ID: 1120940076

View in Genome Browser
Species Human (GRCh38)
Location 14:89939488-89939510
Sequence CAGCAACAGGAGCAGGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 896
Summary {0: 1, 1: 1, 2: 5, 3: 105, 4: 784}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120940076 Original CRISPR CAGCAACAGGAGCAGGAGGC GGG Intronic
900001203 1:15795-15817 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
900346340 1:2212287-2212309 CAGGATCCGGAGCAGGAGGGTGG + Intronic
900929325 1:5726364-5726386 CAGCTGCAGGAGCAAGGGGCAGG + Intergenic
900929432 1:5726920-5726942 CAGCTGCAGGAGCAAGGGGCAGG - Intergenic
901022111 1:6260861-6260883 CCGCAGCCGGAGCCGGAGGCGGG - Exonic
901399779 1:9007846-9007868 CAGCTACAGGAGGCGGAGGCAGG - Intronic
901420325 1:9146338-9146360 CAGGAAGAGGAGGAGGAGGAAGG - Intergenic
901464750 1:9413884-9413906 CAGGACCAGGGCCAGGAGGCTGG + Intergenic
901503228 1:9666975-9666997 CAGCTACAGGAGGCTGAGGCAGG - Intronic
901604731 1:10450237-10450259 GAGCAGCAGCAGCAGGAGGCCGG - Exonic
901860383 1:12070570-12070592 CAGCAATAGGAGGCGCAGGCAGG - Intronic
902081016 1:13820735-13820757 CAGCAGCAGGAGCTGGGGGCTGG - Intronic
902286975 1:15413240-15413262 CAGTCACTAGAGCAGGAGGCAGG + Intronic
902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG + Intergenic
902803537 1:18846431-18846453 CAGGAACAGGAGTGGGAGACTGG - Intronic
902921077 1:19666223-19666245 CAGCAGCAGGGGCAGGAAGGAGG - Exonic
903025531 1:20427524-20427546 CACTAACAGGAGGAAGAGGCAGG - Intergenic
903109659 1:21120512-21120534 CAGCTACTTGAGCAGAAGGCAGG + Intronic
903281038 1:22250200-22250222 CAGGACCAGGAGGAGGAGCCGGG + Intergenic
903413811 1:23168224-23168246 CAGCAGCAGGAGGAGGAGGGCGG - Intronic
903436947 1:23357120-23357142 TAGGAACAGGAGAAGCAGGCAGG + Intergenic
903549919 1:24150688-24150710 CAGCAGTAGGAGGAGGAGGAGGG + Intergenic
903858993 1:26354073-26354095 CAGCAGCAGGAGCTCCAGGCTGG - Exonic
903907403 1:26696488-26696510 CAGCAGCAGCGGGAGGAGGCGGG + Exonic
903975860 1:27149771-27149793 CAGCATCAGGAGCAGAACCCAGG + Intronic
904430863 1:30463178-30463200 CAGCTCCAGGACCAGGAGCCAGG - Intergenic
904715046 1:32461390-32461412 CAGCACTAGGAGAACGAGGCAGG - Intergenic
904800905 1:33092400-33092422 CAGCCACAGTTGCAGGAGGTTGG + Intronic
905387112 1:37612792-37612814 CAGCAACAGCAGCAGCAGCAAGG - Exonic
905873855 1:41419709-41419731 CAGCAGAAGGAGCAGGAGCTGGG - Intergenic
905979327 1:42209901-42209923 CAGCCACAGGTGCAGGAGCTGGG + Intronic
906013345 1:42550475-42550497 CAGCAAGATGAGGAGGAGGTAGG - Intronic
906191973 1:43904758-43904780 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906191983 1:43904794-43904816 CAGGAAGAGGAACAGGAGGAGGG - Intronic
906191991 1:43904827-43904849 CAGGAATAGGAGCAGGAGGAGGG - Intronic
906192010 1:43904899-43904921 CGGGAAGAGGAGCAGGAGGAGGG - Intronic
906192188 1:43905538-43905560 CAGGAATAGGAGCAGAAGGAGGG - Intronic
906192249 1:43905754-43905776 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192337 1:43906081-43906103 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192381 1:43906225-43906247 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906209680 1:44005595-44005617 CAGCAACAGCAGCACCAGACGGG + Intronic
906262523 1:44405367-44405389 CAGCAGCAGCAGTAGGCGGCTGG - Exonic
906296970 1:44654874-44654896 CAGCAACAGGCGCAGCATGGCGG + Exonic
906303001 1:44697317-44697339 GAGCAACTAGAGCAGGAGCCCGG - Intronic
906332513 1:44898802-44898824 CAGCTACAGGAGGCTGAGGCAGG - Intronic
906704110 1:47882224-47882246 CAGCATGGGGAGCATGAGGCAGG - Intronic
907117282 1:51979927-51979949 CAGCTACAGGAGGCTGAGGCAGG + Intronic
907407661 1:54263534-54263556 TGGCCACAGGAGCAGGAGGATGG - Intronic
907488075 1:54790758-54790780 CAGCAGCAGCAGCAGCAGCCAGG - Intronic
908233617 1:62129825-62129847 CAGCTACAGGAGGATGAGGCAGG + Intronic
909180309 1:72415673-72415695 CAGGAGCAGGACCAAGAGGCAGG - Intergenic
910033321 1:82759024-82759046 GAGAAACAGGAGGAGGAAGCAGG - Intergenic
910351437 1:86303401-86303423 CAGCTGCAGCAGCAGGAAGCTGG - Intergenic
910505793 1:87948994-87949016 AAGCAAAAGGAAGAGGAGGCAGG + Intergenic
911568903 1:99498440-99498462 CAGCAGCTGGAGCAGAAGGAAGG + Intergenic
911591460 1:99752897-99752919 CAGGAACAGGACAAGGGGGCTGG + Intronic
912355955 1:109054233-109054255 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
912776569 1:112509387-112509409 CAGCAGCAGGAGCAGAAGGCAGG - Exonic
912844203 1:113064400-113064422 CAGAGGCAGAAGCAGGAGGCAGG + Intergenic
913534239 1:119755990-119756012 GAGGAACAGGAGCAGGAAGATGG - Intronic
914245289 1:145881171-145881193 CAGCTACAGGAGACTGAGGCAGG + Intronic
914789943 1:150868784-150868806 CAGCTACAGGAGGCTGAGGCAGG + Intronic
914932742 1:151949472-151949494 CAGCCACAGGAGCAGGAGGCTGG + Intergenic
914950630 1:152110653-152110675 CAGCTCCAGGAGGAGGAGGACGG - Exonic
914993103 1:152515480-152515502 CAGCAGGAGGAGGAGGAGGCGGG - Exonic
915076653 1:153313170-153313192 CACCAGCAGGGGCAGGAGGAAGG + Intergenic
915835386 1:159171782-159171804 CAGGAGCAGGAGCAGGAGCGAGG - Exonic
915898317 1:159828267-159828289 CAGCACCAGGAGGAGCAGGTAGG + Intronic
915951118 1:160190532-160190554 GAGGAATAGGAGCAGGGGGCGGG - Intergenic
916407324 1:164510293-164510315 CAGGAAGAGGAGGAGGAGGTAGG - Intergenic
916740787 1:167645484-167645506 AAGCAACAAGACCACGAGGCTGG + Intronic
916890014 1:169105813-169105835 CAGGTGCAGGAGCGGGAGGCGGG + Exonic
917612231 1:176700258-176700280 CAATATCTGGAGCAGGAGGCTGG + Intronic
917869551 1:179229456-179229478 CAGCGCCAGGAGCCCGAGGCCGG - Exonic
918263532 1:182818838-182818860 GAGCAACTGGAGCAGTGGGCAGG + Exonic
918430458 1:184454665-184454687 CAGGAACAGGAGCAAGAGAGAGG - Intronic
919491031 1:198205008-198205030 CAGCAACAGTAGCAGGGGCCTGG - Intronic
919790720 1:201289093-201289115 CAGCAGAGGGGGCAGGAGGCTGG + Intronic
920115710 1:203619652-203619674 CAGCAATAGCAGCAGCAGGCTGG - Intergenic
920294502 1:204947556-204947578 CAGCAGTGGGAGCTGGAGGCTGG - Intronic
920401599 1:205679997-205680019 CTGCAACAGGAGCCAGCGGCCGG + Intronic
920600780 1:207321821-207321843 CAGCACCAGCAGCAGCAGCCGGG - Exonic
920651440 1:207840303-207840325 GGGGAACAGGAGCAGGATGCTGG + Intergenic
921060251 1:211578961-211578983 CCGGAGCAGGAGCAGGAGGGCGG + Intergenic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
921906601 1:220501997-220502019 CAGGAACAAGAGCAAGAGGCAGG - Intergenic
921945406 1:220882766-220882788 AAGCAGCAGGAGGAGGAGGAAGG - Intronic
922327221 1:224539170-224539192 CGGCAAGAGGAGCAGTATGCAGG - Intronic
922465553 1:225843906-225843928 TAGCAACAGCAGCAGGGAGCAGG - Intronic
922727840 1:227932475-227932497 CAGCAACATGAACAGGAGTTTGG - Intronic
922823311 1:228499603-228499625 CAGCAACATGAACAGGAGTTTGG - Intergenic
923119712 1:230978802-230978824 CAGCAGCAGCAGCAGCCGGCAGG + Exonic
923256583 1:232226640-232226662 CAGCAACAGCAGCAGCAGCCTGG + Intergenic
923653120 1:235892247-235892269 GAGCAACAGGAGCTGCAGGGAGG - Intergenic
923711426 1:236390439-236390461 CAGCTACAGGAGGCTGAGGCAGG + Intronic
924186888 1:241502174-241502196 CAGCAGCATGAGAAGGAGACAGG + Intronic
924458129 1:244234421-244234443 CAGCAGCAGCAGCAGCAGCCAGG - Intergenic
924617346 1:245623221-245623243 AAGGAAGAGGAGCTGGAGGCAGG - Intronic
924621027 1:245660925-245660947 CAGCTACAGGAGGTTGAGGCAGG - Intronic
924679864 1:246220616-246220638 CATGAACAGCAGCAGGAGGCAGG + Intronic
1063344244 10:5296374-5296396 CTGCAACAGGAGAAGGAAGCTGG - Intergenic
1063451283 10:6151923-6151945 CAGGAACAGGAGCTGCAGGAGGG - Intronic
1064645341 10:17454199-17454221 CAGCAGCAGCAGCAGCAGGCTGG + Exonic
1065478833 10:26171713-26171735 CTGCCTCAGGAGCAGGAGGCTGG + Intronic
1065550414 10:26863804-26863826 GAGGAACAGGAGTAGGAGGAAGG + Intergenic
1065629141 10:27659800-27659822 CACCACCAGAAGTAGGAGGCAGG - Intergenic
1065643164 10:27805547-27805569 CAGCAAGACAAGGAGGAGGCAGG + Intergenic
1065861914 10:29879037-29879059 CAGCAAAAGGTCCAGGAGCCAGG + Intergenic
