ID: 1120939658

View in Genome Browser
Species Human (GRCh38)
Location 14:89935143-89935165
Sequence CATGATGAACAAAGGGCCGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120939658_1120939661 -3 Left 1120939658 14:89935143-89935165 CCGACGGCCCTTTGTTCATCATG 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1120939661 14:89935163-89935185 ATGCAATCATAGAAGTGATTAGG 0: 1
1: 0
2: 0
3: 13
4: 175
1120939658_1120939662 5 Left 1120939658 14:89935143-89935165 CCGACGGCCCTTTGTTCATCATG 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1120939662 14:89935171-89935193 ATAGAAGTGATTAGGATCTACGG 0: 1
1: 0
2: 2
3: 15
4: 138
1120939658_1120939663 16 Left 1120939658 14:89935143-89935165 CCGACGGCCCTTTGTTCATCATG 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1120939663 14:89935182-89935204 TAGGATCTACGGTAATTATTTGG 0: 1
1: 0
2: 1
3: 5
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120939658 Original CRISPR CATGATGAACAAAGGGCCGT CGG (reversed) Intronic
906069179 1:43005303-43005325 CAGGTTGAACAAAGAGCCCTGGG + Intergenic
908647626 1:66296013-66296035 CCTGATGAACAAAGGGGAATTGG - Intronic
910327826 1:86030276-86030298 CATGCTGAAGACAGGGCCCTGGG + Intronic
917191347 1:172422435-172422457 CATGCTGAATAAAGAGCCTTTGG + Intronic
1065010285 10:21414971-21414993 CATGATGAAATAATGGCGGTGGG - Intergenic
1065642946 10:27803745-27803767 CATGCTCAACAAATGGCTGTTGG + Intergenic
1070484671 10:76918410-76918432 CATGATCAACAAAGTGCTATGGG - Intronic
1075280753 10:121136229-121136251 GATGATGAACACAGGGCCTTGGG - Intergenic
1075507435 10:123036798-123036820 CATGAAGGACAAAGTGCAGTTGG + Intronic
1076117885 10:127913175-127913197 CATGATCACCAAAGGGCCAGCGG + Intronic
1076473557 10:130736725-130736747 CAAGAAGAACAAGGGGCTGTGGG - Intergenic
1076618375 10:131771463-131771485 AAGAATGAACCAAGGGCCGTAGG + Intergenic
1078906731 11:15694537-15694559 TGTGATGAACAAAGGGCCTCTGG - Intergenic
1080009660 11:27445153-27445175 AGGGATGAACAAAGGGCTGTGGG - Intronic
1092075106 12:5666284-5666306 CATGATGAACAAAGATGGGTGGG - Intronic
1098462192 12:70744036-70744058 AGTGATGAACGAAGGGCCGGTGG - Intronic
1100283239 12:93138652-93138674 CATGATGAAAAGAGGGCTTTTGG - Intergenic
1102873859 12:116434705-116434727 CATGATGCCCCTAGGGCCGTAGG - Intergenic
1105064957 12:133188495-133188517 AATGATGATAAAAGGGCCATGGG - Intronic
1110650997 13:77940745-77940767 CATGATGCACAAAGAGCAGTTGG + Intergenic
1115504131 14:34078217-34078239 CATGAGGAAAAAAGGGAAGTGGG + Intronic
1120700887 14:87697662-87697684 CATGATGTGCAAATGGCCATGGG - Intergenic
1120939658 14:89935143-89935165 CATGATGAACAAAGGGCCGTCGG - Intronic
1124711792 15:32019154-32019176 CATTATGAAGAAAGGGCCCATGG - Intergenic
1127887493 15:63215139-63215161 TATGAGGGACAAAGGGCCCTTGG - Intronic
1132647088 16:1004044-1004066 CATGAAGCACATAGGGCAGTGGG + Intergenic
1137934530 16:52621874-52621896 CATGATGAACACAGCCCCGGGGG + Intergenic
1142274092 16:89106834-89106856 CATCCTGCACAGAGGGCCGTGGG + Intronic
1155397293 18:25400182-25400204 CATGATGAACAAAGTTAAGTGGG - Intergenic
1156055630 18:32999146-32999168 CAAGCTGAACAAAGAGCCCTTGG + Intronic
1165138686 19:33686542-33686564 CCTGATGAACAAAGGGGACTCGG - Intronic
1165979445 19:39707247-39707269 CAGGATGACCAAAGTGCAGTCGG - Exonic
927098645 2:19768890-19768912 CATTATGCACAAAAGGCCATTGG - Intergenic
927279154 2:21288478-21288500 CAGAGTGAACAAAGGGCTGTAGG + Intergenic
930469262 2:51792455-51792477 TTTGATGACCAAAGGGCCCTTGG + Intergenic
930553298 2:52863524-52863546 CATGATGTACAAAAAGCCTTTGG + Intergenic
933103111 2:78284728-78284750 CCTGATGAACAAAGGGAAATTGG + Intergenic
935631952 2:105219310-105219332 CATCATGCACAAAGGGCTGGAGG + Intergenic
