ID: 1120942151

View in Genome Browser
Species Human (GRCh38)
Location 14:89958673-89958695
Sequence AAGTGTGCCAAGTGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 293}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120942151 Original CRISPR AAGTGTGCCAAGTGGGAAGA GGG Intronic
900004235 1:34177-34199 CAGAGTCCCAGGTGGGAAGAAGG + Intergenic
900023963 1:204693-204715 CAGAGTCCCAGGTGGGAAGAAGG + Intergenic
900802764 1:4747535-4747557 AAGAGGGACAAGTGGGAGGATGG - Intronic
901054936 1:6444685-6444707 GAGTGTGCCCAGGAGGAAGACGG + Intronic
901458704 1:9378444-9378466 ATGTTTGCCAAATGGGACGATGG - Intergenic
902270681 1:15302232-15302254 AAGTTAGCTAAGTGGGGAGAAGG + Intronic
902300132 1:15495795-15495817 ATTTGTGCCAGGTGGGCAGAGGG - Intronic
902479419 1:16703918-16703940 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
902775424 1:18671505-18671527 CAGTGGGCCAGGTGGGAGGAGGG + Intronic
904369176 1:30037712-30037734 CAGGGAGCCAGGTGGGAAGAAGG + Intergenic
904437719 1:30509556-30509578 TACTGTGGCAAGTGGGTAGAGGG + Intergenic
904487102 1:30833051-30833073 AGGAGTGGGAAGTGGGAAGATGG + Intergenic
907182890 1:52586379-52586401 AAGTGTCCCAAGAGGGAGGGGGG + Intergenic
908021537 1:59903320-59903342 AAATGTGCAATGTGGGGAGAGGG + Intronic
909156282 1:72081483-72081505 AAATGTGGCAAGTGCAAAGAAGG - Intronic
911300319 1:96164922-96164944 AAGGGAGCCAAATAGGAAGAAGG - Intergenic
911437373 1:97878339-97878361 GAGTGTGTAAAGTGGAAAGAGGG - Intronic
913496998 1:119437022-119437044 ATGTCTGCAATGTGGGAAGAGGG + Intergenic
915178943 1:154041684-154041706 AAGAGAGGCAAGTGGGAAGATGG - Intronic
915535155 1:156530925-156530947 CAGTGTGTGAAGTGGGGAGAGGG + Intronic
915806497 1:158858984-158859006 ACGTGTGCCAAATGGGAAGAGGG - Intergenic
916455331 1:164965338-164965360 GAGGATGCCAAGTTGGAAGATGG - Intergenic
916525058 1:165601888-165601910 AAGGGTGCTAAGTTGTAAGAGGG - Intergenic
916533460 1:165680486-165680508 AAGTGTGCCCACTGGCATGAAGG - Exonic
916718130 1:167462147-167462169 AAGAGAGCCAGGTGGGGAGAGGG - Intronic
916847869 1:168671601-168671623 ATGTGTGGCAAGAGGGAAGAGGG + Intergenic
917605231 1:176621424-176621446 CAGGGTGCCAAGGGGGATGATGG - Intronic
920451257 1:206062731-206062753 AGGAGTGCCAAGCGGGAAGTGGG + Intronic
920931765 1:210395267-210395289 AAGGGTGCCAAGTGATAATAGGG - Intronic
921014406 1:211175299-211175321 AAGTATGCCAAATGGGAAGGTGG - Intergenic
922953944 1:229583381-229583403 CAGTGTTCCATGTGGGAAGAAGG - Intergenic
923023707 1:230187757-230187779 AAGGGGGTTAAGTGGGAAGATGG + Intronic
923538166 1:234869105-234869127 AAGTGCCAGAAGTGGGAAGATGG - Intergenic
924655546 1:245972046-245972068 AACTGAACCAAGTGGGAAGGGGG + Intronic
1064469605 10:15622276-15622298 GAGAGTGAGAAGTGGGAAGAAGG - Intronic
1066096569 10:32077876-32077898 TAGTATGAAAAGTGGGAAGAGGG + Intergenic
1066640332 10:37548901-37548923 AGGGGTGGCAACTGGGAAGAGGG + Intergenic
1068461177 10:57331015-57331037 AATTGTGGCAAGTGGAAAGATGG - Intergenic