1066290854 10:34013203-34013225 CAGCTGCAGGAGCAGGGGTCTGG - Intergenic
1066745572 10:38602540-38602562 GGGCAGCAGGAGCAAGAGGCAGG - Intergenic
1067561146 10:47305523-47305545 CACCAACAGAAGCTGGAGGAAGG - Intronic
1067724481 10:48759539-48759561 CAGCAACAGCAGCAGCAGCCAGG - Intronic
1067945141 10:50684456-50684478 CAGGAGCTGGAGCAGGAGGAAGG + Intergenic
1069108565 10:64414134-64414156 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
1069589485 10:69632962-69632984 CAGGAAGAGGAGCAGGATGGAGG - Exonic
1069893617 10:71667078-71667100 CAGCAACAGAGGCAGGCGGCCGG - Intronic
1069902384 10:71713526-71713548 CTGCATCGGGACCAGGAGGCGGG + Exonic
1069989531 10:72306360-72306382 CAGCCACAGATGCAGGTGGCTGG + Intergenic
1070148445 10:73791227-73791249 CAGCAAGAGGAGGATGAGGCAGG - Intronic
1070255974 10:74813552-74813574 CAGCGACCTAAGCAGGAGGCAGG - Intergenic
1070495442 10:77017278-77017300 CAGCACCAAGTACAGGAGGCTGG - Intronic
1070600916 10:77865714-77865736 CAACAACAGGCGCAGGAAGCGGG + Intronic
1070866646 10:79711328-79711350 CAGGACCTGGAGCAGGAGGAAGG + Exonic
1070880435 10:79849449-79849471 CAGGACCTGGAGCAGGAGGAAGG + Exonic
1071285862 10:84144465-84144487 CACCTACAGGAGCCTGAGGCAGG - Intronic
1071600411 10:86956141-86956163 CGGCAAGGGGAGCAGGGGGCGGG - Intronic
1071633558 10:87233551-87233573 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1071647005 10:87365767-87365789 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1072690843 10:97571443-97571465 CAGCAACTGATGGAGGAGGCAGG - Intergenic
1073045285 10:100634186-100634208 CAGCAGCCAGAGCAGGAGGGTGG - Intergenic
1073152744 10:101323008-101323030 CAGGGAGAGGAGCAGGAGGAGGG + Intergenic
1073531731 10:104238658-104238680 GAGAAACAGGGGCAGGAGACAGG - Intronic
1073874919 10:107911817-107911839 CAGCAAAAGGAACAGGAGAGAGG + Intergenic
1074147067 10:110726159-110726181 AGTCATCAGGAGCAGGAGGCTGG - Intronic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074431798 10:113400843-113400865 CAGCACCTGGCTCAGGAGGCAGG + Intergenic
1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG + Intronic
1075152138 10:119943476-119943498 CAGCTACAGGAGGCTGAGGCAGG + Exonic
1075155620 10:119974093-119974115 CAGTAACAGGGCCAGGAGCCAGG + Intergenic
1075450939 10:122551625-122551647 CAGCATGAGCAACAGGAGGCAGG - Intergenic
1076028679 10:127139681-127139703 CAGCATCAGGTGGAAGAGGCAGG - Intronic
1076120413 10:127932582-127932604 CAGCAACAGAGACAGGAGGGTGG + Intronic
1076350441 10:129811546-129811568 CAGCACCGGGAGAAGGGGGCAGG - Intergenic
1076413556 10:130268429-130268451 CAGCACCAGATGCAGGATGCAGG - Intergenic
1076779189 10:132714589-132714611 CAGCACCAGGCCCAGGAGGGAGG + Intronic
1077235561 11:1480556-1480578 CAGCAACAGGTGCAGGAGCTCGG + Intronic
1077370013 11:2177445-2177467 CAGCAGCAGTAGCAGAAGGGGGG - Intergenic
1077407612 11:2389624-2389646 CAGCAGCTGGGGCAGGAAGCAGG - Intronic
1077442278 11:2574380-2574402 TAGCAACAGGGGCTGGGGGCTGG + Intronic
1077506825 11:2933447-2933469 CAGCAGCTGGAGTAGGATGCGGG + Intergenic
1077919300 11:6631053-6631075 CTGCACCAGCAGCTGGAGGCTGG + Exonic
1077920982 11:6641536-6641558 CAGCAATGGTAGCAGGAGGTGGG + Exonic
1079036937 11:17028069-17028091 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
1079079924 11:17407008-17407030 CAACGACAGGAGCAGGATGCCGG + Exonic
1079128494 11:17734811-17734833 CAGCAAGCGGAGCAGCAGCCCGG + Exonic
1079274885 11:19026095-19026117 CAGCAACAGGAATTGGATGCAGG - Intergenic
1080394211 11:31875069-31875091 CAGTAGCAGGAGCAGCAGGAGGG - Intronic
1080433743 11:32221270-32221292 CAGCAGCAGGAGCAGAAGACAGG - Intergenic
1080648683 11:34205758-34205780 CAGCAACAGGTACAGCAGACAGG + Intronic
1080876367 11:36278644-36278666 CTGTAACAGAAGCAGCAGGCAGG + Intronic
1081668324 11:44929421-44929443 CAGCAACTGGCCCAGGATGCAGG + Exonic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1081893041 11:46560931-46560953 CACCAACAATATCAGGAGGCTGG + Intronic
1082809045 11:57467621-57467643 CAGGAGCATCAGCAGGAGGCAGG - Exonic
1082816324 11:57512267-57512289 CAGCACCAGGTGGAGAAGGCAGG + Intronic
1082834077 11:57639456-57639478 GAGCAGCAGGGGCAGGGGGCTGG - Intergenic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083474822 11:62909044-62909066 CAGCAACAGGACCAGGAGCCAGG - Exonic
1083796879 11:65021967-65021989 CAGCAGTAGCAGCAGCAGGCTGG - Exonic
1083824345 11:65189966-65189988 CAGGCACAGGTGCAGAAGGCTGG - Intronic
1083937872 11:65879877-65879899 CACCAACAGGGCCAGGAGGCAGG - Exonic
1084046097 11:66568457-66568479 CAGCGACAGGAGCTGCAGCCAGG + Exonic
1084122972 11:67080258-67080280 GAGCACCAAGCGCAGGAGGCAGG + Intergenic
1084185086 11:67467319-67467341 CAGCAGCAGGAGCAGGAAGGAGG + Exonic
1084338876 11:68479262-68479284 CAGCAGCAGATGCAGGGGGCTGG + Intronic
1084557531 11:69883826-69883848 CAGACACAGGAGCAGGGAGCTGG + Intergenic
1084564386 11:69920938-69920960 CAGCCACAGGTGCAGGAGGGTGG + Intergenic
1084575622 11:69986264-69986286 GCGCACGAGGAGCAGGAGGCAGG + Intergenic
1084697038 11:70761915-70761937 CAGCAGCAGCAGCAGCAGCCGGG - Intronic
1085880667 11:80463429-80463451 TAGCAACCGCAGCAGGTGGCAGG - Intergenic
1086194309 11:84118692-84118714 CAGCAGCAGAAGCAGGAAGATGG + Intronic
1087392058 11:97548443-97548465 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1087594743 11:100238490-100238512 CAGCAGCAGGAGGAGGAGAAGGG + Intronic
1088330918 11:108650541-108650563 AAAAAAAAGGAGCAGGAGGCAGG + Intergenic
1088696267 11:112368656-112368678 CAGAAGCAGCAGGAGGAGGCTGG - Intergenic
1088825858 11:113493722-113493744 CAGCAACTGGTGCATGTGGCTGG + Intergenic
1089300858 11:117497881-117497903 AAGCAGCAGGGGGAGGAGGCGGG - Intronic
1089353051 11:117832224-117832246 CTGCAACCATAGCAGGAGGCAGG - Intronic
1089413318 11:118265451-118265473 CAGGAACAAGAGAAGGCGGCAGG + Intergenic
1089561623 11:119346074-119346096 AAGCAGCAGGAGGAGCAGGCTGG + Exonic
1089666141 11:120021209-120021231 GGGCACCAGGAGCAGGAGGAGGG - Intergenic
1089678418 11:120105924-120105946 CAGCAACAAAAGCAGCAGTCAGG + Intergenic
1089767145 11:120776293-120776315 CAGCCCCAGGAGCCGGAGGAAGG + Intronic
1090029445 11:123194914-123194936 TAGCAAGAGGAGAAGGAGGAGGG + Exonic
1091111352 11:132971927-132971949 CAGCAGCAGTAGCAGCAGGGTGG - Intronic
1091410387 12:235267-235289 AAGCAGCAGGGGCAGGAGGCAGG + Intronic
1091751852 12:3027260-3027282 CAAAGAAAGGAGCAGGAGGCTGG - Intronic
1091761726 12:3091938-3091960 CTGCAACAGGAGCACAATGCTGG - Intronic
1092349278 12:7742397-7742419 CAGCTACAGGAGGCTGAGGCAGG + Intronic
1092599083 12:10039126-10039148 CACCACCAGGAGGAGGAAGCAGG - Intronic
1092750689 12:11716458-11716480 CAGAAACAGAAGCAGGATGATGG - Intronic
1093416366 12:18925347-18925369 CATCACCAGGAGCAAGAAGCTGG + Intergenic
1096109765 12:49021634-49021656 GAGCCCCTGGAGCAGGAGGCTGG - Exonic
1096111829 12:49033420-49033442 CAGCAACAGCAGCAGGGTCCTGG - Exonic
1096374778 12:51099678-51099700 CAGCAGCAGAAGCATGAGGATGG - Exonic
1096715223 12:53487126-53487148 CAGCTACATGAGCAGGATGCAGG - Exonic
1097172797 12:57127180-57127202 CAGAAACAGGAGCAGCACGAAGG - Intronic
1097249686 12:57625700-57625722 TAGCACCAGGAGCGGGAGCCAGG + Exonic
1098898043 12:76084774-76084796 CAGCAACGCGAGCGAGAGGCGGG + Exonic
1101852709 12:108417063-108417085 CAAAAGCAGGAGCAGGAGGCAGG + Intergenic
1102230406 12:111257776-111257798 CAGGAAGAGGAGGAGGAGGATGG - Intronic
1103478605 12:121236396-121236418 CATGAACACCAGCAGGAGGCTGG + Intergenic
1104021248 12:124993828-124993850 CAGCAGCAGCAGCAGGAGCCCGG - Exonic
1104350844 12:128042627-128042649 AACCAACAGGGGCAGGATGCAGG - Intergenic
1104900843 12:132188857-132188879 GAGGAGCAGGAGCAGGAGGGAGG + Intergenic
1105264021 13:18800702-18800724 CAGCAGCAGGATCATGGGGCTGG + Intergenic
1105544874 13:21344014-21344036 AAGGAAGAGGAGGAGGAGGCGGG - Intergenic
1107276712 13:38687427-38687449 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1108004665 13:45934624-45934646 CAGTATCAGGAAGAGGAGGCTGG + Intergenic
