ID: 1120957673

View in Genome Browser
Species Human (GRCh38)
Location 14:90097300-90097322
Sequence CTTAACATGGTGAAGGTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120957669_1120957673 9 Left 1120957669 14:90097268-90097290 CCTGGCTTCTGGCAAGGGCTTCT 0: 3
1: 5
2: 23
3: 64
4: 275
Right 1120957673 14:90097300-90097322 CTTAACATGGTGAAGGTCAAAGG 0: 1
1: 0
2: 0
3: 14
4: 152
1120957668_1120957673 10 Left 1120957668 14:90097267-90097289 CCCTGGCTTCTGGCAAGGGCTTC 0: 2
1: 11
2: 23
3: 87
4: 307
Right 1120957673 14:90097300-90097322 CTTAACATGGTGAAGGTCAAAGG 0: 1
1: 0
2: 0
3: 14
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120957673 Original CRISPR CTTAACATGGTGAAGGTCAA AGG Intronic
902828142 1:18991520-18991542 CTTAATCTAGTGAAGTTCAATGG - Intergenic
903206586 1:21786932-21786954 TTTAACAAGGTGAAGGCCATTGG - Intergenic
907768609 1:57437128-57437150 CTTCAGATGGTGAAAGTGAATGG + Intronic
909724996 1:78824112-78824134 CTTTACATTGTGAAGTCCAATGG + Intergenic
914767105 1:150648147-150648169 CTTATAATGGTCAAGGTCTATGG + Exonic
918913561 1:190605576-190605598 GATAAGATGGTGAAGGTCAGAGG - Intergenic
919426520 1:197439140-197439162 CTTAAAATGGAGTTGGTCAATGG + Intronic
920516624 1:206589294-206589316 CGTAAGATGGTGAAGTTCAAGGG - Intronic
922666263 1:227471991-227472013 CTTAACATGGTGAAGCAGGAGGG - Intergenic
922891236 1:229063135-229063157 CTTAACATTGTAGGGGTCAAGGG + Intergenic
924171530 1:241347003-241347025 CTTAAGATGGTGTATGCCAAGGG - Intronic
924301113 1:242638674-242638696 GTTCACATGGTGAAGATCCAAGG - Intergenic
1062766894 10:72956-72978 TTTAAAATGCTGAAGGCCAAGGG + Intergenic
1062792344 10:316509-316531 TTACACATGGTGAAGGGCAAGGG + Intronic
1063287816 10:4709446-4709468 CATAACCTGGAGAAGGCCAAGGG - Intergenic
1063341931 10:5274083-5274105 CTTAACTTGGTGGAGGCCACTGG + Intergenic
1064920318 10:20509579-20509601 CTAAACATGGCAGAGGTCAAAGG - Intergenic
1067079866 10:43206771-43206793 CTCCACATGGTGAAGGTCTTGGG + Intronic
1068891008 10:62148395-62148417 ATTAACAAGGTGTAGGGCAAGGG - Intergenic
1070609668 10:77924976-77924998 CTTAGCAACCTGAAGGTCAAAGG - Intronic
1072838285 10:98740705-98740727 GTTAACATGGTGTAGGTATATGG + Intronic
1074113440 10:110438357-110438379 GTTAACAGGGAGGAGGTCAAGGG + Intergenic
1074256225 10:111805303-111805325 CTTAACATTGTGATGGCCACAGG + Intergenic
1075300467 10:121318189-121318211 CTTGAGATGATAAAGGTCAATGG - Intergenic
1079786585 11:24680808-24680830 ATTAACTTGCTCAAGGTCAACGG + Intronic
1080257346 11:30305849-30305871 CCTCACATGGTGAAAGGCAATGG + Intergenic
1080472454 11:32559397-32559419 TTTAAATTAGTGAAGGTCAAAGG + Intergenic
1080926744 11:36765214-36765236 CTTAACATGGCAATGGGCAATGG - Intergenic
1082066383 11:47904100-47904122 CTTCACATGGTGGAGGTGGAGGG - Intergenic
1082196106 11:49308217-49308239 CTTACCATTGTGAGGGTAAATGG - Intergenic