1069157284 10:65046796-65046818 AAGTGTGTAGAGTGGGAGGAGGG + Intergenic
1070306115 10:75240110-75240132 TTGGATGCCAAGTGGGAAGATGG + Intergenic
1070698538 10:78581595-78581617 GAGTGAGACTAGTGGGAAGAAGG - Intergenic
1071128492 10:82364035-82364057 AAATTTGCCAAGTTGAAAGAAGG - Intronic
1071264497 10:83952873-83952895 AAGAGTGAGAAGAGGGAAGAGGG + Intergenic
1074732862 10:116396151-116396173 AAGGCTGCCAAGTGAGGAGATGG + Intergenic
1074834688 10:117278852-117278874 AAGTCTGCCACTTTGGAAGATGG + Exonic
1075303672 10:121348502-121348524 AGGTGGGGCAAGGGGGAAGAGGG - Intergenic
1075403483 10:122177936-122177958 AAGTCTGCCAAGATCGAAGATGG + Intronic
1076207176 10:128612579-128612601 AAGGGCGCTAAGTGAGAAGACGG - Intergenic
1076723691 10:132403852-132403874 GAGGGTGCCAGGTGGGCAGATGG + Intronic
1077634464 11:3832782-3832804 AACTGTGCCAAACAGGAAGAAGG + Intronic
1077897091 11:6461311-6461333 AAATGTTCCAGTTGGGAAGAGGG - Intronic
1078533714 11:12156655-12156677 ACCTGGGCCAGGTGGGAAGATGG + Intronic
1078631953 11:13010869-13010891 AAGTGTGCAAAGTTTGCAGAAGG - Intergenic
1080394297 11:31875713-31875735 AAATGTGGCAAGTGGGATGGAGG + Intronic
1081199356 11:40198020-40198042 AAGTAGGATAAGTGGGAAGATGG + Intronic
1083738570 11:64695420-64695442 CACAGTGTCAAGTGGGAAGAAGG + Intronic
1085347112 11:75775337-75775359 AGGTGTGCCAGGTGGGAAGTGGG - Intronic
1085814773 11:79726265-79726287 AAGAGTGGAAAGTGGGAAGAGGG - Intergenic
1086187465 11:84035740-84035762 GAGGGTGCAAAGTGGGAACAGGG + Intronic
1086372133 11:86165413-86165435 AAGTGTGCATAGTGGAAACATGG - Intergenic
1087397370 11:97617180-97617202 CAGGGTGCCAAGTGAGAAAATGG - Intergenic
1087729540 11:101762684-101762706 AAGGGTGGAGAGTGGGAAGAGGG - Intronic
1089677602 11:120100171-120100193 GAATTTCCCAAGTGGGAAGATGG - Intergenic
1090728649 11:129550898-129550920 AAGTGCACCAAATGGGAAGGTGG - Intergenic
1091220778 11:133928758-133928780 AAATGTGCCAAGCGGGGTGAGGG - Intronic
1091377659 12:36225-36247 CAGAGTCCCAGGTGGGAAGAAGG + Intergenic
1092164869 12:6336563-6336585 ATGTGGGCCAAGTGGGACAAGGG - Intronic
1092209396 12:6636435-6636457 AAGTGTGCTCAGTGGGAGGCAGG - Exonic
1093568895 12:20643034-20643056 AAGTGTATCAAGACGGAAGAGGG + Intronic
1093644658 12:21571205-21571227 AAGTGTGCCCCATGGGAGGAGGG - Intronic
1093705732 12:22273222-22273244 AAGTGTGCCAAACGGGCAGGTGG - Intronic
1097947077 12:65380933-65380955 AAGTATGTCATGTGGGAATAGGG - Intronic
1097951169 12:65429614-65429636 CAGTGGGCCCAGTGGGAACATGG - Intronic
1098669818 12:73212551-73212573 AAGTGTTCCTGGTAGGAAGAGGG - Intergenic
1102306320 12:111807379-111807401 AAGTGTACCCACTGGGAAGTGGG - Intronic
1102634276 12:114309199-114309221 AAGTGTGACAAGTGTGATCAAGG - Intergenic
1103005479 12:117417088-117417110 AATTTTCCCACGTGGGAAGATGG - Intronic
1103791081 12:123471620-123471642 AAGGGTGCTAGGTGGGAAGCTGG - Exonic
1104027901 12:125042294-125042316 AAATTTACCAAGTGGGAAGAGGG - Intergenic