1108639708 13:52371709-52371731 CAGCAGCAGCAGCAGGATGGGGG + Intergenic
1108754647 13:53485207-53485229 CTGGAGCAGGAGCAAGAGGCAGG - Intergenic
1110542065 13:76717968-76717990 CAACAACAGCAGCAAGAAGCTGG + Intergenic
1110573914 13:77034893-77034915 CAACCACAGGGGCTGGAGGCAGG + Intergenic
1112598074 13:100828051-100828073 AAGCAACAAGAACAGGAGGATGG - Intergenic
1112732996 13:102387841-102387863 CAGCTACAGGAGGCTGAGGCAGG - Intronic
1113453863 13:110433282-110433304 CAGAAATAGGACCAGGCGGCCGG + Intronic
1113491186 13:110693328-110693350 CAGCACCAGCAGCAGTAGGTGGG - Intronic
1113543084 13:111123878-111123900 CAGCCGCAGGGGCAGGGGGCGGG - Intronic
1113632264 13:111896444-111896466 CAGCTCCGAGAGCAGGAGGCTGG + Intergenic
1113708263 13:112447767-112447789 CAGCAACGTGCGCAGGAGGAGGG + Intergenic
1114842058 14:26275837-26275859 CAGCAACAGGAACAGAAGGAGGG + Intergenic
1115399424 14:32939833-32939855 GAGGAGCAGGAGGAGGAGGCCGG + Intronic
1115460115 14:33650862-33650884 CAGGAGCAGGAGCAGGACCCAGG + Intronic
1116245616 14:42407941-42407963 CATCACCAAGAGCAGGAGGGTGG - Intergenic
1116564388 14:46427212-46427234 CAACAACAGGACCAGAAGTCTGG - Intergenic
1117199442 14:53373266-53373288 CTGCAATAGGCACAGGAGGCAGG + Intergenic
1117592160 14:57281759-57281781 GAGCAACAGGAGCTGTGGGCAGG + Intronic
1117748248 14:58893204-58893226 CAGAAAAAGGGGCAGGAGACAGG + Intergenic
1117827765 14:59721245-59721267 CAGCTACAGCAGCTTGAGGCTGG - Intronic
1117920122 14:60720902-60720924 CTGCCAAAGGAGCAGGAGGTAGG + Intronic
1118200127 14:63663739-63663761 CATGAACAGTGGCAGGAGGCAGG - Intergenic
1118273993 14:64369281-64369303 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
1118626080 14:67660578-67660600 CAGAAAGAGGAGCAGGAGAAGGG - Intronic
1118636865 14:67755909-67755931 CAGCAACAGAGGTAGAAGGCAGG + Intronic
1118748736 14:68791875-68791897 CACCAACAGGAGCAGCAAGCTGG + Intronic
1118839765 14:69501530-69501552 CAGTTACAGTAGCTGGAGGCTGG - Intronic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1120778627 14:88464987-88465009 CAGAAACAGGAGGAGGAGGGAGG - Intronic
1120940076 14:89939488-89939510 CAGCAACAGGAGCAGGAGGCGGG + Intronic
1121055111 14:90845749-90845771 CAGCAACAGGAACTGGGGGCAGG + Intergenic
1121171716 14:91859931-91859953 CTGGAACTGGAGCAGCAGGCAGG + Intronic
1121233758 14:92377533-92377555 GAACAGCAGGAACAGGAGGCAGG + Intronic
1121693517 14:95894443-95894465 CAGCCACACTAGCAGGAGGAGGG + Intergenic
1121741484 14:96255308-96255330 CAGCAACAGGAGAAGACAGCAGG + Intronic
1121798777 14:96756264-96756286 CAGCCACATGACAAGGAGGCAGG + Intergenic
1122072526 14:99213867-99213889 CAGCATCAGAAGCAAGATGCTGG - Intronic
1122143085 14:99674007-99674029 CAGCCTGAGGAGCAGGAGGTGGG + Intronic
1122375450 14:101254026-101254048 CCACAACAGGAACAAGAGGCTGG - Intergenic
1122700946 14:103588728-103588750 CAGCTACAGGAGGCTGAGGCAGG + Intronic
1122752059 14:103943865-103943887 AAGCAACAGGAGCTGTAGGGTGG - Intronic
1122866066 14:104604490-104604512 CAGCAGCAGAGACAGGAGGCTGG + Exonic
1123498053 15:20850180-20850202 CAGCAGCAAGAGCAGGAGCGAGG + Intronic
1123555284 15:21423808-21423830 CAGCAGCAAGAGCAGGAGCGAGG + Intronic
1123591529 15:21861139-21861161 CAGCAGCAAGAGCAGGAGCGAGG + Intergenic
1123626157 15:22228120-22228142 CAACAGCAGGACCTGGAGGCAGG - Intergenic
1123774582 15:23566009-23566031 CAGCCTCAGGAGGAGGAGCCTGG + Exonic
1124177320 15:27438634-27438656 CACCCGGAGGAGCAGGAGGCGGG - Intronic
1124816057 15:32993888-32993910 CTGCAACAGCAGCCGGGGGCGGG + Intronic
1124836416 15:33199720-33199742 AAGAGACAGGAGCAGGAGGCGGG + Intergenic
1125722570 15:41852273-41852295 CAGCCACAGGAGCTGAAGCCCGG - Exonic
1125966741 15:43880891-43880913 CTGCAATGGGAGGAGGAGGCTGG + Intronic
1126487637 15:49199849-49199871 GAGCAACAAGAGAATGAGGCAGG + Intronic
1126829561 15:52587067-52587089 CAGCAGCAGTAGCAGGAGAAAGG + Intronic
1127291797 15:57578055-57578077 GAGGAACAGGAGAAGGAGTCAGG - Intergenic
1127817055 15:62620406-62620428 CAACAACAAAAGCAGTAGGCAGG - Intronic
1128153505 15:65377714-65377736 CAGCAGCGGCAGCAGGAGCCGGG + Exonic
1128244940 15:66126674-66126696 CAGAGACAGTAGCAGGAAGCAGG + Intronic
1128657946 15:69476248-69476270 CAGCAACTAGAGAAGGAGCCAGG - Intergenic
1128682341 15:69661178-69661200 CATCCACAGGAGCAGGAGGGAGG + Intergenic
1128965248 15:72051831-72051853 CATGAACAGCAGGAGGAGGCAGG + Intronic
1129232255 15:74203318-74203340 CTCCAGGAGGAGCAGGAGGCAGG - Intronic
1129296974 15:74604935-74604957 CAGCCACAGGAGCAGGATGCAGG - Intronic
1129589675 15:76904667-76904689 CAGCAACAGAGGCAGGAGGCTGG + Intronic
1129972593 15:79792997-79793019 CAGCTACAGGAGGCGGAGGTTGG - Intergenic
1130135234 15:81176696-81176718 AGGCAACAGCAGCGGGAGGCAGG + Intronic
1130648893 15:85751141-85751163 CAGCCACAGAAGCAGAGGGCGGG + Intergenic
1132026091 15:98405531-98405553 CAGCAACAGCAGCCTGGGGCAGG - Intergenic
1132452306 15:101975144-101975166 CAGCAGAAGGAGCAGGAGCAAGG + Intergenic
1202963630 15_KI270727v1_random:151017-151039 CAGCAGCAAGAGCAGGAGCGAGG + Intergenic
1132454592 16:15480-15502 CAGCAGAAGGAGCAGGAGCAAGG - Exonic
1132495417 16:260974-260996 CTGCAACCCCAGCAGGAGGCAGG + Intronic
1132713665 16:1280066-1280088 CAGGAACAGGGCCTGGAGGCGGG + Intergenic
1132782396 16:1634768-1634790 GCCCAACAGGAGCATGAGGCTGG + Intronic
1133124996 16:3641052-3641074 CAGCAACAGCACCTGGGGGCTGG - Intronic
1133138458 16:3728397-3728419 CAGCAACAGCAGCAGCAGCAAGG - Exonic
1133228923 16:4357163-4357185 CAGCAAAAGAAGGAGGAGGTAGG - Exonic
1133284186 16:4682990-4683012 CAGCGACAGAAGCTGGAGGAGGG - Intronic
1133288418 16:4702102-4702124 CAGCAGCAGCAGCAGCAGTCGGG - Exonic
1133784313 16:8963248-8963270 CAGCAGCAGCAGCAGAAAGCGGG - Exonic
1134222005 16:12362394-12362416 CTGCAGCAGGTGGAGGAGGCTGG - Intronic
1134743923 16:16572790-16572812 TAGCAACAGCAGCAGTATGCTGG - Intergenic
1134762321 16:16725155-16725177 AAGCAACAGCAGCAGCAGGATGG + Intergenic
1134983738 16:18634015-18634037 AAGCAACAGCAGCAGCAGGATGG - Intergenic
1135001559 16:18780961-18780983 TAGCAACAGCAGCAGTATGCTGG + Intergenic
1135330881 16:21558610-21558632 CAGCTACAGGAGGCTGAGGCAGG - Intergenic
1135720748 16:24815739-24815761 CAGCTACAGGAGGCTGAGGCAGG + Intronic
1135771932 16:25224419-25224441 CAGGAGCAGGGGCAGGTGGCAGG + Exonic
1135942134 16:26831057-26831079 CAGCAAGAAGTGCAGGAGGCAGG + Intergenic
1135994563 16:27238328-27238350 CTGCCAGAGGATCAGGAGGCTGG - Intronic
1136019336 16:27430088-27430110 CAGCAGCAGGAGCAAGGGGGCGG - Exonic
1136025318 16:27464802-27464824 CAGCATCAGGTGCTGGAGGTCGG - Exonic
1136081040 16:27852802-27852824 AGGCGAGAGGAGCAGGAGGCAGG + Intronic
1136095402 16:27952036-27952058 AAGAAACAGGAGCAGGGAGCAGG + Intronic
1136120733 16:28131913-28131935 TTGCAACAGGTGCAGGGGGCAGG + Intronic
1136590377 16:31214752-31214774 CAGCTCCTGGTGCAGGAGGCCGG - Exonic
1136737493 16:32477109-32477131 AGGCAGCAGGAGCAAGAGGCAGG + Intergenic
1137291583 16:47055377-47055399 CAGGAGCAGGGACAGGAGGCTGG + Intergenic
1137649933 16:50111052-50111074 AACCAACAGAAGCAGTAGGCAGG - Intergenic
1137904835 16:52310507-52310529 CTGAACCAGGAGCAGGAGGCTGG + Intergenic
1138319403 16:56099056-56099078 CAGCAAAAAGAGAAGGAGGTGGG + Intergenic
1138391201 16:56670894-56670916 GGGCAACAGGAGCAGCAGCCTGG - Exonic
1139300766 16:65943519-65943541 CAGCAACAGGGGCAGATGGTTGG - Intergenic
1139420354 16:66845743-66845765 TAGCAAGAAGAGCTGGAGGCAGG - Intronic
1139425469 16:66877248-66877270 CAGCTACAGGAGGCTGAGGCAGG - Intergenic
1139582189 16:67880292-67880314 CAGGATCAGCAGCAGGGGGCTGG - Intronic
1139595069 16:67952675-67952697 CAGCAACTGGAGGCTGAGGCAGG + Intronic
1139910041 16:70392095-70392117 CAGCCACAGGCGCTGGAGGCAGG - Intronic
1140392867 16:74603114-74603136 CAGCAGCAGCAGCAGCAGCCAGG + Intronic
1141583981 16:85020731-85020753 TAGCAACAGGTGAAGGACGCTGG + Intergenic
1141608722 16:85169720-85169742 CAGCAGCAGGAGCCGGCGCCCGG + Intergenic
