGAAAATGG - Intergenic
1156241383 18:35257894-35257916 AGAGAGAAGCAGGATTAGGAAGG - Intronic
1157687868 18:49657361-49657383 AGGCAGCAGCAGGGTGAGGATGG - Intergenic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1158125989 18:54100163-54100185 TGGGAGAAGGAAGCAGAAGAAGG + Intergenic
1158133179 18:54175598-54175620 AGGGGGAAGCAGTGTGAATAAGG - Intronic
1158186713 18:54779913-54779935 AGGGAGAAGCAGTCAGGAGACGG - Intronic
1158186747 18:54780049-54780071 AGGGAGAAGCTGTCAGGAGAGGG - Intronic
1158186781 18:54780186-54780208 AGGGGGAAGCAGTCAGGAGAGGG - Intronic
1158775961 18:60580315-60580337 AGGTGGGAACAGGCTGAAGATGG - Intergenic
1159174431 18:64814868-64814890 AGGGAAGTGCAGACTGAAGATGG - Intergenic
1159360830 18:67400425-67400447 AGGTAGCAGCAGGATGATGAGGG - Intergenic
1159766657 18:72499396-72499418 AGGCAGAAGCAGCCAGAAAATGG + Intergenic
1159880986 18:73858336-73858358 TTGGAGAAGGAGGCAGAAGATGG - Intergenic
1160007179 18:75076037-75076059 AGGGAGGAGGAGGAGGAAGAGGG + Intergenic
1160092772 18:75842557-75842579 AGAAAAAAGCAGGCGGAAGAAGG + Intergenic
1160178501 18:76614784-76614806 AGGCAGAAGCAGTCTTAAAAAGG + Intergenic
1160308216 18:77761095-77761117 AAGGAGAAGCAGGCTGCAGCAGG - Intergenic
1160486805 18:79300486-79300508 AGGGAGGTGCAGGCTGTTGAGGG + Intronic
1160629853 18:80239201-80239223 TGGGAGCAGCAGGGAGAAGAGGG + Intronic
1160760393 19:781260-781282 AGGAAAAAGCAGGATGAAGCGGG - Intergenic
1160925352 19:1542229-1542251 AGGGAGAAGAAGGAAGAAGAAGG - Intergenic
1161166289 19:2789574-2789596 TGGAAGAAGCAGACAGAAGAAGG + Intronic
1161232026 19:3179187-3179209 AGTGAAGAGCAGGCTGAAGGTGG - Exonic
1161448909 19:4333715-4333737 CCGGAGAATCAGGCTGAAGTGGG + Exonic
1161934343 19:7362297-7362319 AAGGAGAAGGAGGAAGAAGAAGG + Intronic
1162026682 19:7898313-7898335 GGGAAAAAGCAGGCTGAAGGTGG - Intronic
1162031222 19:7918029-7918051 AGGGAGAGGCGAGCTGCAGAAGG - Intronic
1162081461 19:8220291-8220313 AGAGAGAGGGAGGCTGAAGGTGG - Intronic
1162403902 19:10462076-10462098 TGGGAGAAAGAGGCTGAGGAAGG - Intronic
1162916477 19:13877062-13877084 AGGGAGGAGCAGGCTGTGGGAGG - Intronic
1162930026 19:13952938-13952960 AGGGAGAATCAGGAGGAAGGGGG + Intronic
1162988671 19:14288348-14288370 CGGGAGAGGCAGGCTGAGCAGGG + Intergenic
1163160885 19:15463679-15463701 AGTAGGAGGCAGGCTGAAGATGG + Intronic
1163779166 19:19237197-19237219 AAGGAAAAGTAGGCTGAGGATGG - Intronic
1164537991 19:29100658-29100680 AGGGAGAAGCTGAGAGAAGATGG - Intergenic
1164718639 19:30415046-30415068 AAGCAGAAGCAGGAAGAAGAAGG - Intronic
1164906821 19:31974621-31974643 AGCCAGCAGCAGGCTGGAGATGG - Intergenic
1165351957 19:35280381-35280403 AGGGTGCTGCAGGCTGAAGCAGG - Intergenic
1165468752 19:35990732-35990754 AGGGAAAAGAAGGAAGAAGAAGG + Intergenic
1165468777 19:35990869-35990891 AGGAAGAAGGAGGAAGAAGAAGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166213896 19:41323654-41323676 AGGGAGAGGAAGGCGGAGGAAGG - Exonic
1166631354 19:44410457-44410479 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1166798812 19:45443780-45443802 AGGGAGAAGGAGGCTAAACCGGG - Intronic
1166895843 19:46021607-46021629 CGGCTGAAGCAGGCTGAAGCAGG - Intronic
1166978727 19:46620569-46620591 ATGGAGAAGCTGGCAGATGAAGG - Exonic
1167148273 19:47695107-47695129 AGGGAGACGGGGCCTGAAGATGG + Intronic
1167433060 19:49464307-49464329 AGGGAGAAGGGAGATGAAGATGG - Intronic
1167640944 19:50681064-50681086 GGGAAGATGCAGGGTGAAGAGGG + Intronic
1167698281 19:51027398-51027420 AGGGAGAAGCGGGCAGGGGAAGG - Intronic
1168307670 19:55444196-55444218 AGGGAGATACAGGCTGAGAAAGG + Intergenic
1168677507 19:58289667-58289689 AGAGTGAAGCACTCTGAAGATGG - Intronic
1202648894 1_KI270706v1_random:163157-163179 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1202649372 1_KI270706v1_random:166431-166453 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
925148612 2:1599801-1599823 AGGGAGCAGCAGGAAGAGGAGGG - Intergenic
925289815 2:2740001-2740023 AGAGAGAAGGAGGCTGATGGAGG + Intergenic
925289974 2:2740858-2740880 AGTGAGGAGGAGGCTGATGAAGG + Intergenic
925957051 2:8977040-8977062 AGGGAGAGGCAGGAGGGAGACGG + Intronic
926366477 2:12138434-12138456 ATGGAGAAGTAGGCTTCAGAAGG - Intergenic
926846803 2:17150019-17150041 AGGGAGAAGCAGAGGGAAGCGGG + Intergenic
926874392 2:17458518-17458540 AGGAAGAAGCATTATGAAGATGG + Intergenic
927028581 2:19096406-19096428 AGGAAGAAGAAGGTGGAAGAAGG + Intergenic
928215071 2:29354555-29354577 ATTGAGAAGAAGGATGAAGAAGG - Intronic
928541227 2:32285425-32285447 AGGGATAAAAAGACTGAAGAAGG - Intronic
929998653 2:46846417-46846439 AGGGAGAAGCAGGCATAAGAGGG + Intronic
930411567 2:51031923-51031945 GGGGCGAGGCAAGCTGAAGAAGG - Intronic