1104531458 12:129575066-129575088 ATGTGTTCCAGGTGGTAAGAGGG - Intronic
1104593032 12:130099785-130099807 AAGTGTTCCCAGTGGGTAGTGGG + Intergenic
1105213615 13:18272159-18272181 AGGTGTGACAACAGGGAAGAGGG + Intergenic
1106158966 13:27183680-27183702 AAGTGTGGCCTGTGGGAGGAGGG - Intergenic
1106365426 13:29074387-29074409 AAGGGTGCTAAGTGGCATGACGG - Intronic
1108779999 13:53818401-53818423 AAGTGGGCCAGGTGGGAATAAGG - Intergenic
1112754166 13:102611903-102611925 AAGGGTGCCAAGTGAAAAGAAGG - Intronic
1113066999 13:106382772-106382794 AAGTGAGCCCAGGGGTAAGACGG + Intergenic
1114791535 14:25664917-25664939 ACGTGTTCCAAGAGGTAAGATGG + Intergenic
1116387043 14:44344557-44344579 AAGTGTACAATGTGGGAAGAAGG + Intergenic
1116977347 14:51131043-51131065 GAGTTTGCCAGGTGGGAATAAGG - Intergenic
1117438415 14:55739557-55739579 AAGTGTTCAAAGAGGGAAGGGGG + Intergenic
1117830501 14:59745154-59745176 AAGGGTCCCAAGTGGGTACAGGG - Intronic
1119188087 14:72658870-72658892 AAGTGTGCCCAGTAGGCACATGG + Intronic
1120942151 14:89958673-89958695 AAGTGTGCCAAGTGGGAAGAGGG + Intronic
1123039130 14:105483246-105483268 AGGTGTGGAAAGAGGGAAGAAGG - Intergenic
1202889625 14_KI270722v1_random:143791-143813 ATGTGTGTCAGGTGGGCAGAGGG - Intergenic
1202929021 14_KI270725v1_random:22889-22911 ACGTGAGCCAGGTGGGAGGAAGG - Intergenic
1124220022 15:27843310-27843332 AAGTGTGCTGAGTGGGCAGCAGG - Intronic
1125187480 15:36948124-36948146 AAGTGTGAAAATTAGGAAGATGG + Intronic
1125431593 15:39600447-39600469 ACATGAGACAAGTGGGAAGAAGG + Exonic
1126246369 15:46510679-46510701 AAATGACCCAAGTGGGAAAATGG - Intergenic
1127841315 15:62834630-62834652 TTGTGTGCCAGGTGGGGAGACGG - Intronic
1127848184 15:62889928-62889950 ATGTTGGCCAAGTGGGAAGCGGG + Intergenic
1128787911 15:70411906-70411928 AAGAATGCAAAGTGGAAAGAGGG - Intergenic
1129295079 15:74595785-74595807 GAGAGTGGCAAGTGGGAAGCTGG - Exonic
1129976403 15:79826048-79826070 AAGTGTGCCCAGTGGTAAAGGGG - Intergenic
1130304095 15:82701193-82701215 AACTCTGCCCAGAGGGAAGAGGG - Intronic
1132449269 15:101956767-101956789 CAGAGTCCCAGGTGGGAAGAAGG - Intergenic
1133130180 16:3671897-3671919 ACGTGTGCTAAGAGGGAAGCAGG + Intronic
1133804026 16:9109313-9109335 AAGGGTCCCGAGTGAGAAGATGG + Intronic
1134861327 16:17562918-17562940 AAGTGTGATAAGTGAGAGGAAGG - Intergenic
1138109158 16:54309489-54309511 AAGTGTGACATGTGGGAAGGAGG - Intergenic
1139972297 16:70783676-70783698 AGGTGTCCCATGTGGGAGGAGGG + Intronic
1143859199 17:9875652-9875674 AACTGAGCCAAGTGTGAAGGAGG + Intronic
1144038951 17:11391429-11391451 AAGTGTAACAAGGAGGAAGAGGG - Intronic
1144308935 17:13994590-13994612 CAGTGTTCCAAGAGGAAAGAAGG + Intergenic
1145739114 17:27257358-27257380 AAATGTGGCAAGTGTGAATAAGG + Intergenic
1145802971 17:27702520-27702542 TAGAGTGCAAAGTGGGAACAGGG - Intergenic
1147455666 17:40536651-40536673 AAGAGTGCCAGGTGGGGAGGAGG + Intergenic
1148857270 17:50585620-50585642 CAGTGTGCCCAGTGGGCAGGAGG + Intronic