1141779669 16:86151199-86151221 CAGCAGGAGGAGGTGGAGGCTGG - Intergenic
1141977819 16:87529250-87529272 CACCAGCAGGACCTGGAGGCAGG + Intergenic
1142027786 16:87823801-87823823 CAGCAGCCAGAGGAGGAGGCCGG - Intergenic
1203015578 16_KI270728v1_random:352468-352490 AGGCAGCAGGAGCAAGAGGCAGG - Intergenic
1203033913 16_KI270728v1_random:625626-625648 AGGCAGCAGGAGCAAGAGGCAGG - Intergenic
1142639803 17:1279395-1279417 CTGCAACAGAAACCGGAGGCTGG + Intergenic
1142765262 17:2060846-2060868 CAGGAAGAGGAGCAGCAGGAAGG + Exonic
1143035221 17:3991298-3991320 GAGAAAGAGGAGGAGGAGGCCGG - Intergenic
1143320977 17:6069029-6069051 TTGCAACAGGTGCAGGTGGCAGG - Intronic
1143550953 17:7630198-7630220 CAGCAACAGCAGCAGGCGCGAGG - Exonic
1143608253 17:8003148-8003170 GAGCAGCAGGAGCGGGAGCCGGG - Exonic
1143722028 17:8819154-8819176 CTGTGACAGGAGCAGCAGGCAGG + Exonic
1144438290 17:15260710-15260732 CAGCAACAGGAGGAGCATTCTGG + Exonic
1144634249 17:16893972-16893994 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1144893237 17:18507938-18507960 CAGCAACATGAGCAGGACCTGGG + Intergenic
1144968623 17:19093398-19093420 CAGGAAGAGGAGGAGGAGGGTGG + Intronic
1144979292 17:19158665-19158687 CAGGAAGAGGAGGAGGAGGGTGG - Exonic
1144988930 17:19219567-19219589 CAGGAAGAGGAGGAGGAGGGTGG + Intronic
1145002032 17:19312392-19312414 TAGCCACAGCGGCAGGAGGCAGG - Intronic
1145168363 17:20633867-20633889 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1145212990 17:21028940-21028962 CAGGATCAGGAGCAGGAGGTGGG - Intronic
1146380312 17:32322921-32322943 CAGAAACAGGGGCAGGAGTGTGG + Exonic
1146659953 17:34659051-34659073 CAGGAACAGGCCCAGGATGCTGG + Intergenic
1147319014 17:39634897-39634919 CAGGAAAAGCAGCAGGTGGCTGG + Intronic
1147379547 17:40045669-40045691 AAGCTACAGGTGCAGGAGGATGG + Intronic
1147416619 17:40295904-40295926 CAGCAGGAGGGGCAGGAGGATGG - Intronic
1147437561 17:40426640-40426662 AAGCTACAGGAGCAGGAAGATGG + Intergenic
1147559405 17:41499740-41499762 CACCACCAGGACCTGGAGGCAGG + Intergenic
1148021692 17:44557711-44557733 CAGCAGCGGCAGCAGCAGGCGGG - Exonic
1148070441 17:44905701-44905723 CAGCAGCAGCAGCAGGTGGCAGG + Intronic
1148141735 17:45333864-45333886 AGGAATCAGGAGCAGGAGGCGGG + Intergenic
1148647011 17:49225024-49225046 CAGCAGGAGGAGGAGGAGGAGGG + Exonic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148765716 17:50037262-50037284 CAGGAATAGGAGAAGGAGGTGGG + Intergenic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1149570181 17:57666795-57666817 CAGCAACATGAGAGGGTGGCTGG + Intronic
1150218906 17:63484899-63484921 GAGCAGCAGGAAGAGGAGGCTGG - Exonic
1150649016 17:66997863-66997885 CACCAACAGGAGCATGAGAATGG + Intronic
1151039324 17:70840253-70840275 CAGCATCTGGAGCTGGAAGCAGG + Intergenic
1151165811 17:72202839-72202861 CAGCAGCAGCAGCAGGAGTGAGG - Intergenic
1151439165 17:74117032-74117054 CAGGAAGAGGAGTGGGAGGCAGG + Intergenic
1151509472 17:74549504-74549526 CAGGACCAGGAGCAGGACGTAGG + Intergenic
1151571451 17:74927914-74927936 CTGCAACAGGAGGAGGACCCTGG - Intronic
1151811762 17:76447777-76447799 AAGCAAAAGGTGCACGAGGCGGG - Intronic
1151895128 17:76974941-76974963 CATGAACAGCAGCAGGAGGCAGG + Intergenic
1152039702 17:77894781-77894803 CTGCGCCAGGAGCAGGAGGGAGG + Intergenic
1152266927 17:79300583-79300605 CAGTGACAGAACCAGGAGGCTGG + Intronic
1152424009 17:80209179-80209201 CTGCAACAGCCCCAGGAGGCAGG - Exonic
1152690564 17:81715986-81716008 CTGAAACAGAAGCAGGTGGCGGG - Intronic
1152803355 17:82342416-82342438 CAGCCACAGGCGCAGCAGCCAGG - Intergenic
1153274931 18:3359253-3359275 CAGCATCAGCACCAGGTGGCTGG - Intergenic
1153994528 18:10428811-10428833 CAGCAGCAGGAGCAGGGCACAGG + Intergenic
1154032520 18:10766224-10766246 GAGGAACAGGAGGAGGAGGAGGG + Intronic
1154148341 18:11885195-11885217 CAGCATCATGAGCTGGATGCAGG + Exonic
1154374033 18:13794070-13794092 GAGCAAGAGGAGCAGGTGGACGG - Intergenic
1154456054 18:14526609-14526631 CAGCAGCAAGAGCAGGAGCGAGG + Intronic
1155707030 18:28828662-28828684 CAGCAACAGTAGCAGGATTTTGG - Intergenic
1156748455 18:40421006-40421028 CAGGAACAGAGGCAGGAGGCTGG - Intergenic
1157476774 18:48028879-48028901 CAGCCACAGCAGGAGGAGGTAGG - Exonic
1157513084 18:48292490-48292512 CAGGGACAGGCGCAGGAGGAGGG - Intronic
1157610075 18:48950534-48950556 CAGCAGCAGCAGCAGGGGCCCGG + Exonic
1158722195 18:59935434-59935456 CAGCATTAGGAGCAGGATGAAGG - Intergenic
1159102221 18:63970153-63970175 CAGCAGCAGCAGCAGGAGGTGGG + Exonic
1159588344 18:70303677-70303699 CAGCTACAGGAGGCTGAGGCAGG + Intronic
1160157185 18:76442762-76442784 CAGGGACACGAGCCGGAGGCGGG - Exonic
1160524202 18:79525557-79525579 CAGCGACAGGGACAGGAGGGAGG - Intronic
1160529237 18:79553879-79553901 CGGGAACGGGAGCGGGAGGCCGG - Intergenic
1160796025 19:945792-945814 CAGCACCAGCAGCAGGAGCCGGG - Intronic
1160933578 19:1582474-1582496 CAGCGACTGGGGCAGGAGGAGGG - Intronic
1160972119 19:1774175-1774197 TAGGGGCAGGAGCAGGAGGCAGG + Intronic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161021057 19:2011747-2011769 GAGGAGCAGGAGCAGGAGGGTGG - Intronic
1161383470 19:3978689-3978711 CAGCTACAGGAGGCTGAGGCAGG + Intronic
1161735159 19:5987698-5987720 TGGCAACAGCAGCAGCAGGCTGG - Intergenic
1161768310 19:6218620-6218642 CAGCTGCAGGAGGAGGAGGCGGG - Intronic
1161829568 19:6592502-6592524 CGAGAACAGCAGCAGGAGGCTGG - Intronic
1161847582 19:6720548-6720570 TAGTAGCAGGAGCAGCAGGCTGG + Exonic
1162018553 19:7858314-7858336 CAGCTACAGGAGCAGCAGGTAGG + Exonic
1162412356 19:10514193-10514215 GAGCAACAGCAGCAGGAAGAGGG + Exonic
1162426560 19:10600287-10600309 CAGCAACGGGAGGCTGAGGCAGG + Intergenic
1162481105 19:10927682-10927704 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1162715928 19:12633481-12633503 CAGGAAAATGAGCAGGAAGCAGG - Intronic
1163154249 19:15431561-15431583 CAACACCAGGGTCAGGAGGCTGG + Intronic
1163368771 19:16890356-16890378 CAGCAGCAGCAGCAGGTTGCTGG - Exonic
1163451344 19:17379165-17379187 GAGGAACAGGAGCAGGGAGCCGG + Intergenic
1163777490 19:19226887-19226909 CAGCAGCAGGAACCGGAGCCGGG + Exonic
1163784941 19:19270159-19270181 CTGCAGAAGGTGCAGGAGGCAGG - Exonic
1164039851 19:21484543-21484565 CAGAAACAGGAGGATGGGGCCGG - Intronic
1164324425 19:24179474-24179496 GAGGAAGAGGAGCAGGAGGATGG + Intergenic
1164430681 19:28185853-28185875 CAGCCTCATGAGGAGGAGGCTGG + Intergenic
1164442653 19:28291239-28291261 CAGCAGCAGTTGCTGGAGGCAGG - Intergenic
1164876868 19:31697051-31697073 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
1165194856 19:34093918-34093940 TGGCAACAGGAGCAAGAGGGAGG + Intergenic
1165277032 19:34763147-34763169 CATCAACAGATGCAGGAAGCAGG + Intronic
1165377006 19:35449875-35449897 CAGCAGCAGCAGGAGGAGGTCGG - Exonic
1165421876 19:35726168-35726190 GAGCAACATGAGCGGGAGACGGG - Intronic
1165714433 19:38035314-38035336 CAGCAAGAGGAGCAGGAACATGG - Intronic
1165828455 19:38718889-38718911 CGGCAGCAGGCCCAGGAGGCAGG - Intronic
1165886990 19:39085282-39085304 CAGTAACAGGACCAGTAGCCAGG - Exonic
1166012113 19:39950249-39950271 CAGCAACAAGAGGAGTGGGCTGG + Intergenic
1166100648 19:40569685-40569707 CAGCTGCAGGAGAAAGAGGCAGG + Exonic
1166105737 19:40597266-40597288 CAGCAACAGCACCAGCAGGAGGG - Exonic
1166168235 19:41007735-41007757 CAGCTACAGGAGGCTGAGGCAGG - Intronic
1166604337 19:44127120-44127142 CAGCCAGAGGAGCAGGGGGTGGG - Intronic
1167291339 19:48626700-48626722 CAGCTACAGGAGGGTGAGGCAGG + Intronic
1167354288 19:48993672-48993694 GAGCAAAAGGAGGAGGAGCCAGG + Exonic
1167384393 19:49155546-49155568 GAGGAGGAGGAGCAGGAGGCAGG - Intergenic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1167570107 19:50281609-50281631 CGGCGCCAGGAGGAGGAGGCAGG + Exonic
1168298875 19:55391943-55391965 CACAAACACGGGCAGGAGGCTGG - Intronic
1168315495 19:55483173-55483195 CAGCCAGTGGAGCAGGGGGCTGG - Exonic
1168565532 19:57419175-57419197 CAGTAAAAGGAACAGGTGGCTGG - Intronic
924981712 2:228720-228742 CAGACGCAGGGGCAGGAGGCAGG + Intronic