930818534 2:55622463-55622485 AGGCAGAAGCAGGATGAAAAGGG - Intergenic
931056860 2:58482126-58482148 AGGAAGAAGCAGACCAAAGAAGG - Intergenic
931707889 2:64962600-64962622 AAGAAGAAGCAGGCAGCAGAAGG - Intergenic
932101889 2:68908762-68908784 AGGGAGCAGCAGGCAGCACAGGG - Intergenic
932746325 2:74336819-74336841 GGGGAGTATCAGGCTGGAGAAGG - Intronic
932803283 2:74761767-74761789 AGGAAGAATCAGTCTGAAGCAGG + Intergenic
933272699 2:80250431-80250453 GAAGAGAAGCAGGCTGAGGATGG + Intronic
933669263 2:84991265-84991287 AGGGAGAAGCATTTTGGAGATGG + Intronic
933855709 2:86412257-86412279 AGGGAGAAGAAGGAAGAAGGAGG - Intergenic
935129444 2:100250450-100250472 AGAGAGAAAGAGGCTGAAGGAGG - Intergenic
935672735 2:105569849-105569871 AGTGAGGAGCAGGATGCAGAAGG + Intergenic
936022464 2:109005366-109005388 AGGGAGATCCAGGCTGTGGAAGG - Intergenic
936055739 2:109260671-109260693 TGGGAGAAGCGGCCTGCAGAGGG + Intronic
936447025 2:112604218-112604240 AGGGAGAAGAGGCCTGAAGTAGG + Intergenic
936482255 2:112894512-112894534 TGGAAGAAGCTGGCTGAAGGGGG - Intergenic
936495577 2:113017794-113017816 AGGGAGAAGGAGGGAGAAGGAGG + Intergenic
936502959 2:113080972-113080994 AGGGAGAGGCATGTGGAAGAAGG - Intergenic
936607698 2:113974696-113974718 AGGGAAAGGAAGGCTGAAGTTGG - Intergenic
936731294 2:115384457-115384479 AGGAAGAAGAAGGAAGAAGAAGG + Intronic
937217302 2:120321079-120321101 AGGGAGAAGGAGGAGGGAGAAGG - Intergenic
937217306 2:120321092-120321114 AGGGAGAAGGAGGAGGGAGAAGG - Intergenic
937217315 2:120321121-120321143 AGGGAGAAGGAGGAGGGAGAAGG - Intergenic
937217392 2:120321339-120321361 AGGGAGAAGAAGGAGGGAGAAGG - Intergenic
937453908 2:122025122-122025144 AAGGAGAAGAAGGTGGAAGATGG + Intergenic
937483510 2:122289458-122289480 AGAGAGAGGCAGGGAGAAGAGGG - Intergenic
937650660 2:124315457-124315479 AGGTAGAAGCAAGCAGAACAAGG + Intronic
937874070 2:126807522-126807544 GGGGAGAGGCATGCTGAAAAGGG - Intergenic
938371070 2:130768612-130768634 AGGGAAAAACAGGCTGAGGGTGG - Intergenic
938541628 2:132288041-132288063 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
940011534 2:149060019-149060041 AGGGAGAAGGAGGAGGAGGAGGG + Intronic
940207778 2:151223154-151223176 TAGGAAAAGCAGGCAGAAGAAGG + Intergenic
940987588 2:160063783-160063805 CGGGGGAAACAGGCTGCAGAGGG + Intergenic
941169041 2:162115681-162115703 AGGCAGCAGAAGGCTGCAGAGGG + Intergenic
941809248 2:169739022-169739044 AGGAAGAAGAAGGCAGAAGGAGG - Intronic
941920987 2:170850524-170850546 AGGTAGAAGCAGACTAAGGAGGG + Intronic
942681066 2:178478951-178478973 AGGGAGAGGCATGCTGGAAAAGG + Intergenic
943366209 2:186969859-186969881 AAGGAGAAACAAGCTGAAGAAGG + Intergenic
944064703 2:195606631-195606653 ATGGAGAAGCAGGAACAAGAAGG + Intronic
944269487 2:197765176-197765198 AGGGAGAAGGAGTAGGAAGAGGG + Intronic
945197961 2:207255094-207255116 AGGGAGAAGTGGGCAGAACATGG + Intergenic
945675929 2:212855663-212855685 TGGGAGAAGGTGGCTGAAGGAGG - Intergenic
945839345 2:214869192-214869214 AGGGAGAAGCAGGCAAGAGGAGG + Intergenic
945911373 2:215653630-215653652 AGAGAGAAGCAGGGAGAAGGAGG + Intergenic
946679901 2:222202406-222202428 AGGGAGAAGAGGGGAGAAGAGGG + Intronic
946687399 2:222284200-222284222 ACAATGAAGCAGGCTGAAGAGGG + Intronic
946809119 2:223504188-223504210 AGCAAGAAGAAGGCTGAAGAAGG + Intergenic
947023594 2:225711688-225711710 AGGAAGACGCATGCTGGAGATGG + Intergenic
947324095 2:228955824-228955846 AGAGAAAAGGAGGCTGAGGATGG + Intronic
947405283 2:229769757-229769779 TGGGAGAAGCAAGCTGAACTAGG + Intronic
947535792 2:230939861-230939883 AGGGGCAAGCAGGCTGCAGCGGG + Intronic
947536289 2:230942280-230942302 CAGGAGAAGGAGGCAGAAGAAGG - Intronic
948260282 2:236599253-236599275 AGAGAGAAGCAGGCTGCAGTTGG - Intergenic
948513627 2:238489246-238489268 AGAGAGGAGGAGGCAGAAGATGG - Intergenic
948732448 2:239975665-239975687 AGAGAGACTGAGGCTGAAGAGGG - Intronic
948869805 2:240792209-240792231 TGTGAGAAGCAGGCTGCTGAAGG - Intronic
948983125 2:241505179-241505201 GAGGAGGAGCAGGCAGAAGAGGG - Intronic
1168862206 20:1053687-1053709 AGGAGGAAACAGGCTGAGGAGGG - Intergenic
1169301597 20:4446251-4446273 GGTGGGAAGCAGGCTGAAGAGGG - Intergenic
1169825629 20:9765654-9765676 AGGGAGAAGCAGGGAGAGGGCGG - Intronic
1170959984 20:21016647-21016669 AGAGAAAAGCAGGCTGCAGATGG + Intergenic
1171047403 20:21823397-21823419 TGGAAGCAGCATGCTGAAGATGG - Intergenic
1172005413 20:31815991-31816013 AGGGAGCAGCTGGCTGGAGCAGG + Intergenic
1172107869 20:32527529-32527551 AAGGAAAAGCAGGTTGAAGGGGG - Intronic
1173169113 20:40708653-40708675 AGGATGTGGCAGGCTGAAGAAGG + Intergenic
1173530285 20:43764074-43764096 AGGAAGAAGCAGGCACAAAAGGG + Intergenic