1148958412 17:51372672-51372694 AAGAGTCCCAAGTTGGAAGGAGG - Intergenic
1150909023 17:69369037-69369059 AACTGTGAACAGTGGGAAGATGG - Intergenic
1151635849 17:75347314-75347336 AAGCCTACCAAATGGGAAGATGG - Intronic
1151923596 17:77176365-77176387 AACTGTGCCAAATGAGAAGGTGG + Intronic
1152025133 17:77804041-77804063 TAGTGAGCCCAGTGGGAAGCAGG + Intergenic
1154322315 18:13364890-13364912 AAGTGTGCAAAGTGTGATGGGGG + Intronic
1154465765 18:14641822-14641844 AAGGGTGCCGAGTAGGAGGAAGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1157409146 18:47449215-47449237 AGGTAGGCCAAGTGGGAGGAAGG - Intergenic
1157864468 18:51168779-51168801 AAGTGTACCAATTGAGAAGAGGG - Intergenic
1158041061 18:53094275-53094297 CAGTGTCCCAACTGGGAAGAAGG + Intronic
1158589502 18:58768091-58768113 AAGTCTGCCAATTGCCAAGAGGG - Intergenic
1159023435 18:63161759-63161781 TAGTGCGTCAGGTGGGAAGACGG - Intronic
1159037403 18:63290883-63290905 AAGAGGGCCGAGTGGGATGAGGG - Intronic
1159308659 18:66679104-66679126 AAGTGCGCCAAATGAGAAGGTGG + Intergenic
1160635987 19:75786-75808 CAGAGTCCCAGGTGGGAAGAAGG + Intergenic
1162013961 19:7833731-7833753 ATGTGTGCCAAGTGTACAGATGG - Intronic
1163034733 19:14564100-14564122 AAGTGGGGCAGGTGGGAGGAGGG + Intronic
1166646340 19:44534488-44534510 ATGTGTGCCATGGGGGATGAGGG + Intergenic
1167436520 19:49481563-49481585 AGGTGGGCCAGGAGGGAAGAAGG + Intronic
1167669925 19:50844888-50844910 AAGTGTGAAAAGTGTGAAGGGGG - Intergenic
1202665026 1_KI270708v1_random:110558-110580 ATGTGTGTCAGGTGGGCAGAGGG - Intergenic
1202713458 1_KI270714v1_random:29824-29846 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
925465918 2:4107295-4107317 AAGGGTGCAAAGTGGGAAAGTGG + Intergenic
926247915 2:11134100-11134122 AAGTGTGACCAGCGGTAAGAAGG + Intronic
926854770 2:17242939-17242961 GAGTGGGGAAAGTGGGAAGAAGG - Intergenic
926989345 2:18660783-18660805 AAGAGTGACAAGTGGTAATATGG - Intergenic
927174812 2:20398461-20398483 AAGCGTGGCTACTGGGAAGAGGG - Intergenic
928876045 2:36041474-36041496 AAGTGTGGCAAGAGGGCAGCTGG - Intergenic
929570007 2:43016745-43016767 AAGTGTGTCACATGGCAAGAAGG - Intergenic
931793586 2:65688401-65688423 AAATGTGCCAAGTTGGAAATAGG - Intergenic
934300713 2:91774587-91774609 AGGTGTGACAACAGGGAAGAGGG - Intergenic
934715251 2:96539283-96539305 AAGTGGGCCAAGAGGACAGATGG - Intronic
936565493 2:113579266-113579288 CAGAGTCCCAGGTGGGAAGAAGG - Intergenic
937748331 2:125442455-125442477 AAAGGTGCCAAGTGAGGAGATGG - Intergenic
939818244 2:146922777-146922799 ATGTGTACTAAGTGGAAAGATGG + Intergenic
939895922 2:147791328-147791350 TAGTGTGCTTAGTAGGAAGAAGG - Intergenic
939949944 2:148458033-148458055 AAGTGGACTAAGTTGGAAGAAGG + Intronic
940357285 2:152757744-152757766 CAGTGTTCCCAGTGGGAATATGG + Intronic
941483511 2:166048345-166048367 GAGTGTGCAAGGTGGGAAGAGGG - Intronic
943430589 2:187796200-187796222 AAGTGTACCAAGAGGGATGATGG + Intergenic
944031353 2:195238497-195238519 AAGTGTGCCAAAAGGGAATTGGG + Intergenic
