ID: 1120948001

View in Genome Browser
Species Human (GRCh38)
Location 14:90015976-90015998
Sequence TCCCTTGGGGCCCACCTAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120948001_1120948005 -8 Left 1120948001 14:90015976-90015998 CCAATTAGGTGGGCCCCAAGGGA 0: 1
1: 0
2: 0
3: 0
4: 67
Right 1120948005 14:90015991-90016013 CCAAGGGAGATTCTTATATTTGG 0: 1
1: 0
2: 0
3: 12
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120948001 Original CRISPR TCCCTTGGGGCCCACCTAAT TGG (reversed) Intronic
903216159 1:21844357-21844379 TCCCCTGGGGCCCAGATACTAGG + Intronic
905272196 1:36794375-36794397 TCCCTCGGGCCACAGCTAATTGG + Intergenic
906756919 1:48326139-48326161 TTCCTTTGGGCCTACCAAATGGG - Intronic
910452665 1:87362803-87362825 TCCCTAGGGGCCCACTTCTTGGG - Intergenic
921156974 1:212446401-212446423 TTCCTTGGAGCCCACATAAGCGG + Intergenic
1068053674 10:51983426-51983448 GCCCTGGGGGCCCACATCATAGG - Intronic
1077137513 11:1008389-1008411 CACCATGGGGCCCACCTCATGGG + Intronic
1081951672 11:47049510-47049532 TGCCTTTGGTCCCAGCTAATTGG + Intronic
1082802451 11:57425055-57425077 TCCCTAGGGGCTTAGCTAATAGG - Intronic
1083681180 11:64352561-64352583 CCCCGTGGGGCTCACCTATTGGG + Intronic
1089356954 11:117860208-117860230 GCCCTTGGGCCCCACCTCACAGG + Intronic
1092342294 12:7687051-7687073 TCCCTGTGGTCCCACCTACTTGG + Intergenic
1102238468 12:111309282-111309304 GACCTTGGGGCCCACTTCATGGG + Intronic
1107807592 13:44168975-44168997 GCCCATGGGTCCCACCTACTTGG + Intergenic
1119113074 14:71993880-71993902 TCTCTTGAGGACCACCAAATTGG + Intronic
1120278272 14:82406436-82406458 TCCCTTGTGGCTAACCTACTGGG + Intergenic
1120948001 14:90015976-90015998 TCCCTTGGGGCCCACCTAATTGG - Intronic
1122154607 14:99742608-99742630 GTCCTTTGGGCCCTCCTAATAGG - Intronic
1123125335 14:105941880-105941902 TCCCATGGGGCCCACATCGTGGG + Intergenic
1123937912 15:25202909-25202931 TCCCATGGGTCCCATCAAATGGG + Intergenic
1132295102 15:100728906-100728928 TCCCTCGGGGCTCACCTAGAGGG - Intergenic
1137751510 16:50864336-50864358 TTCCTTGGGGCTCAGCGAATGGG - Intergenic
1140177280 16:72675390-72675412 TCCTTTGGGGCCTACCATATGGG - Intergenic
1144945128 17:18965857-18965879 GTCCTTGGGGCCCACCTCTTAGG + Intronic
1146484608 17:33232923-33232945 TCTCTTGGTGCCCACCAAAGGGG - Intronic
1153778416 18:8473797-8473819 CCTCATGTGGCCCACCTAATGGG + Intergenic
1154336128 18:13466342-13466364 TCCCTTTGGTCCCAGCTACTTGG + Intronic
1160797238 19:951429-951451 TGCCTGTGGTCCCACCTAATCGG + Intronic
1162945328 19:14039822-14039844 TCCATTGGGCCCCACCTACATGG + Exonic
1163849991 19:19657278-19657300 TCCCTTGGGGCTTTCCTAACCGG - Intronic