1174052089 20:47773997-47774019 AGGGGCAAGCTGGCTGAGGACGG - Intronic
1174183116 20:48687312-48687334 CGGGAGGAGCAGGCTGCAGGGGG - Intronic
1174871441 20:54186325-54186347 AGGGTGATGGAGGCTCAAGAGGG + Intergenic
1174996439 20:55574131-55574153 AGGGAAAAGCAGGTTGTAAAAGG + Intergenic
1175243414 20:57566606-57566628 AGGGAGAAGGAGGGAGCAGATGG + Exonic
1175499083 20:59436781-59436803 AGGGAGAGGCAGGGTCAGGAAGG + Intergenic
1175598314 20:60253148-60253170 AGAAAGAAGCTGGCTGGAGAAGG - Intergenic
1175800539 20:61798699-61798721 AGGAAGAAGCAGGCTGTCCAGGG - Intronic
1176044015 20:63083137-63083159 ACTGTGAAGCAGGCTGGAGAGGG + Intergenic
1176602449 21:8806115-8806137 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1176602928 21:8809384-8809406 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1176611894 21:8991218-8991240 AGGGAGAAGCTGGCTGAGGCAGG - Intergenic
1178097177 21:29228556-29228578 ACGGATAAGAAGGCTGAAGGAGG - Intronic
1178194928 21:30333790-30333812 AAAGAGAAGCTAGCTGAAGAAGG - Intergenic
1178226262 21:30722729-30722751 AGGGAAGAGTAGGCAGAAGAAGG - Intergenic
1178553091 21:33558631-33558653 TGGGACAAGAAGGCTGAAGATGG - Intronic
1178604749 21:34025960-34025982 AGGGAGACTCAGACTGGAGAGGG + Intergenic
1178619039 21:34158403-34158425 CGGGAGAAGGTGGCTGAAGTGGG + Intergenic
1178643204 21:34363351-34363373 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1178643205 21:34363361-34363383 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1178643206 21:34363371-34363393 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1178747171 21:35264208-35264230 TGGAAGAAGAAGGCTGAAGAGGG - Intronic
1179448124 21:41447845-41447867 AGGGAGGTGGAGGCTGAAGCAGG - Intronic
1179468747 21:41596641-41596663 AGGGAGAGGCCGTTTGAAGATGG + Intergenic
1179536795 21:42058157-42058179 AGGAAGCAGCAGGCAGAAGAGGG - Intergenic
1179547390 21:42121994-42122016 AGCGAGAAGCAGGCTGCCCAGGG + Intronic
1179611476 21:42554660-42554682 AGGGAGAAGCAGGTAACAGAAGG + Intronic
1180344734 22:11697668-11697690 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180345214 22:11700941-11700963 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180352557 22:11816662-11816684 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180352994 22:11819182-11819204 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180385698 22:12175695-12175717 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1181100509 22:20535847-20535869 AGAAAGAAGCAGGCTGAGCACGG - Intronic
1181423035 22:22815007-22815029 AATGAGAGGCAGGCTGAAGTGGG - Intronic
1181492493 22:23269245-23269267 AGGCAGACACAGGCTGGAGAAGG - Intronic
1181533882 22:23531971-23531993 GGGGAGATGCAGGCAGCAGAGGG + Intergenic
1182003613 22:26941027-26941049 AAGGAGAAGCAGGTTGAAAGAGG + Intergenic
1182102967 22:27670686-27670708 AGAAAGAAGCAGGCTGGGGAAGG - Intergenic
1182502196 22:30755791-30755813 AGGGAGGGGAACGCTGAAGAGGG - Intronic
1182551413 22:31102777-31102799 AGGGAGCACCAGGTTGGAGAGGG + Intronic
1182593330 22:31399171-31399193 GGGGTGAGGCAGGCTGAAGATGG + Intergenic
1183013760 22:34969314-34969336 AGGGACAGGAAGGCAGAAGATGG + Intergenic
1183425783 22:37738761-37738783 AGGGGGAAGCAGGTTGGAGATGG + Intronic
1183597360 22:38820727-38820749 AGGGGGAAGAACACTGAAGAGGG + Exonic
1183708028 22:39487075-39487097 GCGGAGAAGCAGGCTGCAGAGGG + Intronic
1183827191 22:40397740-40397762 AGGGAGAAGCAGCCCCAAGTTGG - Intronic
1184323064 22:43757752-43757774 AAAGGGAAGCAGGCTGAAGCAGG - Intronic
1184345971 22:43913229-43913251 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1184653640 22:45930638-45930660 AGGCAGGAGCAGCCTGAGGAAGG - Intronic
1184723648 22:46330407-46330429 AAGGAGATGCAGGCTGCAGTGGG + Exonic
1184952454 22:47853645-47853667 AGGAAGAAGAAGGAAGAAGAAGG + Intergenic
949204642 3:1423501-1423523 AGGGAGAGGCAGACTGATGCAGG - Intergenic
949246273 3:1928363-1928385 AGGGAGAAAGAGGATGAATAGGG + Intergenic
949465387 3:4338161-4338183 AAGGTGAAGCAGGCGGAGGATGG + Intronic
949644174 3:6074108-6074130 AGGGAGAAGCAAGCTAGAGAGGG + Intergenic
949654967 3:6207265-6207287 CTGGAGAAGCATGGTGAAGATGG - Intergenic
950548401 3:13652585-13652607 AGGGAGGAGCAGGCTGGGGGTGG + Intergenic
950769945 3:15303314-15303336 AAGCCGAAGCAGGCTGAGGAAGG + Intronic
951033822 3:17911101-17911123 AGGAAGAAGCAAGAGGAAGAAGG - Intronic
952135972 3:30420092-30420114 AGAGAGAAGTAGGGTGATGATGG + Intergenic
952308241 3:32164174-32164196 AGGGAGAAGCAGGTTGGAAATGG + Intronic
953678381 3:45021073-45021095 ATGGAGAACCACGCTGAGGAGGG - Intronic
953827402 3:46265769-46265791 AGGGAGAACGAGACAGAAGATGG - Exonic
953881729 3:46694412-46694434 AGGGGGAATCAGGCTGCTGACGG - Intergenic