946179205 2:217939871-217939893 AGGTGGGGCAAGTAGGAAGATGG + Intronic
946869330 2:224071783-224071805 AAGGCTGCACAGTGGGAAGAAGG - Intergenic
947297721 2:228651107-228651129 AAGGGTGGCAGGTGGGAAGAGGG + Intergenic
948176653 2:235948790-235948812 CTGTGTGGCAAGTGGGAGGATGG - Intronic
948432731 2:237930340-237930362 AAGTGCACCAAACGGGAAGACGG - Intergenic
948577699 2:238965145-238965167 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948577742 2:238965295-238965317 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948785242 2:240348839-240348861 AAGTGTCCCAAGTGGAAGAACGG + Intergenic
1169185602 20:3614338-3614360 AAGTGTGTGAGGTGGGAAGGTGG + Intronic
1169260605 20:4135595-4135617 AATTGAGCCATGTGGAAAGATGG - Intronic
1171494341 20:25544974-25544996 AAGTATGACAAGTGAGATGAGGG + Intronic
1171993782 20:31716923-31716945 AGGTCTGCCAACTGGGAACAAGG + Intronic
1172080984 20:32340488-32340510 AAGTGTGCTTAGTGGGCAGTAGG + Intergenic
1173020276 20:39261394-39261416 CAGTGTGCAGAGTGGAAAGAAGG - Intergenic
1173398370 20:42702056-42702078 AAGTGTGACAAGTGGGAAGTGGG - Intronic
1173678993 20:44862874-44862896 AAGTGAGCCAGGTGTGAGGAAGG - Intergenic
1173759886 20:45550135-45550157 GAGTGTGATAAGTGGGAAGATGG + Intergenic
1174401822 20:50280050-50280072 AAATGTGCCAGGTGGAGAGAAGG - Intergenic
1174779527 20:53376098-53376120 AAGTTAGCCAAGTGAGAAGAGGG + Intronic
1175027824 20:55921573-55921595 AAGCATGCCAAATGGGAAGGTGG + Intergenic
1175135065 20:56816976-56816998 AGGTGTTCCAAGTGGCAAAAGGG + Intergenic
1175144647 20:56886350-56886372 AAGGGAGGCATGTGGGAAGAAGG + Intergenic
1176024323 20:62978101-62978123 AAGTGCGCCAGGAGGGGAGATGG - Intergenic
1176033099 20:63023319-63023341 AAGGGTGTGAAGAGGGAAGAGGG - Intergenic
1176309626 21:5142732-5142754 TCCTGTGCCAAGTGGGAAGGTGG - Intronic
1177278785 21:18951444-18951466 AAGTGATCAAAGTGGGAAAAGGG - Intergenic
1179372749 21:40821861-40821883 AAGGGTGGAAAGTGGGAGGAGGG + Intronic
1179847432 21:44119301-44119323 TCCTGTGCCAAGTGGGAAGGTGG + Intronic
1179960512 21:44764869-44764891 ATGTGTGCCAGGAGGGAAGGGGG - Intergenic
1180331752 22:11487478-11487500 ATGTGTGTCAGGTGGGCAGAGGG - Intergenic
1180657008 22:17430381-17430403 AAGTGTGCCAGATGGAAGGATGG - Intronic
1180816449 22:18792550-18792572 AGGTGTGACAACAGGGAAGAGGG + Intergenic
1181081695 22:20419789-20419811 ATTTGTCCCCAGTGGGAAGATGG - Intergenic
1181202636 22:21226882-21226904 AGGTGTGACAACAGGGAAGAGGG + Intronic
1181637718 22:24182013-24182035 AAGTGAGATAAGTGGCAAGAGGG - Intronic
1181699067 22:24609723-24609745 AGGTGTGACAACAGGGAAGAGGG - Intronic
1183786456 22:40031682-40031704 AAGTTGGCATAGTGGGAAGAGGG + Exonic
1185105189 22:48864956-48864978 ACCTGTCCCAAGAGGGAAGAAGG - Intergenic
1203224277 22_KI270731v1_random:68531-68553 AGGTGTGACAACAGGGAAGAGGG - Intergenic
1203266549 22_KI270734v1_random:18261-18283 AGGTGTGACAACAGGGAAGAGGG + Intergenic
949248547 3:1954814-1954836 AAGTGGGACAAGTGAGGAGATGG - Intergenic