925201379 2:1969812-1969834 CAGCAGGAGGTGCAGGAGGATGG + Intronic
925647807 2:6054812-6054834 CAGGAACAGTGGCAGGGGGCAGG - Intergenic
927508569 2:23630144-23630166 CAGCACCAGGAGTGGGAGCCAGG + Intronic
927562810 2:24085301-24085323 CAGCCCCAGGAGAAGGATGCTGG + Intronic
927640846 2:24844397-24844419 AGGCCACAGGAGCAGGAGCCAGG + Intronic
927932760 2:27055841-27055863 CAGAAACAGGAGCATCAGGAGGG - Exonic
928391470 2:30914054-30914076 CAGCAGCAGCAGCAGCAGCCTGG - Intronic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
930060704 2:47286100-47286122 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
931302711 2:60996616-60996638 AAGCAACAGCAGCATGAAGCAGG + Intronic
931799657 2:65746492-65746514 GAGCAGAAGGAGCAGGAGGAAGG + Intergenic
932233558 2:70102711-70102733 CAGCAGGTGGGGCAGGAGGCCGG - Intergenic
934307971 2:91841731-91841753 GGGCAGCAGGAGCAAGAGGCAGG - Intergenic
934673501 2:96232248-96232270 CAGCCACAGGATCACTAGGCTGG - Intergenic
934767035 2:96885456-96885478 CAGTACCACGAGCAGGAGCCAGG - Intronic
934858457 2:97743630-97743652 CATAAACAAGAACAGGAGGCCGG - Intergenic
935408712 2:102736725-102736747 CGGAAACAGGAGCAGAAGACAGG - Exonic
935504672 2:103885405-103885427 AAGGAAGATGAGCAGGAGGCTGG + Intergenic
935632693 2:105224860-105224882 CAGCAGCACGAGGAGGAGGAGGG - Intergenic
935808165 2:106769452-106769474 CAGCAGCAGAAACAAGAGGCTGG - Intergenic
936598128 2:113868896-113868918 CAGCAGCAGCAGCAGAAGGAAGG + Intergenic
937022525 2:118671364-118671386 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
937258348 2:120570142-120570164 CAGCAGCCTGAGCAGGAGGTGGG - Intergenic
937334107 2:121050397-121050419 CTGCGACTGGAGCAGGAGGCTGG - Intergenic
937343200 2:121104980-121105002 CAGCAGGAGGAGCAGCAGGCCGG + Intergenic
937368016 2:121279061-121279083 TACCAACAGGAGCAGGGGCCAGG + Intronic
937440134 2:121908319-121908341 CAGATGCAGGTGCAGGAGGCTGG + Intergenic
937825707 2:126366568-126366590 TTACAACAGAAGCAGGAGGCTGG - Intergenic
938114043 2:128591388-128591410 CAGCAACAGGGGAGGAAGGCAGG - Intergenic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
938364134 2:130720591-130720613 CACTAGGAGGAGCAGGAGGCAGG + Intergenic
938475534 2:131608234-131608256 CAGCAGCAAGAGCAGGAGCAAGG - Intergenic
938548944 2:132361715-132361737 CAGCCTCAGGCGCAGGAGGGAGG - Intergenic
939590889 2:144062225-144062247 GATGAACAGGTGCAGGAGGCGGG - Intronic
940048696 2:149437731-149437753 CAGGCTCAGGAGCAGGAGCCAGG - Exonic
940748564 2:157597612-157597634 TGGCAGCAGAAGCAGGAGGCAGG + Intronic
940962208 2:159798157-159798179 CAGCAACGGCAGCAGGAGCGCGG + Exonic
941047097 2:160688933-160688955 CAGCACAAGGATCAGGGGGCTGG - Intergenic
942342833 2:174967228-174967250 CAGCTACTGGGGTAGGAGGCAGG + Intronic
942461169 2:176169844-176169866 CAGCAACAGCACCAGCAGCCTGG - Intronic
942678313 2:178451144-178451166 GAGCAACGCAAGCAGGAGGCGGG - Exonic
942813425 2:180023418-180023440 CAGAAAAAGGAGCATGATGCTGG + Intergenic
943064359 2:183070998-183071020 CAGCCACAGGAGGGGCAGGCTGG + Intergenic
943104622 2:183529099-183529121 CAGAAGCTGGAGCAAGAGGCAGG - Intergenic
943464958 2:188217867-188217889 AAGAAAAGGGAGCAGGAGGCTGG - Intergenic
944239586 2:197472884-197472906 CACCAGCAGGAAGAGGAGGCTGG - Intronic
944315244 2:198277733-198277755 CAGGATCTGGAGCAGGAGGAGGG - Intronic
944581208 2:201134194-201134216 CAGCTACAGGAGGTGAAGGCAGG + Intronic
944771621 2:202920264-202920286 CAGCTACAGGAGTCTGAGGCAGG - Intronic
945148608 2:206764743-206764765 CTACAACAGGAGCAGGAGCCAGG - Intronic
945225771 2:207530139-207530161 GAGGAGCAGGAGGAGGAGGCAGG + Intronic
946149366 2:217753769-217753791 CAGTAACTGGAGAAGGGGGCAGG + Intronic
946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG + Intronic
946195673 2:218032070-218032092 CAGCCTCAGGAGCAAGAGGTTGG - Intergenic
946211236 2:218149051-218149073 CAGCACCAGGAGTAGGAAGGTGG - Intergenic
946211451 2:218150461-218150483 CAGCACCAGGAGCAGGAAGGTGG - Intergenic
946306626 2:218860057-218860079 CAGCAGCAGCAGCCCGAGGCGGG - Exonic
946329422 2:219001216-219001238 CAGGAACCGGGACAGGAGGCTGG + Intergenic
946429090 2:219615103-219615125 CAGCAACAGGGATACGAGGCAGG - Exonic
946496120 2:220197207-220197229 CACCAACAGAAGCAGTAGGCAGG + Intergenic
946716501 2:222559177-222559199 CAGCGAGAGGAGCAGGGGCCGGG - Exonic
946865621 2:224039144-224039166 CCGCAACCGGAGCGGGAGCCTGG + Intronic
946896261 2:224327639-224327661 CAGCTATAGAAGCAGGAGGCGGG - Intergenic
947182480 2:227423781-227423803 GAGCAGCAGGACCAAGAGGCGGG + Intergenic
947618832 2:231575867-231575889 CAGCACCCAGAGCAGGAGGGAGG + Intergenic
947722584 2:232378813-232378835 CAGCAGCAGCAGCAGCATGCAGG - Exonic
947948220 2:234124765-234124787 CAGGGACAGCAGCAAGAGGCTGG - Intergenic
948061544 2:235046103-235046125 CATCTGCAGGAGCTGGAGGCCGG - Intronic
948923851 2:241081606-241081628 CAGCAACATGTCCATGAGGCAGG + Intronic
1169211677 20:3769165-3769187 CAGAAAGAGGCGGAGGAGGCAGG - Intergenic
1169422768 20:5473199-5473221 CACCAACAGGCGCATGTGGCAGG + Intergenic
1169657785 20:7944121-7944143 CACCAAAAGGAGCAGGAGAGAGG + Intergenic
1170317895 20:15062202-15062224 CAGCCTCAGGAGAAAGAGGCTGG + Intronic
1170458340 20:16554063-16554085 CATGAACAGCAGCAGGAGACAGG + Intronic
1170570540 20:17629822-17629844 GAGCAACAGCAGCAGATGGCCGG - Exonic
1170999111 20:21396194-21396216 CAGCAGCTGCAGCAGGAGGGCGG - Exonic
1171255943 20:23689109-23689131 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171272356 20:23826800-23826822 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171433934 20:25104651-25104673 CAGCAAGAGGAACCGGGGGCTGG + Intergenic
1172448105 20:35003572-35003594 CAGCATCAGGATCACCAGGCTGG + Exonic
1172520508 20:35562654-35562676 CAGCAACAGGAGCTGCAGTCAGG + Intergenic
1172930330 20:38581975-38581997 CACCAAGAGGAGCAAGAGGTGGG + Intronic
1174808256 20:53623534-53623556 CAGCACGAGGAGGAGGAGGAGGG - Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175952465 20:62590775-62590797 CACCCGCAGGATCAGGAGGCAGG - Intergenic
1175997172 20:62817087-62817109 CAGGAGCAGGAGCAGGAGCGGGG - Exonic
1176085039 20:63292084-63292106 CAGCTACCAGAGCAGCAGGCAGG + Intergenic
1176818108 21:13626731-13626753 CAGCAGCAAGAGCAGGAGCGAGG - Intronic
1176857749 21:13985483-13985505 CAGGATCAGGGCCAGGAGGCTGG - Intergenic
1178254951 21:31043981-31044003 CAGCATCTGCAGCAGGAGCCTGG - Intergenic
1178506948 21:33170207-33170229 CAGCAGAGGGAGGAGGAGGCAGG - Exonic
1179073761 21:38098700-38098722 CAGGAAAGGGAGTAGGAGGCAGG - Intronic
1179416242 21:41200771-41200793 CAGCAAGAGGAGCAAGAGGACGG + Intronic
1179799320 21:43803549-43803571 GAGGAAGAGGAGCAGGAGGAGGG + Exonic
1180140124 21:45888173-45888195 GAGCTGCAGGAGCAGGAGGAGGG - Intronic
1180535053 22:16388814-16388836 GGGCAGCAGGAGCAAGAGGCAGG - Intergenic
1180800668 22:18630477-18630499 AAGGAACAGGAGCAGCCGGCAGG - Intergenic
1180851900 22:19026034-19026056 AAGGAACAGGAGCAGCCGGCAGG - Intergenic
1180874890 22:19170614-19170636 CAGGAACAGGAGAAGGAGTCAGG - Intergenic
1181043015 22:20201754-20201776 CAGCACCAGGAGCAGGGGTGAGG + Intergenic
1181171448 22:21012415-21012437 CAGCAACACCAGCAGGACCCAGG + Intronic
1181221051 22:21364785-21364807 AAGGAACAGGAGCAGCCGGCAGG + Intergenic
1181450962 22:23020394-23020416 ATGCATCAGGAGTAGGAGGCAGG + Intergenic
1181647667 22:24242606-24242628 CAGAAAAAAGAGCAGGAGACTGG + Intronic
1181749372 22:24978088-24978110 CCGCAACAGCCCCAGGAGGCAGG + Intronic
1181873993 22:25925606-25925628 CAGAAACTTGAGCAGGTGGCTGG + Intronic
1181935275 22:26433809-26433831 CACGAAGAGGACCAGGAGGCAGG - Exonic
1181985095 22:26794981-26795003 CAGGAACAGGAGCAAGGTGCAGG - Intergenic
1182090923 22:27594354-27594376 CAGCAACAACAGCAGAGGGCAGG - Intergenic
1182104987 22:27682765-27682787 CAGCCCCAGGAGCAGGTGACGGG + Intergenic
1182106755 22:27695205-27695227 CAGGAAGAGGAGAAAGAGGCGGG + Intergenic
1182428689 22:30288109-30288131 CAGCAGCAGGAGGAGGAGCTAGG + Intronic