953916138 3:46922328-46922350 AGGGAGAAGCAGGAAGGTGAAGG + Intronic
954580519 3:51700652-51700674 AGGGGGAGGCAGGCAGCAGAGGG - Intronic
954986508 3:54798754-54798776 AGCGAGCAGCAGCCTGCAGAGGG + Intronic
955114318 3:55982074-55982096 AAGGAGAGGCTGGCTGGAGAGGG + Intronic
955930865 3:64055531-64055553 AGGGAAAAACAGGATGAATAGGG - Intergenic
956106425 3:65823531-65823553 CAGGAGAAGCAGGCTGTGGAAGG - Intronic
956681295 3:71784685-71784707 AGGGAGAAGTAAGCGGGAGAAGG + Intronic
956784427 3:72630576-72630598 GGGGAGAAGCAGAAGGAAGAAGG + Intergenic
957261392 3:77906519-77906541 ATGGAGAAGGAGGCTGAAGAAGG + Intergenic
957724854 3:84050645-84050667 AGTGAGAACCTGGCTGAAAAGGG + Intergenic
957729634 3:84117097-84117119 AGAGAGAATAAGGATGAAGAAGG - Intergenic
958694434 3:97510169-97510191 AGGCAGAAGCAGGCTTCAGAAGG - Intronic
959071168 3:101703433-101703455 AGGACAAAGCAGGCAGAAGAAGG + Intergenic
959239768 3:103775509-103775531 AGGAAGAAGGAGGATGTAGAAGG - Intergenic
960148384 3:114227300-114227322 GGGGAGAAGAGGGTTGAAGAGGG + Intergenic
960427825 3:117530790-117530812 AAGGAGAAGAAAGATGAAGAGGG - Intergenic
960885052 3:122384691-122384713 AGGAAGGAGCAGGGGGAAGAGGG - Intronic
960960750 3:123068427-123068449 GGGGAGAACCAGGCTGGAGTGGG + Intronic
961493909 3:127276662-127276684 AGAGGAATGCAGGCTGAAGATGG - Intergenic
961670462 3:128524566-128524588 AGGGAGAAGTGGGCTGAGCACGG + Intergenic
962430649 3:135316108-135316130 AGGGATAAGGAGGTTGGAGATGG - Intergenic
962431493 3:135324524-135324546 GGGGAGAAACAGGGTGGAGAAGG + Intergenic
962912347 3:139864385-139864407 AGGGAGAAGAAGGCCAAAAATGG + Intergenic
963049263 3:141127714-141127736 ATGGAGACACAGGCTGGAGAAGG + Intronic
964089488 3:152857580-152857602 AGGGAAAATCAGGCAGAAGAAGG - Intergenic
964447139 3:156771353-156771375 AGAGAAAAGCAGGCAGCAGAAGG - Intergenic
965000624 3:162948000-162948022 AAGGCAAAGCAGGCAGAAGAAGG - Intergenic
965711734 3:171562693-171562715 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
965711735 3:171562703-171562725 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
966806495 3:183811663-183811685 AGGGAGTGGCAGGCAGGAGAAGG + Exonic
966874931 3:184316122-184316144 GGGGAAACGCTGGCTGAAGAGGG - Exonic
967257762 3:187610712-187610734 AGGGAGAAAAATGGTGAAGATGG - Intergenic
968176582 3:196555316-196555338 AAGGAGAAGCGGGCTGAAATAGG - Intronic
968276935 3:197447177-197447199 AGACAGAAGCCTGCTGAAGAAGG + Intergenic
969595548 4:8147576-8147598 GGGGAGAAGTAGCATGAAGATGG + Intronic
969846480 4:9923972-9923994 AGGGAGGAGCAAGCCGAGGAGGG + Intronic
970016139 4:11514876-11514898 AGTGGGAAGCAGGTTGAACAGGG - Intergenic
970287347 4:14532624-14532646 AGTGAAGAGCAGGTTGAAGAGGG + Intergenic
970353340 4:15228124-15228146 TAGGAAAAGCAGGCAGAAGAAGG - Intergenic
970633394 4:17979788-17979810 AGGGGGAAACAGGCTGCAGATGG + Intronic
970798616 4:19945672-19945694 AGGCATAAGCAGGCAGGAGAGGG + Intergenic
970837315 4:20425878-20425900 AGGGAGAGGCAGGCAGAGAAAGG - Intronic
971001950 4:22333144-22333166 AAGGAGAAGCAGGCAGGAGCTGG - Intergenic
971009635 4:22419045-22419067 AGTCCGAAGCAGGCTGAGGAGGG + Intronic
971102541 4:23483851-23483873 AGAGAAAAGAAGGCTGAATAAGG + Intergenic
971146002 4:23976972-23976994 AGGAAGAAGGAGGAGGAAGAGGG + Intergenic
971945533 4:33271385-33271407 AGGAAGAAGCAGCGTGAAGTGGG + Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972723780 4:41727765-41727787 AGGGAGCTGCATGCTGAAGATGG - Intergenic
973053161 4:45620032-45620054 GAGGAGGAGCAGGCTGAATATGG - Intergenic
973375099 4:49280976-49280998 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973375998 4:49286998-49287020 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973376923 4:49293161-49293183 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973377843 4:49299316-49299338 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973378787 4:49305596-49305618 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973379431 4:49310058-49310080 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973380304 4:49316054-49316076 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973381227 4:49322220-49322242 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973382312 4:49329265-49329287 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973385851 4:49513877-49513899 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973637218 4:52871372-52871394 AAGGAGCAGCAGGCAGAAAAGGG - Intergenic
973781025 4:54288309-54288331 AGGGAGAACTAGGATGAAAAAGG - Intronic
973980618 4:56305581-56305603 GGGGAGGAGAAGGCTGAAAAGGG - Intronic
974617456 4:64307594-64307616 AGGGGAGTGCAGGCTGAAGATGG - Intronic