949545828 3:5071433-5071455 AAGTGTGCCAACAAGGATGAAGG - Intergenic
951196108 3:19825540-19825562 CTGTGTCCCAGGTGGGAAGAGGG - Intergenic
953215691 3:40915673-40915695 AAGAGTCCCAAGTAGGAATAGGG - Intergenic
953529699 3:43729229-43729251 ATGTGTGAGAAGTGGAAAGAAGG + Intronic
953752315 3:45618192-45618214 AAGCGTGCTGAGTGGGGAGATGG + Intronic
955024233 3:55151915-55151937 AATTGTGCCAAGTGGAAAAAAGG - Intergenic
955753496 3:62205570-62205592 CAGAGAGCCAAGTGGTAAGAAGG + Intronic
959502398 3:107121406-107121428 AAGTGTGTGAAGTGGGGAGCAGG - Intergenic
960970705 3:123137936-123137958 TATTGTGCCAGGTGGGAGGAAGG + Intronic
962613289 3:137099536-137099558 AATGCTGGCAAGTGGGAAGAGGG - Intergenic
962821741 3:139055018-139055040 AGGTGTGCAGAGGGGGAAGACGG + Intronic
963353473 3:144180783-144180805 AAGTGTGGCAATTGGTAAAAGGG + Intergenic
966740385 3:183227349-183227371 AAGTCTGGGAGGTGGGAAGAAGG + Intronic
967109459 3:186280816-186280838 AATTAAGCCCAGTGGGAAGAGGG + Intronic
968550694 4:1222243-1222265 AAGGGTGCCAGGTGGGCAGCCGG + Intronic
968684870 4:1951193-1951215 ATGTGTGCCAGGTGAGGAGAAGG + Exonic
969856201 4:10001826-10001848 AAGTCTCCCAGGCGGGAAGAGGG - Intronic
970950436 4:21749481-21749503 AATGGTGTCAAGTGGGGAGAGGG - Intronic
972644415 4:40954132-40954154 AGGTGAGCCTAGGGGGAAGAGGG - Intronic
973735804 4:53870572-53870594 AGGTGTGGCACGTGGGATGAAGG - Intronic
976749878 4:88443317-88443339 AAGGGTCCCAAGTTGGAAAAGGG - Intergenic
977724189 4:100275678-100275700 ATGTGTGCCAGGTAGGAAGAAGG - Intergenic
978222284 4:106291223-106291245 AAGTGTGCAGTGTGGGAAGGAGG - Intronic
978296880 4:107215676-107215698 AATTGTGCCAATTGCCAAGAGGG + Intronic
979139693 4:117155536-117155558 TTGTATTCCAAGTGGGAAGAAGG - Intergenic
979466939 4:121050749-121050771 ACTTGTGCCAAATGTGAAGAAGG - Intronic
979600252 4:122579618-122579640 AAGTCTGCCAAAGGGGAGGAGGG - Intergenic
982522662 4:156438805-156438827 AACTGTGACAAGTTGTAAGAAGG + Intergenic
983236363 4:165184843-165184865 AAGTGGGCCATGTTGGAAAATGG + Intronic
983533550 4:168833770-168833792 AAGTCTGCCAAGTCTGAAGGGGG - Intronic
984277568 4:177628215-177628237 AAGGGTGGAAAGTGGGAAGAGGG - Intergenic
984906261 4:184629219-184629241 TTGTATGCCAAGTGAGAAGATGG - Exonic
985931282 5:3059565-3059587 AAGTGTGCTAAGACGGCAGAAGG - Intergenic
986532553 5:8754284-8754306 AAGAAAGCCAATTGGGAAGAAGG + Intergenic
987108418 5:14663305-14663327 AAATGTGCACAGAGGGAAGAAGG - Intergenic
988599506 5:32626385-32626407 ATGTCTGTCATGTGGGAAGAAGG - Intergenic
990177004 5:53119059-53119081 AAGTGCGCCAAATGGGAAGGTGG + Intergenic
990312032 5:54549369-54549391 AGGTGGGCAAAGTGGGCAGAAGG - Intergenic
991157553 5:63457450-63457472 AAGTGGGCAAATTGGGAAGTGGG - Intergenic
992485550 5:77191034-77191056 CTGTGTGCCAGCTGGGAAGAAGG - Intergenic
993272627 5:85814744-85814766 GAGTGTGCCTAGTGGAAAGTAGG - Intergenic
994839160 5:104899111-104899133 ATGTGTAACAAGTGGCAAGAGGG - Intergenic
