ID: 1120942096

View in Genome Browser
Species Human (GRCh38)
Location 14:89958363-89958385
Sequence GGTTAGGCTGACAACCGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 45}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120942091_1120942096 -3 Left 1120942091 14:89958343-89958365 CCTGCGTCCAAGAATAATGAGGT 0: 1
1: 15
2: 126
3: 538
4: 859
Right 1120942096 14:89958363-89958385 GGTTAGGCTGACAACCGAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 45
1120942093_1120942096 -10 Left 1120942093 14:89958350-89958372 CCAAGAATAATGAGGTTAGGCTG 0: 1
1: 2
2: 37
3: 109
4: 321
Right 1120942096 14:89958363-89958385 GGTTAGGCTGACAACCGAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 45
1120942089_1120942096 10 Left 1120942089 14:89958330-89958352 CCGAATTTCTTGTCCTGCGTCCA 0: 1
1: 8
2: 123
3: 400
4: 751
Right 1120942096 14:89958363-89958385 GGTTAGGCTGACAACCGAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120942096 Original CRISPR GGTTAGGCTGACAACCGAAG GGG Intronic
903551785 1:24162183-24162205 AGTTTTGCTGACAACCCAAGGGG - Intronic
913369711 1:118084321-118084343 GGTTAGGCTTACAAAGGAAATGG + Intronic
918458695 1:184754433-184754455 GGTGAGGCTGACAACAGGAGGGG - Intronic
919482655 1:198108560-198108582 TCTTAGGCTGACAATTGAAGAGG + Intergenic
921550913 1:216534750-216534772 GGTTCGTTTGACAACCGTAGGGG + Intronic
922760068 1:228123191-228123213 TCTAAGGCTGACAACCCAAGGGG + Intergenic
1067090618 10:43264350-43264372 GGTCAGGCTGACAGCCATAGGGG + Intronic
1069817928 10:71210332-71210354 GGTTAGGCTGAGAAGGGAAGTGG + Intergenic
1074627777 10:115212243-115212265 GGATAGGCTCAAAACCGGAGTGG - Intronic
1075008972 10:118851985-118852007 GGTTAGGCTGAGTCCCTAAGGGG - Intergenic
1075451854 10:122557249-122557271 GGTCAGACTGACACCTGAAGGGG + Intergenic
1079296322 11:19237882-19237904 GGTTTGTTTGACAACAGAAGTGG - Exonic
1089911887 11:122109079-122109101 GTTTAGGCTGGCAAGCAAAGAGG + Intergenic
1091979101 12:4851152-4851174 AGTTAGGCAGACAAGCCAAGCGG + Intronic
1093191667 12:16081921-16081943 GTTTAGGCTGAGAACCGACACGG + Intergenic
1094757919 12:33493225-33493247 GGATAGACTGCCAACTGAAGTGG + Intergenic
1111055074 13:82938438-82938460 GGTTAGGCAGACAACCAGAGAGG - Intergenic
1114849348 14:26364611-26364633 TGTTAGGGTGACAACTGCAGAGG - Intergenic
1117656391 14:57960805-57960827 AGTTAGGCTGACTACCAAGGAGG + Intronic
1118766150 14:68910588-68910610 GGTTAGGCAGGCAACTGAGGGGG + Intronic
1120942096 14:89958363-89958385 GGTTAGGCTGACAACCGAAGGGG + Intronic
1133403050 16:5502649-5502671 GGTTAGGCTGGGAGTCGAAGGGG + Intergenic
1135504225 16:23022245-23022267 AGATGGGCTGACAACTGAAGTGG + Intergenic
1137411776 16:48234730-48234752 GGTTATGCTGCCAACAGAAGTGG + Intronic
1155605012 18:27595234-27595256 GGTGAGGCTGACAAAAGATGAGG + Intergenic
1156626007 18:38909848-38909870 TGCTAGACTGACAACAGAAGAGG + Intergenic
1157118207 18:44882331-44882353 GGTCAGGCTGACAGCTCAAGTGG + Intronic
932415247 2:71569720-71569742 GGTGAGGCTGACATACGCAGGGG + Intronic
933016547 2:77135354-77135376 GGTTATGATGAAAACAGAAGGGG - Intronic
935233039 2:101115937-101115959 GGTAAGGCTGACAACATAAAAGG + Intronic
936236276 2:110745305-110745327 GGTCAGGCTGAAAACCAAAAAGG - Intronic
1170866402 20:20161681-20161703 GGTGTGGCTGACAACCTAACTGG - Intronic
1172083271 20:32358832-32358854 GGTGAGGCGGACAGCCGAGGGGG + Exonic
1173602047 20:44302397-44302419 GGTCAGGCTGACAAACGAGTGGG + Intergenic
960996972 3:123346584-123346606 GGTGAGGCTGACAGCAGTAGGGG - Intronic
963565938 3:146930672-146930694 AGTTAGCCTGACAAATGAAGTGG - Intergenic
964526902 3:157624711-157624733 AGTTATGCTGACTACCGAACAGG + Intronic
970426612 4:15951894-15951916 GGTCAGGCTGTGAACTGAAGAGG - Intergenic
999512301 5:152264965-152264987 GGTTAGCATGACCTCCGAAGGGG - Intergenic
1001570137 5:172725469-172725491 GGTTAGGCGGACAAGTGCAGAGG + Intergenic
1004154999 6:13159512-13159534 GGTTTGGCTGACATCCAAGGTGG + Intronic
1022839375 7:34148424-34148446 GGTTGGGCTTACAACCAAATAGG - Intronic
1023853642 7:44166097-44166119 GGATACGCTGACAATCAAAGAGG + Intronic
1034952052 7:155305223-155305245 GGTTAGGCTTAGAACCTCAGAGG - Intronic
1046029344 8:108765016-108765038 TGATAGGCTGAAAACGGAAGGGG - Intronic
1048289090 8:133166140-133166162 GGTTAGGCTGACATCAGGGGAGG + Intergenic
1057750996 9:97793007-97793029 GATTAAGCTTACAAGCGAAGAGG + Intergenic
1060469762 9:123938686-123938708 GCTTAGGCTGACTTCCTAAGGGG + Intergenic
1191594610 X:62929236-62929258 GGATATGCTGACAATCGAAGAGG + Intergenic
1195803234 X:108735528-108735550 TGTGAGGCTGAACACCGAAGTGG - Exonic
1196601581 X:117606899-117606921 GGTGAGGCTAAGAACCAAAGAGG + Intergenic