976714806 4:88112419-88112441 AGAGAGAAGTAGGGAGAAGAAGG - Intronic
977927059 4:102713298-102713320 AGGGAAATGAAGGATGAAGATGG - Intronic
978235815 4:106458543-106458565 AGGAAGAAGAAGGAGGAAGAAGG + Intergenic
978264777 4:106810417-106810439 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
978431630 4:108639308-108639330 AGAGAGAAGAAAGCTGAAGATGG - Intergenic
978632892 4:110767454-110767476 AGGGAGGAGGAGGCTGGACAGGG + Intergenic
978831331 4:113088857-113088879 AGGGAGGAGCAGTGTGAAAAGGG - Intronic
978855306 4:113387590-113387612 GGGGAAAAGCAGGCTGGAGGAGG + Intergenic
980725763 4:136758330-136758352 AGGGAGAAACAGGTTAGAGAGGG + Intergenic
980910789 4:138992510-138992532 AGGGAGGAGGAGGAGGAAGAAGG + Intergenic
981039660 4:140211479-140211501 AGGGACCAGCAGGCAAAAGAAGG - Intergenic
981220341 4:142225130-142225152 TGGAAAAAGCAGGCAGAAGAAGG + Intronic
982226244 4:153170127-153170149 AAGGAGAAGGAGGAGGAAGAGGG + Intronic
982263306 4:153515100-153515122 AGGGTGAAGTAGGCTGAGCACGG - Intronic
982296715 4:153836545-153836567 AGGAAGAAGCAGGCTTCAGAGGG - Intergenic
985040030 4:185880888-185880910 AGGCATAAGCAGGATGAAAATGG + Intronic
985305985 4:188540739-188540761 AGGAAGAAGCAGGCTGACAGTGG - Intergenic
985995420 5:3594854-3594876 GGGGAGACGCAGGGAGAAGAGGG + Intergenic
986065283 5:4229095-4229117 AGGAAGAAGCAGGCTGCACAGGG + Intergenic
986122907 5:4858547-4858569 CGAGAGATTCAGGCTGAAGATGG + Intergenic
986450803 5:7862573-7862595 AGGAAGAAGCAAGCAGAAAAAGG + Intronic
986547315 5:8912505-8912527 TAGGAAAAGCAGGCAGAAGAAGG - Intergenic
987188071 5:15445305-15445327 AGCGAGGAGGATGCTGAAGATGG + Intergenic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
988985122 5:36610858-36610880 AGGCAGAAGCAGCAAGAAGAAGG + Intronic
989135050 5:38145422-38145444 AGAGAGAGGCAGGGTGAAGATGG - Intergenic
989187471 5:38638985-38639007 AGGCATGAGCAGGCAGAAGAGGG - Intergenic
989336742 5:40326449-40326471 AGTGAGAACCTGGCTGAAAAGGG - Intergenic
989668928 5:43891039-43891061 AAGGAAAACAAGGCTGAAGAGGG + Intergenic
989973599 5:50555054-50555076 AGGGAGAAGAGGACTGTAGAAGG - Intergenic
990994491 5:61717906-61717928 AAGGAGAAGCAGGTGGAAGGTGG - Intronic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
992837542 5:80655071-80655093 AGGAAGGGGCGGGCTGAAGAAGG + Intronic
993001484 5:82385704-82385726 AGAGAGAAGCAGAGAGAAGAGGG - Intronic
994212041 5:97097980-97098002 AGGCAGAAAAGGGCTGAAGAAGG - Intronic
994681149 5:102889145-102889167 AGCGTGGAGCAGGCTGAAGAAGG - Intronic
995486087 5:112641342-112641364 AGGGTGAATGAGGCTGGAGATGG + Intergenic
996268746 5:121577024-121577046 AGGGAGATGCAGGCTGCAGTGGG + Intergenic
996550505 5:124725234-124725256 AGGGAGAATCAAGCAGGAGAAGG - Intronic
996590895 5:125146931-125146953 AGGGAGAAGCAGGGAGAAGCAGG - Intergenic
996590897 5:125146941-125146963 AGGAAGAAGCAGGGAGAAGCAGG - Intergenic
997418529 5:133748226-133748248 AGGGAGCAGTTGGTTGAAGAAGG - Intergenic
997444124 5:133928902-133928924 AGGGAGCAGCTGGCTGAGGGAGG - Intergenic
997476006 5:134142925-134142947 AGGCTGCACCAGGCTGAAGATGG - Intronic
997632265 5:135377837-135377859 TGGGAGAAGCAGGATTAAGCAGG - Intronic
997675867 5:135712827-135712849 AGGGAAACGGAGTCTGAAGAAGG - Intergenic
998141794 5:139704026-139704048 AGGTAGATGCAGACTGGAGAGGG - Intergenic
998410465 5:141906712-141906734 AGGAAGAAGAAGGAAGAAGAAGG + Intergenic
998520803 5:142798755-142798777 AAGGAGAAGCATGGGGAAGAGGG - Intronic
1000185835 5:158857068-158857090 AGAGAGTAGGAGGCGGAAGATGG - Intronic
1000328351 5:160188639-160188661 AGGGAGAAGCCGGCCAAAGTCGG - Intronic
1000941176 5:167361989-167362011 AGGCAGAAGCTGGCTCAATAAGG - Intronic
1001016189 5:168143445-168143467 AGGCATAAGCAGGCAGAAGTGGG + Intronic
1001137762 5:169116718-169116740 AGGGAGAAACAGGCTAATCAGGG + Intronic
1001405571 5:171474729-171474751 AGGGAGGGACAGGCTGGAGAAGG - Intergenic
1001601952 5:172934723-172934745 AGGGAGTCGCAGTCTGCAGAAGG - Intronic
1002319689 5:178367626-178367648 AAGGACGAGCAGGCTGCAGAGGG + Intronic
1002414131 5:179109955-179109977 AGGGAGAAGCAGGGGTAGGAAGG - Intergenic
1002521557 5:179795574-179795596 AGGGAGAAGTAGGCTGGGGGAGG - Exonic
1004431254 6:15546019-15546041 AGGGTGGAGCTGGCTGAATATGG + Intronic
1005925919 6:30445507-30445529 AGGGAGACACAACCTGAAGAAGG + Intergenic
1006360518 6:33584605-33584627 TGGGAGAGGAAGGCTGCAGAGGG + Intergenic
1006709136 6:36050278-36050300 AGGGAGATGAAGACAGAAGAGGG + Intronic
1006797434 6:36740889-36740911 AAGCAGAGGCAGGCGGAAGACGG + Exonic
1007041055 6:38722810-38722832 ATGGAGAAGGATGCTGAAGATGG + Exonic
1007263032 6:40577011-40577033 AGGGAGAACCAGACTGGAGGAGG - Intronic
1007358101 6:41335421-41335443 AGGGAAAGGCAGGCTGAGGGTGG - Intergenic