995745503 5:115398421-115398443 AAGGGTGGAGAGTGGGAAGAGGG - Intergenic
996105778 5:119500811-119500833 AAGTGTGTCAAGAAGGAGGAGGG + Intronic
997415768 5:133727453-133727475 AGGTGTGCCCAGTGGGAAGATGG - Intergenic
997839458 5:137225956-137225978 GCGTGCTCCAAGTGGGAAGAAGG - Intronic
998205062 5:140152174-140152196 AAGTGAGGCAAGAGGGATGACGG + Intergenic
999115500 5:149160014-149160036 AAGTGTGACAAGTAGAATGAAGG - Intronic
1000652839 5:163838083-163838105 AAGTGTGCCAAGCGCAAGGATGG + Intergenic
1000869651 5:166560013-166560035 AAGCATGCCAACTGGGAAGGTGG + Intergenic
1001227905 5:169961638-169961660 AATTGTGACAAGTGCTAAGAAGG + Intronic
1001367507 5:171158697-171158719 AAGTGGGCCAAGAGGGAGCAAGG - Intronic
1001527289 5:172437858-172437880 AGGTGTGCCAAATGGGGAAATGG + Intronic
1001640720 5:173242422-173242444 AAGGTGGCAAAGTGGGAAGATGG + Intergenic
1001927844 5:175651889-175651911 CTGTGTGCCAAGTGGGCACATGG - Intergenic
1002403786 5:179012431-179012453 AGGCGTGCCAAATGGGAAGCAGG + Intergenic
1003113032 6:3264783-3264805 AAGGGTGGCAAGTGGGAAATTGG - Intronic
1003302090 6:4893054-4893076 CAGTGTGGCAAGTGAGGAGAAGG - Intronic
1004318750 6:14615556-14615578 AAGCTTGCCAGGTGAGAAGAGGG + Intergenic
1005131431 6:22513026-22513048 CAGTGAGCCAAGAGAGAAGATGG + Intergenic
1005193045 6:23249211-23249233 AAGTGTGTTAACTGAGAAGATGG - Intergenic
1007248066 6:40476568-40476590 AAGTTTGCCAGGTGGAAAGCAGG - Intronic
1009485233 6:64213087-64213109 GAGGGTGCAGAGTGGGAAGAGGG + Intronic
1009784576 6:68318242-68318264 AAGTGTGCAGTGTGGGAGGAAGG - Intergenic
1012537086 6:100312400-100312422 AAGTGTGACAAGTGTCATGAAGG + Intergenic
1012935401 6:105362792-105362814 GACTGTGCCAACTGGGAAGAGGG + Intronic
1016883340 6:148933439-148933461 AATTGTTTCAAGTGGGAACAGGG + Intronic
1017831304 6:158132534-158132556 AAGGGTACAAGGTGGGAAGAGGG - Intronic
1020334371 7:7051342-7051364 AAGTGTGGCAAGAGGGAGGAGGG + Intergenic
1023116312 7:36866020-36866042 AATTCTGGCAAATGGGAAGATGG + Intronic
1023229604 7:38012815-38012837 AAGGGTGAAGAGTGGGAAGAGGG - Intronic
1023527818 7:41123306-41123328 AAGTGGGTCATGTGGGATGAAGG - Intergenic
1023688742 7:42764173-42764195 AAGTGTGCCAAAGAGGAAAAGGG + Intergenic
1024251486 7:47508910-47508932 AAGTGTGCCACCTCGGAAGCTGG + Intronic
1024835741 7:53516220-53516242 AAATGTGTCAAGTGGCAAGTCGG - Intergenic
1025109209 7:56198883-56198905 ATGTGTGCCTAGTCTGAAGATGG - Intergenic
1025152906 7:56574428-56574450 TGGTGTGCGAAGGGGGAAGAGGG - Intergenic
1025245139 7:57311214-57311236 ATGTGTGCCAGGTGGGGATAGGG - Intergenic
1025832973 7:65070288-65070310 ATGTGTGCAAAGAGAGAAGAGGG - Intergenic
1025902739 7:65759802-65759824 ATGTGTGCAAAGAGAGAAGAGGG - Intergenic
1026308516 7:69164081-69164103 ATGTGTGCCTAGTTTGAAGATGG + Intergenic
1026342725 7:69447994-69448016 GGGGGTGCCAAGTGGGCAGAAGG - Intergenic
1026929415 7:74215562-74215584 ACGTCTGCTAAGTGGAAAGATGG - Intronic
1028232224 7:88319320-88319342 ATTTGTGCCAGGTGGGCAGAAGG + Intergenic