937156516 2:119723755-119723777 CATGAAGAACAAAGAGCCTCAGG - Intergenic
937600072 2:123721068-123721090 CATGGAGAACAAAGGTCTGTTGG + Intergenic
938217026 2:129526681-129526703 CAAGCTGATCAAAGAGCCGTTGG + Intergenic
938557651 2:132440217-132440239 AATGTTGAACAAAGGGCCAGTGG + Intronic
946588574 2:221218081-221218103 CATGATGACCACAGGGACGAAGG + Intergenic
1168851463 20:979871-979893 CATGAAGAACATAGCGACGTGGG - Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1174175384 20:48641251-48641273 AATGAAGAACAAAGAGCCCTTGG + Intronic
1179130090 21:38628472-38628494 CATGATGATCTAAGGACCGAGGG + Intronic
1182242357 22:28926126-28926148 CAAGATGAAGGAAGGGCAGTAGG - Intronic
950548218 3:13651656-13651678 CAGGCTGAACACAGGGCTGTAGG - Intergenic
951437007 3:22676586-22676608 CATGCTGACTAAAGAGCCGTTGG - Intergenic
952191290 3:31025957-31025979 CATGATGAACAATGGGGAGGGGG - Intergenic
952883480 3:37999199-37999221 CAGGATGAGGAAAGGGGCGTGGG + Intronic
955726872 3:61942443-61942465 CAAAATGAAAAAAGGGCCATGGG - Intronic
955973480 3:64459050-64459072 CATCATGTACAAAGTGCCTTTGG - Intergenic
966948713 3:184796605-184796627 CAGGATGAAAAGAGGGCCGGCGG + Intergenic
968195780 3:196705019-196705041 CATGATGAGCAAAGGCCTGAAGG - Intronic
971748987 4:30622052-30622074 CAGCATGAACAAAGGGCTGTGGG - Intergenic
987651502 5:20746445-20746467 AATGTTGAACAAAGTGCCGAAGG + Intergenic
993274959 5:85845190-85845212 CATGAAGAACATAAGGCAGTGGG - Intergenic
998531851 5:142892326-142892348 CAGGATGATCCAAGGGCCTTGGG + Intronic
1000665352 5:163988321-163988343 CATGATGAAAACAGTGCTGTGGG + Intergenic
1001829591 5:174774311-174774333 CAGGAGGAACCAAGGGCTGTGGG - Intergenic
1008642050 6:53474227-53474249 CCTGCTGAACAAAGAGCCCTTGG - Intergenic
1009373548 6:62938761-62938783 CCTGCTGACTAAAGGGCCGTTGG - Intergenic
1017561708 6:155635377-155635399 CTTTCTGAACAAAGGCCCGTGGG - Intergenic
1018131516 6:160736274-160736296 CATGACTAACCAACGGCCGTGGG - Intronic
1019645589 7:2127185-2127207 CATGACTAGCAAAGGCCCGTGGG - Intronic
1038846791 8:31237531-31237553 AAAGATGGACAAAGGGCCCTAGG - Intergenic
1043206228 8:77445245-77445267 CAAGTTGAACAAAGAGCCATAGG - Intergenic
1043477885 8:80622666-80622688 AATGATGCATAAATGGCCGTAGG + Intergenic
1045762156 8:105622614-105622636 GATGCTGAACAAAGGTCCTTTGG + Intronic
1049246106 8:141563426-141563448 CATGATTAATAAAGGGCCCAGGG + Intergenic
1049880460 8:145058615-145058637 CAGGATCAACAATGGGCTGTGGG - Intergenic
1055801452 9:80040864-80040886 AATGATGAACACAGGCCAGTAGG - Intergenic
1060495859 9:124118204-124118226 CAAGATTAACAAAGGGCTCTGGG + Intergenic
1061547190 9:131311263-131311285 CATGAAGACCCAAGGGCCATGGG + Intergenic
1061638243 9:131929173-131929195 CCTGCTGACCAAAGGGCCCTTGG + Intronic
1061652183 9:132059652-132059674 CATGATGTACAAATGGCTGTGGG - Intronic
1061665804 9:132160742-132160764 CATCAAGAACAAAGGGCCTGAGG - Intergenic
1188651330 X:32634528-32634550 CATGCTGACCAAAGGGACCTAGG - Intronic
1188670189 X:32872695-32872717 CAAGATGCACAAAGGGAAGTAGG + Intronic
1192116173 X:68413528-68413550 GAGGTTGAACAAAGGGCCCTGGG - Intronic
1193636865 X:83961654-83961676 AATGATTAACAATGGGCAGTGGG + Intergenic
1202279784 Y:23170306-23170328 CATCATGAACAATGGGATGTGGG - Intronic
1202280513 Y:23181146-23181168 CATCATGAACAATGGGATGTGGG - Intronic
1202281242 Y:23191994-23192016 CATCATGAACAATGGGATGTGGG - Intronic
1202284649 Y:23226526-23226548 CATCATGAACAATGGGATGTGGG + Intronic
1202432914 Y:24806377-24806399 CATCATGAACAATGGGATGTGGG - Intronic
1202436323 Y:24840913-24840935 CATCATGAACAATGGGATGTGGG + Intronic
1202437051 Y:24851761-24851783 CATCATGAACAATGGGATGTGGG + Intronic