1182460748 22:30481885-30481907 CAGCAGCAGGAGCAGGAGGGCGG + Intergenic
1182678492 22:32059482-32059504 CATAAACAAAAGCAGGAGGCAGG + Intronic
1182696615 22:32203019-32203041 CAAGAACAGGAGGAGGTGGCCGG + Exonic
1182775642 22:32829293-32829315 CACCAACAGGAACAGTAAGCTGG - Intronic
1183157799 22:36088611-36088633 CGGCCACAGGAGCAGGAGTGAGG + Intergenic
1183284489 22:36953531-36953553 AAGCAAGGGGAGCAGGAGGAGGG + Intergenic
1183325096 22:37187123-37187145 TAGCAGCAGGAGAAGGGGGCTGG + Intronic
1183360468 22:37380498-37380520 CAGCTCCAGGAGCAGGTGGGGGG + Intronic
1183507001 22:38214861-38214883 GGGCACTAGGAGCAGGAGGCCGG - Exonic
1184013905 22:41770939-41770961 CAGCAAGATGAGCAGGATGCTGG - Exonic
1184362416 22:44026327-44026349 CAGGAGGAGGAGCAGGACGCCGG + Intronic
1184406784 22:44304955-44304977 GAGCACCAGGAGCAGGGGCCAGG - Intronic
1184621011 22:45676889-45676911 CAGCTACTGGGGAAGGAGGCAGG - Intronic
1184761255 22:46545958-46545980 CAGCAACAGCATCAGGGGGTGGG - Intergenic
1184881527 22:47307473-47307495 CAGCAAGAAGGGAAGGAGGCTGG - Intergenic
1184925290 22:47632204-47632226 CAGCAGCAGCAGCAGCAGCCCGG + Intergenic
1184997938 22:48223934-48223956 TAGCATCAGGACCAGGAAGCTGG - Intergenic
1185039553 22:48497355-48497377 CAGAAACAGGGGCAAGGGGCTGG - Intronic
1185261349 22:49865956-49865978 CAGCATCGGGAGGTGGAGGCGGG - Intronic
1185330597 22:50250558-50250580 CACCAGCAGGAGCAGGGGGGCGG + Intronic
1185336163 22:50271734-50271756 CAGCTAAAGGAGGAGGAGGCCGG + Intergenic
1185372082 22:50465631-50465653 CAGTAGCAGAAGCAGGAGCCTGG - Intronic
949940637 3:9151704-9151726 CAGCAACAGGGTCAGCAGGTTGG + Intronic
950001612 3:9660880-9660902 TAGCAACAGAAACAGGAGGCAGG - Intronic
950131591 3:10550935-10550957 CAGCCACAGGAACAGCAGGCCGG - Intronic
951556546 3:23926415-23926437 GAGCAAGAGGAGGAGGAGGAAGG - Intronic
951679936 3:25284060-25284082 CAGCAAAATGAGAAGGAGGGAGG - Intronic
951934006 3:28001702-28001724 GAGAAACAGGAGCAGGAAGAGGG + Intergenic
952210742 3:31226765-31226787 CAGCAAGAGAAGGAGCAGGCAGG + Intergenic
952282831 3:31939845-31939867 CAGCTACAGGAGGCTGAGGCAGG - Intronic
952641804 3:35605092-35605114 CAGCAACAACATCAGGAGGAAGG + Intergenic
952886004 3:38011264-38011286 CAGCAGCGGGAGGAGGCGGCAGG - Exonic
952902207 3:38117778-38117800 CAGCCACAGAGGTAGGAGGCAGG - Intronic
952942490 3:38454762-38454784 CAGCAGCAGCAGCAGCATGCGGG + Intronic
952991269 3:38832998-38833020 CAGAAGCAGGAGCTGCAGGCAGG + Intergenic
953347049 3:42184979-42185001 CAGCAGCAGGAGCTGCAGGAAGG - Intronic
954108067 3:48419813-48419835 CAGGAACAGTGGCAGGGGGCAGG + Exonic
954273509 3:49527408-49527430 CAGCTACAGGAGAATGAGGCAGG + Intronic
954579064 3:51693253-51693275 CGGCAGCAGGCGCAGCAGGCTGG + Intronic
954798207 3:53172213-53172235 CAGCAAGAGGAACAGGAGGTGGG - Intronic
954924998 3:54226292-54226314 AAGCATCAGGGGCAGGAGGCGGG - Intronic
955229885 3:57089369-57089391 CAGCAACAGTAGCAGAGGCCAGG + Intergenic
956609144 3:71104392-71104414 CAGCAACAGCAGCAGAAGGGCGG - Intronic
956681381 3:71785011-71785033 CAGCAAGAGGAGCAGGAGTGGGG + Exonic
956754830 3:72374121-72374143 CAGCACCTGCAGCAGCAGGCAGG + Exonic
958931634 3:100213819-100213841 CAACAACAGAAGCAGGAGGTTGG + Intergenic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960350374 3:116585715-116585737 AAGGAAGAGGAGGAGGAGGCTGG + Intronic
960467425 3:118014457-118014479 CAGCTACAGGAGGCTGAGGCAGG - Intergenic
961158150 3:124698270-124698292 GAAAAACAAGAGCAGGAGGCCGG - Intronic
961319970 3:126065995-126066017 AAGCATCAGTACCAGGAGGCAGG - Intronic
961432763 3:126894683-126894705 CAGCAGACGGAGCAGGAGGCTGG + Intronic
962049750 3:131800601-131800623 CAACATCAGGAGCAGTAGGAGGG - Intronic
962338652 3:134562312-134562334 GAGAGAGAGGAGCAGGAGGCTGG + Exonic
962364975 3:134772814-134772836 CTGCCACAGGAGCTGAAGGCGGG + Intronic
962530789 3:136277907-136277929 CAGCCACAAGTGCAGGAGCCAGG - Intronic
963681353 3:148381822-148381844 CAGCAAAGATAGCAGGAGGCAGG + Intergenic
964006266 3:151832967-151832989 GAGCAAGAAGAGCAGGAGGAGGG + Intergenic
965026050 3:163303323-163303345 CAGCAACAGCAGCATGTTGCAGG + Intergenic
965587013 3:170327703-170327725 CAGGAGCAGGAGCGGGAGGTGGG - Intergenic
966017049 3:175153262-175153284 AAGCAACAGCAGCTGGAGACTGG - Intronic
966762305 3:183428758-183428780 CAGGACCCGGAGCGGGAGGCTGG + Intronic
967307250 3:188070830-188070852 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
967829805 3:193909297-193909319 CAGGAGCTGGGGCAGGAGGCAGG + Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968262120 3:197333974-197333996 CAGCAGCAGCAGCAGGAGCTAGG + Intergenic
968568511 4:1327396-1327418 CAGCTGCAGGAGCAGGGGGCGGG + Intronic
968903590 4:3442054-3442076 CAGCAGGAGGAGGAGGAGGAAGG - Exonic
969054563 4:4393538-4393560 CAGCCACAGGAGGTAGAGGCAGG - Intronic
969463815 4:7343113-7343135 CGGCAACAGGAGCATTAGGAGGG + Intronic
969960963 4:10944466-10944488 CACAAACAGGAGCAGCAAGCAGG - Intergenic
970011958 4:11469063-11469085 CAGCAACAGGTGCATGAGGAAGG + Intergenic
970506730 4:16738384-16738406 CAGGAAGAGGAGGAGGAGGAAGG + Intronic
973075789 4:45924200-45924222 GAGCAAAAGGAGCCAGAGGCAGG - Intergenic
973916078 4:55636112-55636134 CAGCAGCAGCAGCAGGAGCGGGG + Exonic
974717715 4:65691859-65691881 CAGCTACAGGAGGTTGAGGCAGG + Intergenic
975096473 4:70462859-70462881 CAGGAACTGCAGCAGGAGGATGG + Intronic
975393488 4:73848021-73848043 CAGCAACAGGTGCAGGCAGCAGG - Intronic
975665183 4:76728055-76728077 CAGCATCCTGAGTAGGAGGCTGG - Intronic
975730632 4:77334189-77334211 CAACATTAGGAGCTGGAGGCTGG + Intronic
975767515 4:77684479-77684501 CAGTAACAGGAGGGGGAGGTAGG - Intergenic
976088181 4:81427732-81427754 AAGCAGCAGCAGCAGCAGGCAGG + Exonic
976206338 4:82626564-82626586 CAACATCAGAAGCAGGAGGAGGG - Intergenic
976295675 4:83468878-83468900 CAGTAACAGGAGTATGAGGAAGG + Intronic
976790982 4:88878174-88878196 CAGCTACAGGAGGCTGAGGCAGG + Intronic
976974944 4:91154484-91154506 CAGGAGCAGGAGCAGGAGCAGGG - Intronic
978159377 4:105527324-105527346 CAGCACCAGGAGCAGCTGGAGGG - Intergenic
978490066 4:109302788-109302810 CAGCAGCGGGAGCGGCAGGCCGG - Intergenic
979279309 4:118847323-118847345 CAGCCTCAGGAACAGGAGGAAGG - Intergenic
979407845 4:120336998-120337020 CAGCAACAGGGGCATAAGGGTGG - Intergenic
979464822 4:121024027-121024049 CAGCTACAGGAGGCTGAGGCAGG - Intergenic
980843299 4:138293118-138293140 CAGCTACAGGAGGCTGAGGCAGG - Intergenic
981184588 4:141785970-141785992 CAGGAAGAGGAGGAGGAGGGGGG - Intergenic
981817098 4:148843097-148843119 CAGGAAGAGGAGAAGGAAGCAGG - Intergenic
982868346 4:160545629-160545651 GAGCCACAGGAGCAGTTGGCAGG + Intergenic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
983556674 4:169065254-169065276 CAGCTACAGGAGGCTGAGGCTGG + Intergenic
983577026 4:169271061-169271083 GAGGAAGAGGAGGAGGAGGCCGG + Exonic
983946760 4:173594945-173594967 CAGCTACAGGAGGATGAGGCAGG - Intergenic
984675304 4:182540473-182540495 CAGCTACGGGAGGCGGAGGCAGG + Intronic
984788635 4:183592884-183592906 CAGCAACACGACCAGGAGGTGGG + Intergenic
985164623 4:187079341-187079363 CAGGCACAGCAGCAGCAGGCAGG + Intergenic
985322466 4:188730140-188730162 CCGCTAAAGGAGGAGGAGGCTGG + Intergenic
985572720 5:658343-658365 CAGCAGCAAGGGGAGGAGGCCGG - Intronic
985573984 5:665297-665319 CTGCAAGAGGAGCAGGAGGAAGG + Intronic
985652172 5:1112300-1112322 CAGCAGGAGGGGCAGGGGGCTGG - Intergenic
985769231 5:1798753-1798775 CAGCAGATGGGGCAGGAGGCCGG + Exonic
985942502 5:3150006-3150028 CACCCATAGGAGCGGGAGGCCGG + Intergenic
985959330 5:3287808-3287830 CAGCTCCTGGAGCAGGAGGCTGG + Intergenic
986371879 5:7088143-7088165 CAGCACCTGGAGCAGATGGCTGG + Intergenic
986591216 5:9372916-9372938 CCGCAGGAGGAGCAGGTGGCAGG + Intronic
987062366 5:14254641-14254663 AAGAAACAGGAGGAGGAGGGTGG - Intronic
988565947 5:32320249-32320271 CATGAACAGCAGCAGGAGGCAGG - Intergenic
989341976 5:40386378-40386400 CAGCAACAGCAGCAGCAGCTGGG - Intergenic