1007431298 6:41779035-41779057 AGGAAGAAGCAGGCTCAGGGAGG + Intronic
1007452609 6:41951603-41951625 AGAGAGAAGCAGGAAGAAGAGGG + Intronic
1007625618 6:43244592-43244614 AGAGAGAAGGAGGGTGGAGAGGG + Intronic
1009167860 6:60362105-60362127 AGGGAAACTCAGGCTCAAGATGG - Intergenic
1009657672 6:66567703-66567725 AGCGAAGTGCAGGCTGAAGATGG + Intergenic
1009850609 6:69193231-69193253 AGGCAGGAGCTGGCAGAAGATGG - Intronic
1010194994 6:73230311-73230333 TGGGAGATGGAGGCTGTAGAGGG - Intronic
1010252745 6:73725107-73725129 AGGCATAAGCAGGCAGAAGTGGG + Intronic
1010448951 6:75980538-75980560 AGGATAAAGCAGGCAGAAGAAGG + Intronic
1010766513 6:79781809-79781831 TGGGAGAAGAAGGGTGAAGGAGG + Intergenic
1013036301 6:106387330-106387352 AGGGAAAAGGAAGCTGAGGAAGG + Intergenic
1013841400 6:114399117-114399139 AGGGAGAAGAAGGAGGAAGAAGG - Intergenic
1014044330 6:116866997-116867019 AAGGAGGAGCAGGTTGAAGAAGG - Intergenic
1014225432 6:118841354-118841376 AGAGAGAGGCAGGGAGAAGAGGG - Intronic
1015638297 6:135302761-135302783 AGGCAGAAGCAGGGGGAAGAAGG + Intronic
1015659451 6:135558726-135558748 ACGGAAAAGCATGTTGAAGATGG + Intergenic
1015666524 6:135636118-135636140 AGGGAGAAGAAGAAGGAAGAAGG - Intergenic
1016987062 6:149903595-149903617 AGGAAGAGGCAGACGGAAGAGGG + Intergenic
1017098548 6:150826927-150826949 AGAGAGAATCAGGCTGGACACGG - Intronic
1017330525 6:153193199-153193221 AGGGTAAAGCAGGCAGAAGAAGG + Intergenic
1017375076 6:153759735-153759757 AGTGAAAAGCAGGCTGTAGCAGG + Intergenic
1017819808 6:158041144-158041166 AGGGAAACTGAGGCTGAAGATGG + Intronic
1018907071 6:168081705-168081727 AGGGAGAAGCTGGATGCAAAAGG + Intergenic
1019192321 6:170259461-170259483 AGGATGACGCAGGCTGCAGATGG + Intergenic
1019351812 7:557558-557580 AGGGAGAAACAGGATGGACATGG + Intronic
1019841509 7:3450808-3450830 AGAGAGAAGAGGGATGAAGATGG + Intronic
1020011459 7:4807889-4807911 AGGGAGAAGAAGAGGGAAGAGGG - Intronic
1020204219 7:6103093-6103115 AGGGAGAAGCAGGCTCATGGTGG + Intergenic
1020372202 7:7444469-7444491 AGGGAGAGCCAGGCTCAATAGGG - Exonic
1020932343 7:14413582-14413604 AAGGAGAAGAAGCCTGAAGCGGG + Intronic
1021081869 7:16374204-16374226 AGAACGAAGCAGGCAGAAGAAGG + Intronic
1021239926 7:18187850-18187872 AGGAAGAAGCACACTGAAGAAGG - Intronic
1021423650 7:20473885-20473907 AAGATGAGGCAGGCTGAAGAGGG + Intergenic
1022336021 7:29423007-29423029 AGTCAAAAGCAGCCTGAAGAAGG - Intronic
1022448075 7:30486147-30486169 TGGAAGAAGGAGGCAGAAGAGGG + Intergenic
1022684012 7:32577793-32577815 ATTGAAAAGAAGGCTGAAGAAGG + Intronic
1023385143 7:39649145-39649167 AGAGAGAAGCAGGTTGGAGTAGG + Intronic
1023935447 7:44736823-44736845 AGGGAGATTGAGGCTGCAGAGGG + Intergenic
1024291434 7:47807412-47807434 GGGGAGAAGGGGCCTGAAGATGG + Intronic
1024678983 7:51663762-51663784 AGGGAAAGGCAGGGGGAAGAAGG - Intergenic
1024849648 7:53696463-53696485 AGGGAGAAGCTGGGAGAGGAGGG + Intergenic
1026590986 7:71695397-71695419 AGGGAGAAGCCAGCAGAGGAAGG + Intronic
1026679851 7:72457602-72457624 TGGGAGAAGGAGGAGGAAGAGGG - Intergenic
1026735328 7:72945386-72945408 TGGGAGAAGCAGGCTGAGCTGGG + Intronic
1026785668 7:73300316-73300338 TGGGAGAAGCAGGCTGAGCTGGG + Intergenic
1026849707 7:73717200-73717222 AGGGAGGAGGAGGAGGAAGAGGG + Intronic
1027108398 7:75419620-75419642 TGGGAGAAGCAGGCTGAGCTGGG - Intronic
1027442968 7:78240125-78240147 AGGGGGCAGGAGGCTGAAGGAGG - Intronic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1028055360 7:86234000-86234022 AGGGAGCAGGAGGCCAAAGAAGG + Intergenic
1028251790 7:88546126-88546148 AGAGGGGTGCAGGCTGAAGATGG + Intergenic
1028548994 7:92035793-92035815 TGGGAGAAGCAGGCTGTAGTGGG + Intronic
1028921374 7:96314101-96314123 AAGGAGAAGGAGGAGGAAGAAGG + Intronic
1029173607 7:98647920-98647942 AGGGAGAAGGAGGCTGAATCTGG - Intergenic
1029455417 7:100668438-100668460 AGGGGGAAGAAGGAAGAAGATGG + Intergenic
1032548898 7:132766194-132766216 AGGGAGAAGCGGGGTAAACAGGG + Intergenic
1032605491 7:133346319-133346341 ATGGAGAAGCAGACAGAAGCAGG - Intronic
1032848300 7:135770579-135770601 AGCTAGAAGCAGGCAGAGGAAGG + Intergenic
1033958532 7:146882509-146882531 AGAGAAATGCAGGGTGAAGAGGG - Intronic
1034427273 7:151020626-151020648 AGGGAGGAGCAGACTCAAGATGG + Intronic
1034948230 7:155278025-155278047 AGGGAGAAGCAGGCAGACCCTGG - Intergenic
1035731899 8:1859624-1859646 AGGGAGAAGCTGCCGGAGGAGGG - Intronic
1036948207 8:13115368-13115390 AGGGAGTGGCAGGCAGCAGATGG + Intronic
1037891156 8:22624367-22624389 TGGGACAAGCTGGCTGGAGATGG + Intronic
1037923091 8:22821683-22821705 AGGGAGAAAGAGGCTGAGGAGGG + Intronic
1038441623 8:27574622-27574644 AGGGAGAGCTAAGCTGAAGATGG + Intergenic
