ID: 1120953200

View in Genome Browser
Species Human (GRCh38)
Location 14:90061107-90061129
Sequence CGGCCAGGAGACCTTGACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120953200_1120953217 29 Left 1120953200 14:90061107-90061129 CCAAGGTCAAGGTCTCCTGGCCG No data
Right 1120953217 14:90061159-90061181 CTCCTCTCCGGAAGCGGGGCTGG No data
1120953200_1120953215 25 Left 1120953200 14:90061107-90061129 CCAAGGTCAAGGTCTCCTGGCCG No data
Right 1120953215 14:90061155-90061177 TGGCCTCCTCTCCGGAAGCGGGG No data
1120953200_1120953212 17 Left 1120953200 14:90061107-90061129 CCAAGGTCAAGGTCTCCTGGCCG No data
Right 1120953212 14:90061147-90061169 CCAGTGTTTGGCCTCCTCTCCGG No data
1120953200_1120953214 24 Left 1120953200 14:90061107-90061129 CCAAGGTCAAGGTCTCCTGGCCG No data
Right 1120953214 14:90061154-90061176 TTGGCCTCCTCTCCGGAAGCGGG No data
1120953200_1120953213 23 Left 1120953200 14:90061107-90061129 CCAAGGTCAAGGTCTCCTGGCCG No data
Right 1120953213 14:90061153-90061175 TTTGGCCTCCTCTCCGGAAGCGG No data
1120953200_1120953205 5 Left 1120953200 14:90061107-90061129 CCAAGGTCAAGGTCTCCTGGCCG No data
Right 1120953205 14:90061135-90061157 CCCTTCCAGCCCCCAGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120953200 Original CRISPR CGGCCAGGAGACCTTGACCT TGG (reversed) Intergenic
No off target data available for this crispr