991370676 5:65916305-65916327 CAGGAACAGCTGCAGGAGTCAGG - Intergenic
991907515 5:71526797-71526819 CAGCTACAGGAGGCTGAGGCAGG - Intronic
992273636 5:75091774-75091796 TAGCAACAGTAGCTGGGGGCAGG - Intronic
992365138 5:76083275-76083297 CAGCACCAGGGGGAGGAGGCAGG + Exonic
992666415 5:79013767-79013789 CAGGAGCAGGAGCAAGAGACAGG + Intronic
992667126 5:79021458-79021480 CAACAGCAGGGGAAGGAGGCTGG + Intronic
994320717 5:98392013-98392035 CAGCCGCAGGAGCAGTAGTCTGG + Intergenic
994497794 5:100535577-100535599 CAGCAACAGCAGGAGGAGGACGG - Exonic
994840721 5:104922210-104922232 CAAGAACAGGAGCAAGAGGAGGG - Intergenic
995340996 5:111059401-111059423 CAGCTACAGGAGGCTGAGGCAGG - Intergenic
995455363 5:112346335-112346357 CAGCTACAGGAGGCTGAGGCAGG - Intronic
997887326 5:137641854-137641876 CAGCAGCAGCAGCTCGAGGCTGG - Intronic
998477199 5:142431998-142432020 CAGCATGGTGAGCAGGAGGCGGG + Intergenic
999173904 5:149618271-149618293 CAGCTGCTGAAGCAGGAGGCGGG + Exonic
999230648 5:150059912-150059934 CATGAACAGGAGCATGAGACTGG + Intronic
999491978 5:152060220-152060242 GTGCAACAGGGGCTGGAGGCAGG + Intergenic
1000116085 5:158154633-158154655 CAGCAACAGAAGCAGGTGCCAGG + Intergenic
1000329857 5:160197990-160198012 GAGAAAGAGGAGCAGGAGGTGGG + Intronic
1000926316 5:167198840-167198862 CAGCAACAGCGGCAGGAGAAAGG + Intergenic
1001400112 5:171441359-171441381 CTGCAGCAGGATCAGGAGCCAGG - Intronic
1001546454 5:172573570-172573592 CAGCAACAGGAGGAGAAAGAAGG - Intergenic
1001548351 5:172584480-172584502 CAGCAAGAGGGGCTGGAGGTGGG + Intergenic
1001554438 5:172626355-172626377 CAGCAAGAGGAGAAGGAGAGAGG - Intergenic
1002078830 5:176725925-176725947 GGGCACCAGGAGCAGGCGGCTGG + Intergenic
1002447140 5:179296516-179296538 CAGCAAGGAAAGCAGGAGGCGGG + Intronic
1002774492 6:317303-317325 CAGCAAGAGGAACACGTGGCAGG - Intronic
1002861362 6:1082389-1082411 CAGAACCAGGAGCAGGACCCAGG + Intergenic
1003113878 6:3270503-3270525 CAGCCTGAGGAGGAGGAGGCCGG - Exonic
1003592890 6:7450474-7450496 CAGCAGCAGCAGCAGGAGAAAGG + Intergenic
1004421259 6:15472205-15472227 CAGAAACAGCAGTAGGAGGTGGG - Intronic
1005830954 6:29670779-29670801 AAGCAACAAGAGGAAGAGGCGGG + Intronic
1005883016 6:30074714-30074736 GAGGAGCGGGAGCAGGAGGCTGG - Intronic
1005989338 6:30893350-30893372 GAGCAGCAGGAGCAGGATGATGG - Exonic
1006171966 6:32098148-32098170 CAGCACCAGGAGAACCAGGCTGG + Intronic
1006368921 6:33632684-33632706 CAGCAGAGGGAGCAGGAGGATGG - Intronic
1006634566 6:35452622-35452644 CAGCGCCTGCAGCAGGAGGCGGG - Exonic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1007418041 6:41703428-41703450 CAGGAGCAGGGGCAGGAGCCAGG - Intronic
1007446062 6:41907082-41907104 CAGCAGCAGGTGCCGGTGGCTGG - Exonic
1007599957 6:43075569-43075591 CAGCAAGGGGTGTAGGAGGCGGG - Intergenic
1007654838 6:43445762-43445784 CGGCAGCAGGAGCAGCAGCCAGG - Exonic
1007943285 6:45802157-45802179 CAGCACCAGGAGGATGTGGCCGG + Intergenic
1008311443 6:49979908-49979930 CAGCAACAGAAGCACGGAGCAGG - Intergenic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010155292 6:72785351-72785373 CAAGAACAGGAGCAGGGGTCAGG + Intronic
1010373705 6:75141425-75141447 CAGCAGACGGAGCAGGAAGCAGG + Intronic
1012767553 6:103387589-103387611 CAGCCACAGGAGGAGGAGCTGGG + Intergenic
1012889906 6:104885888-104885910 CATGAACGGCAGCAGGAGGCAGG + Intergenic
1013425624 6:110010095-110010117 CAGCAACAGAAGCAAAAAGCAGG + Intergenic
1013803324 6:113970932-113970954 CAGCAGCAGGAGGAGGAGCCCGG - Exonic
1014563329 6:122917494-122917516 CAGTAACCTGAGCAGGAGCCTGG - Intergenic
1014994525 6:128125373-128125395 CAGGAGCAGGAGCAGGATGGGGG - Intronic
1015214302 6:130732171-130732193 CAGCAACTGGAGTTTGAGGCCGG - Intergenic
1015874482 6:137809039-137809061 CAGCAACAGGAGGATGGGGTGGG + Intergenic
1016026418 6:139291989-139292011 CAGCAACAGCAGGAGAGGGCGGG + Exonic
1016234531 6:141847205-141847227 CAGAAACAGAAACAGGAGGAAGG - Intergenic
1016466826 6:144334211-144334233 CAGCAACAGGTGCAGCATTCCGG - Intronic
1016969541 6:149749622-149749644 CAGCCACAGGGGCGGGCGGCTGG + Exonic
1016986710 6:149900814-149900836 CAGCAAAAGGAGAAGCAGTCTGG - Intergenic
1017164207 6:151391740-151391762 GAGCAGCAGGAGGCGGAGGCGGG - Intergenic
1017450341 6:154548982-154549004 CAGCTACAGGAGGCTGAGGCAGG - Intergenic
1017688819 6:156942741-156942763 AAGCAATAGGAGGAGGAGGATGG - Intronic
1018569163 6:165188633-165188655 AAGCAACAGGAAAAGGAGGGTGG - Intergenic
1019034811 6:169045514-169045536 CACCAAAAAGAGCAAGAGGCCGG - Intergenic
1019165536 6:170095477-170095499 CAGGAACAAGCGCAGGGGGCTGG - Intergenic
1019168742 6:170116843-170116865 CAGGAGGAAGAGCAGGAGGCTGG + Intergenic
1019320318 7:412157-412179 CAGCAGCAGGAACAGGTGGGAGG + Intergenic
1019382449 7:731068-731090 CAGCAAGAAGTGCAGGCGGCCGG + Intronic
1019484192 7:1281141-1281163 CAGCAGCAGCAGCAGCAGCCAGG + Intergenic
1019660734 7:2222690-2222712 CAGCTTCAGGAGCGGGAGGCCGG - Exonic
1019767045 7:2859141-2859163 CAGCTACAGGAGGCTGAGGCTGG + Intergenic
1019959823 7:4449798-4449820 CAGCAGCAGGAGCAGGGGGAAGG - Intergenic
1020055982 7:5117750-5117772 TAGCACCAGCAGCAGCAGGCAGG - Intergenic
1020138596 7:5599861-5599883 CACCCACAGGAGAGGGAGGCTGG - Intronic
1021117040 7:16755242-16755264 CACCAACAGGAGAAGGAGGTTGG + Intronic
1021446293 7:20737044-20737066 CAGCTTCAGGAGGTGGAGGCAGG + Intronic
1021993614 7:26159161-26159183 CAGCAAGAGCAGCTGGGGGCTGG - Intronic
1022268647 7:28784462-28784484 AAGCAAAATGAGCAGGAGGGAGG - Intronic
1022834079 7:34097178-34097200 CAAAAAGAGGAGCAGGAGGCTGG + Intronic
1023289730 7:38656633-38656655 CAGCCACAGGAGGGGCAGGCTGG - Intergenic
1024299531 7:47876569-47876591 CAGCAGGAGGAGCAGGAGGGAGG + Intronic
1024377746 7:48658266-48658288 CAGCAACAGGACCTGGAGCCTGG + Intergenic
1024698641 7:51883403-51883425 CAGGAGCAGGGGTAGGAGGCAGG - Intergenic
1024972711 7:55085384-55085406 CAGCATGGGGAGCAGGATGCTGG + Intronic
1025070266 7:55892164-55892186 CAGCTACAGGAGGCTGAGGCTGG + Intronic
1025189893 7:56888403-56888425 CACCACCAGGAGTAGGAGGTAGG - Intergenic
1025682046 7:63688518-63688540 CACCACCAGGAGTAGGAGGTAGG + Intergenic
1027252980 7:76410656-76410678 CAGCATCATGACCAGGAGTCAGG - Intronic
1028888132 7:95957441-95957463 CAGCAGCAGGAGGAGGAGGAGGG - Intronic
1029110943 7:98212769-98212791 CAGCAGCAGCAGCAGGTGGCTGG + Exonic
1029112255 7:98218310-98218332 CAGAAAGAGGATCAGGAGGCCGG - Intronic
1029479085 7:100802209-100802231 CAGCCACTGGAGAGGGAGGCTGG - Intergenic
1029793291 7:102867812-102867834 CAGCTACAGGAGGCTGAGGCAGG - Intronic
1030892085 7:115011153-115011175 CAGAAACAGGATCAGGACCCAGG - Intronic
1031798794 7:126214814-126214836 CAACAGCAGGAGCAAGAGGATGG - Intergenic
1032017395 7:128388808-128388830 GAGCAGGTGGAGCAGGAGGCTGG + Intergenic
1032149014 7:129411645-129411667 CAGCTACAGGAGTGTGAGGCAGG + Intronic
1032198094 7:129800815-129800837 CAGCATCTGCAGCATGAGGCAGG + Intergenic
1032312759 7:130803575-130803597 CAGCAGGAGGAGGAGGATGCTGG + Intergenic
1032511170 7:132473435-132473457 TAGCTACAGAAGCAGGAGACAGG - Intronic
1033279403 7:139995158-139995180 CGGTAAGAGGAGCAGGAAGCAGG + Intronic
1033492367 7:141855796-141855818 CAGCCACAGGAGCAGGAGCTAGG - Intergenic
1033600012 7:142882587-142882609 CAGGAACATGAGCTGGAGGGAGG - Intronic
1033611785 7:142970295-142970317 CAGCAAAAGGAGCAGGAAAAGGG + Intergenic
1033657278 7:143382255-143382277 CAGCAAGGGGAGGTGGAGGCAGG - Exonic
1033673015 7:143511272-143511294 CAGCAGCAGCAGCACCAGGCAGG + Intergenic
1033953759 7:146817650-146817672 CAGGAACAAGAGCAAGAGGAAGG + Intronic
1035057537 7:156046097-156046119 CAGGAGCAGGAGCAGGAGAGAGG + Intergenic
1035095725 7:156353381-156353403 CAGGAACTGGAGCAGGAGTGGGG - Intergenic
1035223830 7:157422714-157422736 GAGTAACAGGATGAGGAGGCCGG - Intergenic
1035392793 7:158516611-158516633 CAGCACCAGGAACAATAGGCAGG - Intronic
1035392802 7:158516679-158516701 CAGCACCAGGAACAATAGGCAGG - Intronic
1035689297 8:1549275-1549297 CAGCAAGAGGAGCAAGAGCAAGG + Exonic