1028968333 7:96827788-96827810 AAGTGTGGGAAGTGTGAAGAGGG - Intergenic
1029421596 7:100474680-100474702 GAGTCTCCCAAGTGGGAGGAGGG + Intronic
1031215166 7:118881256-118881278 AAGTGTGTGAAGGGGGAACAAGG + Intergenic
1031539505 7:122976614-122976636 AAGTGTGCCAAAGAGGCAGAAGG - Intergenic
1032851808 7:135801745-135801767 ATCTGTGCCAAGTTGGAAGAGGG - Intergenic
1033865414 7:145685716-145685738 TTGTGTCCCCAGTGGGAAGAAGG + Intergenic
1035555375 8:563546-563568 ATTTGTGCCAGGTGGGCAGAGGG - Intergenic
1035695287 8:1591321-1591343 ATGTGGGCCAGGTGGGAAGGAGG + Intronic
1036179033 8:6567519-6567541 AAGGATGCCAGGTGGGGAGAGGG + Intronic
1041480363 8:58313480-58313502 AAGCGTGTTCAGTGGGAAGAAGG - Intergenic
1045809736 8:106207321-106207343 AAGTGGCCAAAGTGGGAACATGG - Intergenic
1048252314 8:132876947-132876969 CAGATTGCCCAGTGGGAAGAAGG + Intronic
1049886932 9:33960-33982 CAGAGTCCCAGGTGGGAAGAAGG + Intergenic
1050541774 9:6676523-6676545 AAGTGAGCCTTGTGGGCAGAGGG - Intergenic
1051768981 9:20555699-20555721 CAGTGTGCCTAGTGAGATGAGGG - Intronic
1052331319 9:27271758-27271780 AAGTCATCCAAGAGGGAAGAAGG + Intergenic
1055129936 9:72763418-72763440 AATTGTGCCAAGTGCTATGAAGG + Intronic
1055217548 9:73884699-73884721 GAGAGTGCCGAGTGCGAAGAGGG - Intergenic
1056232633 9:84562487-84562509 AAGTGTGGCATGAGGAAAGAAGG + Intergenic
1056939954 9:90946516-90946538 AGGTGTGCCTAGCGGAAAGAAGG - Intergenic
1057762483 9:97888083-97888105 AAGAGTGACAAGAGGGAAGGAGG - Intergenic
1058594729 9:106603346-106603368 GAGTGAGCAAAGTGAGAAGAAGG - Intergenic
1059386490 9:113968942-113968964 ACTTGTGCCCAGTGGTAAGAGGG - Intronic
1062269716 9:135702846-135702868 AAGAGTCCCCAGTGGGAAGTGGG + Intronic
1062356292 9:136165077-136165099 AAGTGTACCACATGGAAAGATGG - Intergenic
1188113085 X:26215024-26215046 AAGTCTGCCTAGTGACAAGAAGG + Intergenic
1189049172 X:37626138-37626160 AAGCGTGAGAAGTGAGAAGATGG - Intronic
1193330437 X:80230090-80230112 AAGCATGCGAAATGGGAAGACGG - Intergenic
1193508355 X:82370617-82370639 AAGGGTCCCAAGTTGGAAAAGGG + Intergenic
1193852117 X:86550924-86550946 AAGGGTGCAAAGGGGGAATATGG + Intronic
1194027779 X:88775323-88775345 AAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1195048776 X:101078610-101078632 AAGTGAGCCCGGTGGGAAGGTGG + Intergenic
1195141700 X:101967271-101967293 AAGTGTGGCAGGTGAGAGGAAGG - Intergenic
1195836491 X:109120532-109120554 AAGTGGGGCAAGTTTGAAGAGGG - Intergenic
1196279800 X:113810741-113810763 GAGTGTGTGAAGTGGGAAGCAGG + Intergenic
1197458746 X:126711765-126711787 AAGTTTGCCATGTGGGTAGCTGG - Intergenic
1198138750 X:133781652-133781674 AAGCATGCCTAGTGGGAAGGTGG + Intronic
1198507073 X:137311541-137311563 GAGTGTGCAGAGTGGGAGGAGGG - Intergenic
1199778324 X:151035009-151035031 AACTGTGCCAAGTGTCATGAGGG - Intergenic
1201863795 Y:18627816-18627838 AAGTATGCCCAGTGGGAAAAAGG + Intergenic
1201869527 Y:18692562-18692584 AAGTATGCCCAGTGGGAAAAAGG - Intergenic