1165172787 19:33905916-33905938 TCCCTGGGGACCCACCGGATCGG + Intergenic
1165993226 19:39827495-39827517 TTCCTGGGGGCACACCTCATTGG + Exonic
926242451 2:11099112-11099134 TCCCTGTGAGGCCACCTAATAGG - Intergenic
927496977 2:23557619-23557641 TGCCTTGGGGACCACCTGCTGGG - Intronic
934525751 2:95050622-95050644 TCCCCTGGGGCCCTCCTTCTGGG - Intronic
944924437 2:204449788-204449810 TCCCTCAGGACCCACCTACTGGG - Intergenic
948370779 2:237487788-237487810 TCCCCTGGGGCCAGCCTACTTGG - Intronic
1169928511 20:10807769-10807791 TCCCATTGGCCACACCTAATGGG + Intergenic
1169928624 20:10808460-10808482 TCCCATTGGCCACACCTAATGGG - Intergenic
1179447254 21:41440990-41441012 TCCCTCGGGGTCCACCTCCTGGG - Exonic
1180903970 22:19395425-19395447 TCCCTAGGAGTCCACCTCATGGG + Intronic
1184405567 22:44298715-44298737 TCCCTTGAGGCCCAGCTCAAAGG - Intronic
966029824 3:175332424-175332446 TCCCTTTGGTCCCAGCTACTTGG - Intronic
974553395 4:63410317-63410339 TGCCTGGGGTCCCAGCTAATCGG + Intergenic
977169545 4:93743753-93743775 CCCATTAGGCCCCACCTAATGGG + Intronic
978383473 4:108155584-108155606 TGCCTTGGGCCCCACCTGGTGGG - Intronic
978419160 4:108511705-108511727 TCTCTGGGTGCCCACCTAGTGGG - Intergenic
982127434 4:152196600-152196622 TCCCTTGCGTCCCTCCTAAGAGG + Intergenic
983496549 4:168448847-168448869 TCCCTTGTGACCTACCTTATAGG - Intronic
995051409 5:107709507-107709529 TGCCTGTGGGCCCACCTACTTGG - Intergenic
1001154956 5:169264680-169264702 TCCCTTTGGGCCACCCTTATAGG + Intronic
1001562299 5:172677648-172677670 TCCCTTGGTGCCCACCCCCTCGG + Intronic
1001652680 5:173327160-173327182 TCACTTGGGGCGTCCCTAATGGG + Intronic
1001845175 5:174915942-174915964 TCCCCGTGGGCCCACCAAATTGG + Intergenic
1010997934 6:82554775-82554797 TCCCTTGGGGAGCACATACTAGG - Intergenic
1013305886 6:108846880-108846902 TCCCTTGGGACCTATCTAAAGGG + Intergenic
1023112457 7:36827464-36827486 TCCCGTGGCTCCCACCTAAGGGG + Intergenic
1032415894 7:131735176-131735198 TCCCTGGGGACCCACGTGATAGG + Intergenic
1034275558 7:149822356-149822378 TCCCTCGGGGCCCTCCTTGTAGG + Intergenic
1038229170 8:25684680-25684702 TCCCTTGGGGCCAATATATTGGG - Intergenic
1043578234 8:81682445-81682467 TATCTTGGGGCCCACATTATAGG + Intronic
1046950738 8:120017405-120017427 TCTCTTGGGCTCCACCTCATGGG - Intronic
1188782727 X:34305687-34305709 TCCCTTTGGTCAAACCTAATGGG - Intergenic
1191586519 X:62833284-62833306 CCCATTAGGTCCCACCTAATTGG + Intergenic
1196965151 X:121047527-121047549 CCCCTTGGGCGCCACCTAACGGG - Intergenic
1197098948 X:122628768-122628790 TCACATGAGGCCCACCTACTGGG - Intergenic
1197942292 X:131802836-131802858 TCCCTTGAGGCCCAGCTGTTGGG - Intergenic
1202018135 Y:20434043-20434065 TCCCTTGGTTCCCACATTATGGG - Intergenic