1038459782 8:27706076-27706098 AGGGAGGGTGAGGCTGAAGAAGG + Intergenic
1039317344 8:36387998-36388020 AAGGAGAAGGAGGAAGAAGAAGG - Intergenic
1039635430 8:39159560-39159582 AGGAAGAAAGAGGCTGAGGAAGG - Intronic
1040568639 8:48589114-48589136 AGGGAGAAGAAGGGTGGTGATGG - Intergenic
1040771364 8:50980360-50980382 AGGTAGATGAAGGCAGAAGAGGG + Intergenic
1040999137 8:53432692-53432714 GGGGAGAAGAACGCTGAACAAGG - Intergenic
1041667020 8:60455730-60455752 AGGAGAAAGCAAGCTGAAGAGGG + Intergenic
1042093646 8:65188024-65188046 GGGGAGAGGAAGACTGAAGAGGG - Intergenic
1042182753 8:66108339-66108361 AGGAAGACGCAGGGAGAAGACGG - Intergenic
1042837416 8:73091191-73091213 AGAGAGAGGCAGGCTGTAGGAGG - Intronic
1043079690 8:75750719-75750741 AAGGAGAAGCAGGCGAAGGATGG - Intergenic
1043438973 8:80260278-80260300 AGGGAAGAGCTGGCTGGAGATGG - Intergenic
1044460988 8:92443690-92443712 AAGGAGGAGCAGGTTGGAGATGG + Intergenic
1044857701 8:96493670-96493692 CCGGAGAAGCAGGCTCAGGAGGG + Exonic
1045000153 8:97871345-97871367 CAGGAAAAGCAGGCCGAAGAGGG + Intronic
1045188987 8:99864963-99864985 AGGGTGAAGCAGAGTCAAGAAGG - Intronic
1045490206 8:102662463-102662485 AGGAAGAAGCAGGCTGAAGGGGG + Intergenic
1046119782 8:109831451-109831473 AGGGCAAAGCAGGCAGAAAAAGG + Intergenic
1046547905 8:115674597-115674619 AGGGAGAAGGAGGGAGAGGAAGG - Intronic
1046719023 8:117597946-117597968 AGGGGGAAACAGGCTGAAAAAGG - Intergenic
1046869826 8:119193488-119193510 AGGGAGAAGCATTTTGAAGCAGG + Intronic
1047126109 8:121962441-121962463 AGTGAGAAGTAGGGTGGAGAGGG - Intergenic
1047248087 8:123161320-123161342 TGGGAGAAGGAGGCAGATGAAGG - Intergenic
1048327679 8:133451690-133451712 ATGGAGTAGCGGGCTGCAGATGG - Intergenic
1048860451 8:138720772-138720794 AGGGAGAACCAGGAGAAAGAGGG - Exonic
1049127787 8:140807990-140808012 TGGTTGAAGCAGGTTGAAGAGGG + Intronic
1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG + Intergenic
1049571160 8:143370887-143370909 AAGGGGGAGCAGGCTGCAGAGGG + Intronic
1049614924 8:143571919-143571941 TGGCAGGAGCAGCCTGAAGATGG + Intronic
1050301009 9:4259028-4259050 AGGCAGCAGCAGGCAGGAGATGG - Intronic
1050663243 9:7906869-7906891 TGGGAGAGGAAGGATGAAGATGG - Intergenic
1051364586 9:16312466-16312488 TGGGGCAAGCAGGCTGAATAAGG - Intergenic
1052406837 9:28072033-28072055 ATGTAGAAGGAGGATGAAGATGG - Intronic
1052563755 9:30119274-30119296 AGGAAGAAAAAGGCAGAAGAAGG + Intergenic
1052865833 9:33464180-33464202 AGGGAGGAGCAGGCTGACCCAGG - Intronic
1053150940 9:35742282-35742304 AGGGAGAGGCCAGCTCAAGAAGG - Intronic
1054789457 9:69242093-69242115 AGGAAGAACTAGGCTGAAGGCGG + Intronic
1055144652 9:72918774-72918796 CGGGAAAAGCAATCTGAAGAGGG - Exonic
1056010737 9:82327441-82327463 TGGCAGAAGCAGGCTTCAGAAGG - Intergenic
1056513353 9:87327100-87327122 AGGAAGAAGAAGGATGAGGAGGG + Intergenic
1056561669 9:87735241-87735263 AGGCTGAAGCAGGCTGCAGCTGG - Intergenic
1056934197 9:90903368-90903390 ATGGATAATCAGGCTGCAGAGGG - Intergenic
1057014963 9:91643149-91643171 TGGGAGGAGGAGGCAGAAGAAGG + Intronic
1057055813 9:91959858-91959880 AGAGAGAAGCAGGCTGGGCACGG - Intergenic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057302504 9:93894958-93894980 AGGGAGAAGCAGGGAGATGCAGG - Intergenic
1057353458 9:94318286-94318308 AGGGAGAAGGTGGCTGAACGGGG - Exonic
1057654293 9:96939306-96939328 AGGGAGAAGGTGGCTGAACGGGG + Exonic
1058563027 9:106249883-106249905 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1058994952 9:110290629-110290651 AGTGAGAAGCAGACAGAAGTGGG - Intergenic
1059160674 9:112032099-112032121 AAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1059177504 9:112180689-112180711 AGGGAGAGGTATGCTGGAGAAGG - Intergenic
1059259398 9:112961500-112961522 TGGGAGAAGCAGGAGGTAGAGGG - Intergenic
1059407270 9:114108926-114108948 AGAGAGATGGAGGCTGAGGAAGG - Intergenic
1059435133 9:114271520-114271542 AGGGAGCAGCAGGGTCAAGTTGG - Intronic
1059651930 9:116323084-116323106 AGGGAGACGGAGGGAGAAGAGGG - Intronic
1060037342 9:120267008-120267030 AGGCAGTAGCAGTCTGAAGGTGG - Intergenic
1060069581 9:120534432-120534454 AGGGAGGAGCAGGATGATAAGGG - Intronic
1060398336 9:123332094-123332116 TGGCAGAAGCAGGTTCAAGATGG + Intergenic
1060732079 9:126045057-126045079 AGGGAGATGCGGGCTGTATAAGG - Intergenic
1060798826 9:126531044-126531066 AGGGTCCAGCAGGCTGAACAGGG + Intergenic
1060865029 9:126988824-126988846 AGGGAGCAGCAGGAAGAACAAGG + Intronic
1061242264 9:129381610-129381632 AGGGGCATGCAGGCTGCAGAGGG - Intergenic
1061246599 9:129403959-129403981 GGGGAGATGCAGGCAGCAGAGGG - Intergenic
1061395951 9:130343410-130343432 AGGGAGAGGCAGGTAGAAGCAGG + Intronic
1061629965 9:131866122-131866144 AGGGAACAGCAGGCTGGGGAGGG - Intronic