1036155390 8:6337459-6337481 CAGGAATAGGAGCAGGATGAAGG - Intergenic
1036579689 8:10062230-10062252 CAGCAGCAGCAGCAGCTGGCTGG + Intronic
1036652165 8:10651611-10651633 CAGCTACAGGAGGCTGAGGCAGG + Intronic
1037759051 8:21729856-21729878 CAGAAACAGGAGCTCCAGGCAGG - Intronic
1037918608 8:22788102-22788124 GAGAACCAGGAGCAGCAGGCAGG + Intronic
1037934253 8:22904039-22904061 CAGTCACAGTGGCAGGAGGCAGG - Intronic
1038290991 8:26249763-26249785 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
1038428601 8:27481754-27481776 CAGGAATTAGAGCAGGAGGCTGG - Intergenic
1039161299 8:34624760-34624782 CAAAAACAGGAGCAAGAGGGTGG + Intergenic
1039455682 8:37704526-37704548 CAGCCACAGGAGCTGGAGGAGGG + Intergenic
1039512709 8:38104833-38104855 CATCAACAGTAGCTGGTGGCTGG - Intergenic
1040683537 8:49842600-49842622 CATGAACAGGTGCAGGAGCCAGG - Intergenic
1041135813 8:54757639-54757661 CAGACACAGAAGCAGGAGACAGG + Intergenic
1041236253 8:55805768-55805790 CAGCTACAGGAGGCTGAGGCAGG + Intronic
1041343781 8:56873976-56873998 AAGCAATGGGAGCAGGAGGATGG + Intergenic
1041359043 8:57030893-57030915 CAGCACCAGTAGTGGGAGGCAGG - Intergenic
1041787046 8:61646947-61646969 CAGCAGCAGGAGCAGGTGTGTGG - Intronic
1042107924 8:65348588-65348610 GGGCAGCAGGAGCAGGAGGCAGG + Intergenic
1042312075 8:67388795-67388817 CAGGAGCAGGAGGAGGAGGGAGG - Intergenic
1042512233 8:69624123-69624145 TGGCAACAGGGGCAGGATGCTGG + Exonic
1043519141 8:81025721-81025743 CAGCCACAGGAGGAGGTGCCTGG + Intronic
1044586615 8:93874544-93874566 GGGCCACAGGAGCAGGTGGCAGG + Intronic
1045051966 8:98335675-98335697 CAGCCCCAGGAGCAGAAGGCTGG - Intergenic
1045400316 8:101809656-101809678 CAGCTACAGGAGGCTGAGGCAGG - Intronic
1045499398 8:102733431-102733453 CAGCAGCAGGAGCAGCAGCATGG + Intergenic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1045718319 8:105074905-105074927 CAGCAGCAGCAGCGGGAGGGAGG - Intronic
1046546072 8:115651651-115651673 CATAAACAGGAGCACAAGGCGGG + Intronic
1046554922 8:115762436-115762458 CTGCTACAGGAGTAAGAGGCAGG - Intronic
1047775907 8:128070236-128070258 CAGCAACAGGAGAAGCAAACAGG - Intergenic
1047961804 8:130016514-130016536 CAGCAGCAGCAGCAGCAGCCCGG + Intronic
1048956701 8:139543416-139543438 GAGCAAGTGGAGGAGGAGGCAGG + Intergenic
1049470608 8:142773605-142773627 CAGCCCCAGGAGCAGAACGCAGG + Intronic
1049478579 8:142808232-142808254 CAGCAGCAGCAGCAGTGGGCTGG + Intergenic
1049579563 8:143405123-143405145 CCCCAGCAGGAGCAGCAGGCAGG - Intergenic
1049799059 8:144509401-144509423 CAGCAGCACTGGCAGGAGGCCGG - Exonic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1049884010 9:15908-15930 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
1050192348 9:3040537-3040559 CAGTAGCAAGAGCAGGAGGCTGG - Intergenic
1050531986 9:6598882-6598904 AAGCAACAGGAACATAAGGCCGG + Intronic
1051973066 9:22914156-22914178 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1052416671 9:28186799-28186821 CAGCAAGAGGACCAGGGTGCCGG + Intronic
1052540493 9:29805025-29805047 TAGTAATAGGAACAGGAGGCAGG - Intergenic
1052849860 9:33371281-33371303 CAGCAGCAGGAACAGGTGACTGG + Intergenic
1053053113 9:34977585-34977607 CAGCAGCAGCAGCAAGAGTCAGG + Exonic
1053120858 9:35546767-35546789 CAGCACCAAGAGTAGGAGTCGGG + Exonic
1053460184 9:38262681-38262703 CAGCAAAAGAAACAGGTGGCAGG + Intergenic
1053751954 9:41266195-41266217 CAGCCTCAGGCGCAGGAGGGAGG + Intergenic
1054193044 9:62002181-62002203 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
1054257477 9:62830525-62830547 CAGCCTCAGGCGCAGGAGGGAGG + Intergenic
1054645365 9:67586510-67586532 CAGCTACAGGAGGCTGAGGCAGG - Intergenic
1054754272 9:68941400-68941422 CAACATCAGAAGCAGAAGGCAGG + Intronic
1055561062 9:77522229-77522251 TAGCAACAGTAGGAGAAGGCAGG + Intronic
1056180198 9:84075622-84075644 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
1056456533 9:86766163-86766185 CAGCAGCAGCTGCAGGAGGAGGG + Intergenic
1056579548 9:87880836-87880858 CAGCAGCAGGAGCAAGGGGCTGG + Intergenic
1056659282 9:88533032-88533054 CAGGCACAGGAGCAGGACTCAGG + Intergenic
1057043177 9:91862360-91862382 GAGCAGCAGGAGCAGCAGCCAGG + Intronic
1057353800 9:94319629-94319651 CAGGAGCTGGAGCAGGAGGAAGG - Exonic
1057653951 9:96937963-96937985 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1058732148 9:107860643-107860665 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
1058951807 9:109910901-109910923 CAGCAACTAGAACAGGATGCAGG + Intronic
1060187993 9:121575574-121575596 CAGCAACCTGAGCATGAGTCAGG - Intronic
1060406805 9:123376899-123376921 CAGGAGGAGGAGGAGGAGGCAGG - Exonic
1060531585 9:124350099-124350121 CAGCAGCAGCAGCAGGAAGCTGG - Intronic
1060720188 9:125971360-125971382 AAGCTACAGAGGCAGGAGGCAGG + Intergenic
1060798133 9:126526469-126526491 AAGCCTCAGGAGCTGGAGGCTGG + Intergenic
1061144829 9:128791512-128791534 GAGCAGCAGCCGCAGGAGGCAGG - Intronic
1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG + Intronic
1062083959 9:134639018-134639040 CATGAACAGGAGCAGGCAGCCGG + Intergenic
1062090731 9:134677511-134677533 CAGCATCAGGGGCAAGAGCCTGG - Intronic
1062192170 9:135253633-135253655 CAGGAAGAGGAGCATGAGGGCGG - Intergenic
1062196445 9:135276716-135276738 CTGCAATGGGAGCAGGAGGAGGG - Intergenic
1062212186 9:135371153-135371175 CAGCAGGGGGAGCTGGAGGCAGG - Intergenic
1062344592 9:136109063-136109085 GAGAAGCAGGGGCAGGAGGCAGG - Intergenic
1062479457 9:136744679-136744701 CACCAAGTGGAGCAGGAGCCTGG - Exonic
1203780235 EBV:96626-96648 CAGGAGCAGGAGGTGGAGGCCGG + Intergenic
1203529251 Un_GL000213v1:122773-122795 CAGCAGCAAGAGCAGGAGCGAGG + Intergenic
1185499042 X:583931-583953 AAACAAGAGGAGGAGGAGGCTGG + Intergenic
1186382940 X:9080213-9080235 CAACAACACAAACAGGAGGCAGG + Intronic
1188577096 X:31664611-31664633 CCTCAACTGGAGCAGGAGGCAGG + Intronic
1190187747 X:48250644-48250666 CAGCAACAACAGCAAAAGGCCGG + Intronic
1190303914 X:49071876-49071898 CTGGGACAAGAGCAGGAGGCTGG - Exonic
1190306460 X:49085576-49085598 CATAAAAAGAAGCAGGAGGCTGG + Intronic
1190418798 X:50206887-50206909 GAGCAAGAGGCACAGGAGGCTGG - Intronic
1190652202 X:52578123-52578145 CAGTCACAGGAGCAGCATGCAGG - Intergenic
1191225741 X:58040910-58040932 CAGCAACAGTAGCAGCATGGTGG - Intergenic
1192314301 X:70040056-70040078 CTGCAAAATGAGCTGGAGGCTGG - Intergenic
1192340964 X:70263050-70263072 AAGCAGTAGGAGCAGGAAGCTGG - Intergenic
1192538157 X:71946184-71946206 CACAGACAGGAGCAGGAGGCAGG + Intergenic
1194890497 X:99372313-99372335 CAGCACTCGGAGCAGCAGGCCGG - Intergenic
1195029759 X:100914908-100914930 GAGCACCAGAATCAGGAGGCGGG + Exonic
1195280615 X:103329592-103329614 CAGCAGCAGAAACAGGTGGCTGG + Intergenic
1195869709 X:109473197-109473219 CAGCAACAGGAAGTGGAGGAGGG - Intronic
1196754058 X:119142661-119142683 CAGCTACAGGAGGCTGAGGCAGG + Intronic
1196786092 X:119422688-119422710 CAGCAGGTTGAGCAGGAGGCAGG - Intronic
1197104996 X:122703134-122703156 TAGCAGCAGCAGCAGCAGGCAGG + Intergenic
1198273432 X:135077702-135077724 GAGCAATAGGAGTTGGAGGCAGG - Intergenic
1198497721 X:137209786-137209808 CAGGTCCAGAAGCAGGAGGCGGG + Intergenic
1199271294 X:145885600-145885622 CCGTAACAGGAGCAGGGGGTGGG - Intergenic
1199417307 X:147599952-147599974 CAGTAAGAGTAGCAGGAGGCTGG + Intergenic
1199600806 X:149540183-149540205 CAGCCACAGGAGAAGCAGGTCGG - Intergenic
1200054897 X:153455237-153455259 CAGGAACAGCACCTGGAGGCTGG + Intronic
1200111175 X:153741665-153741687 GGGCAGCAGGAGCAAGAGGCAGG - Intronic
1200184929 X:154175985-154176007 CAGCTCCAGGAGCTGGAGGAAGG - Intergenic
1200190582 X:154213123-154213145 CAGCTCCAGGAGCTGGAGGAAGG - Intergenic
1200196333 X:154250925-154250947 CAGCTCCAGGAGCTGGAGGAAGG - Intergenic
1200201988 X:154288043-154288065 CAGCTCCAGGAGCTGGAGGAAGG - Exonic
1201300196 Y:12498566-12498588 CAGCAGCAGGAGCGGCAGGGAGG - Intergenic
1201739734 Y:17311109-17311131 CAGCAGCAGGAGGAGGAGGAGGG - Intergenic