1061799111 9:133104477-133104499 AGGGGGAGGCAGGCTCAGGAAGG - Intronic
1061865656 9:133490746-133490768 AAGGAGAAGCAGGGAGAAGAAGG + Intergenic
1062083666 9:134637560-134637582 TGGCAGACACAGGCTGAAGAAGG + Intergenic
1062416790 9:136455234-136455256 TGGGAGAAGCAGGTTACAGAGGG + Intronic
1062638418 9:137503617-137503639 AGGGAGAAGGAGGAGGGAGAAGG + Intronic
1203698817 Un_GL000214v1:119225-119247 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203699773 Un_GL000214v1:125523-125545 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203479507 Un_GL000224v1:113-135 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203480473 Un_GL000224v1:6409-6431 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203481440 Un_GL000224v1:12737-12759 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203482404 Un_GL000224v1:19046-19068 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203548993 Un_KI270743v1:152910-152932 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203549457 Un_KI270743v1:155639-155661 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203550415 Un_KI270743v1:161951-161973 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203569112 Un_KI270744v1:115471-115493 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203570061 Un_KI270744v1:121760-121782 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1185513673 X:682028-682050 AGGGAGAAGGAGACAGAAAAAGG + Intergenic
1185830057 X:3292881-3292903 AGGAAGAAGAAGGAAGAAGAAGG + Intergenic
1186557162 X:10571984-10572006 AGGGAGAAGCTTCCTGAAGGAGG + Intronic
1186946255 X:14571049-14571071 AGGGGGGAGCAGGAAGAAGAGGG + Intronic
1186991981 X:15079921-15079943 TGGGAAAAGCAGGGTAAAGAAGG + Intergenic
1187768343 X:22667827-22667849 AAGGAGGAGCAGGCAGATGATGG - Intergenic
1187786583 X:22894955-22894977 AGAGAGAAAAAGGCTGAGGATGG - Intergenic
1188491724 X:30745155-30745177 GGGTAGATGCAGGCTGAGGAAGG - Intergenic
1189211425 X:39287260-39287282 AGGGAGAGGCAGCACGAAGAAGG + Intergenic
1189289098 X:39872753-39872775 AGGGAGAAGGAGGACAAAGAAGG - Intergenic
1189535012 X:41926334-41926356 AGGGAGAAGTAGGGGGAAAATGG + Intergenic
1189722261 X:43932512-43932534 AGGGGGATGAAGGCTGCAGATGG + Intergenic
1189898997 X:45686502-45686524 AGGGAGAGACAGCATGAAGAAGG - Intergenic
1190072879 X:47293264-47293286 AGAGAGAAGAAGGAGGAAGAAGG + Intergenic
1190123397 X:47682630-47682652 AGGAAGGAGGAGGATGAAGAGGG - Intergenic
1191084615 X:56550985-56551007 AGGGAGGAGAGAGCTGAAGAAGG - Intergenic
1191109872 X:56796089-56796111 AGGGACAAGAAAGATGAAGAGGG - Intergenic
1191122387 X:56920114-56920136 TGAGAGAAGCAGGCTTCAGAAGG - Intergenic
1192280818 X:69682775-69682797 AGGGAGAGTGAGGCAGAAGATGG - Intronic
1192509601 X:71714053-71714075 AGGGAGAATAGCGCTGAAGAAGG + Intergenic
1192517096 X:71767500-71767522 AGGGAGAATAGCGCTGAAGAAGG - Intergenic
1192947711 X:75983937-75983959 AGGGATAAGGAGGAAGAAGAAGG - Intergenic
1193198741 X:78663191-78663213 AGGGAGAAGCGGGGAGATGAGGG + Intergenic
1193236484 X:79113624-79113646 AAGCAGAAGCAGGCTGAAGGTGG + Intergenic
1194049027 X:89045301-89045323 AAGGAGAAGGAGGAAGAAGAAGG - Intergenic
1194440097 X:93921530-93921552 ATAGAGAAGCAGTGTGAAGAAGG - Intergenic
1195324817 X:103749952-103749974 AGGAAGAAGAAGGGTGAAGCAGG - Intergenic
1196322238 X:114355122-114355144 GGGGAGAAGCAGGTTGAAAAGGG - Intergenic
1196706758 X:118723815-118723837 AGGGAGATTCAGCCTGAAGGTGG + Intergenic
1197521835 X:127508533-127508555 AGAGAGAAGCAGACAGAATATGG - Intergenic
1197764305 X:130049959-130049981 AGGGAGAAGCAGGCTGGGTGGGG + Intronic
1198720663 X:139615803-139615825 AAGGAGGAGCAGGCAGAAGTTGG - Intronic
1199109926 X:143919733-143919755 AGAGAGAAGGAGGAAGAAGAAGG + Intergenic
1199194077 X:145006431-145006453 AGAGACAAGCAGAATGAAGACGG + Intergenic
1199404200 X:147436820-147436842 TGGGAAAAGCTGGGTGAAGAAGG + Intergenic
1199991398 X:152989577-152989599 AAGGAGGAGCAGGAGGAAGAGGG - Exonic
1200015903 X:153163695-153163717 AGACAAAAGCAGGCAGAAGAAGG - Intergenic
1201146283 Y:11067085-11067107 AGGGAGAAGAAGGGAGAAGAAGG + Intergenic
1201146286 Y:11067095-11067117 AGGGAGAAGAAGGGAGAGGAAGG + Intergenic
1201146383 Y:11067389-11067411 AGGGAGAGGGAGGGAGAAGAAGG + Intergenic
1201146385 Y:11067399-11067421 AGGGAGAAGAAGGGAGAAGAAGG + Intergenic
1201146388 Y:11067409-11067431 AGGGAGAAGAAGGGAGAGGAAGG + Intergenic
1201596016 Y:15670001-15670023 AGAGAGAGGCAGGCAGAATATGG + Intergenic
1201685997 Y:16703050-16703072 AGGCAGAAGAAGGTGGAAGAAGG - Intergenic
1201760398 Y:17530680-17530702 AGGCAGAAGCATGTTGCAGAGGG - Intergenic
1201841156 Y:18375310-18375332 AGGCAGAAGCATGTTGCAGAGGG + Intergenic