1083788102 11:64965507-64965529 CTTAGGATGGTTAAGGTGAAAGG - Intronic
1083835665 11:65265339-65265361 TTTAGCATGGTGAAGGTCACTGG - Intronic
1085341658 11:75735343-75735365 CTTGAGCTGGTGTAGGTCAAGGG + Intergenic
1086167428 11:83795869-83795891 GTCAACATGGTGAGGGACAAGGG - Intronic
1086659711 11:89400012-89400034 CTTACCATTGTGAGGGTAAATGG + Exonic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1091672345 12:2461400-2461422 CTTAACATTGGGAAGCTCCAGGG + Intronic
1092393396 12:8102059-8102081 CTTAACAGAATGAAGGACAAAGG + Intergenic
1093833485 12:23796277-23796299 AATAAGATGGTGATGGTCAATGG + Intronic
1095143283 12:38693165-38693187 CATAACATGGAGAAGATCTAAGG + Intronic
1097855596 12:64458446-64458468 ATTACCATGGTGAAGTTTAAGGG + Intronic
1101847677 12:108375641-108375663 CATAACATGGTGAAGAGCAAAGG + Intergenic
1102914304 12:116741524-116741546 CTTAATGTGGTGAAGGGAAAGGG + Intronic
1104308248 12:127629859-127629881 ATTAACCTGATGAAAGTCAATGG - Intergenic
1109257244 13:60098059-60098081 CTGGACTTGGTGAAGGTCAGTGG + Intronic
1110927593 13:81174373-81174395 CTTCACATTATGAAGGTCTATGG + Intergenic
1111801792 13:92989969-92989991 CTAAACATGGTGATTGTTAAGGG - Intergenic
1115890945 14:38028122-38028144 TTTAATATGGTGAAAGTAAATGG - Intronic
1116943822 14:50817126-50817148 CTTAAATTGGTGAAGGGAAATGG - Intronic
1117961517 14:61167693-61167715 AATAACATGGTGAATCTCAAAGG + Intergenic
1119181360 14:72607384-72607406 CTTCACATGGTGAAGGGGCAAGG + Intergenic
1119255212 14:73189860-73189882 CAACACATGGTAAAGGTCAAGGG - Intronic
1120545142 14:85801840-85801862 CTTGACATGAAGAAGGTCTATGG - Intergenic
1120957673 14:90097300-90097322 CTTAACATGGTGAAGGTCAAAGG + Intronic
1125068924 15:35528537-35528559 CTGAACATGGGGAATGCCAAGGG - Intronic
1125482827 15:40092351-40092373 TTTGACACTGTGAAGGTCAAAGG + Intronic
1126499649 15:49331144-49331166 CTTGACATGCTGAAAGTAAAAGG + Intronic
1127024674 15:54790903-54790925 CTTAACATGATGATGGACATTGG - Intergenic
1129371554 15:75099148-75099170 CATAAAAAGGTGAAAGTCAAAGG - Intronic
1129474934 15:75778624-75778646 ATAAACAGGCTGAAGGTCAATGG - Intergenic
1130719583 15:86373398-86373420 CTTAGCATGGTGGAGGGCATGGG + Intronic
1131864680 15:96694913-96694935 CATAACATGCTGAAGGTTCACGG + Intergenic
1139246409 16:65448732-65448754 CTTAACATTTTGAAGGTTAGAGG - Intergenic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1143051749 17:4131842-4131864 CATAATAAGGTAAAGGTCAAAGG + Intronic
1143525065 17:7467042-7467064 CAGGTCATGGTGAAGGTCAAGGG + Intronic
1144401836 17:14911921-14911943 GTTACTATTGTGAAGGTCAATGG - Intergenic
1144655739 17:17035131-17035153 GTTTACATGGAGAAGGTCAGGGG - Intergenic
1148571845 17:48676447-48676469 TCTAACATGGTAAATGTCAATGG - Intergenic
1149169146 17:53789768-53789790 CTTATGATGGTGTAAGTCAAAGG + Intergenic
1149502298 17:57162966-57162988 GTTAAAATGGTCAAGGTCACAGG - Intergenic
1151404366 17:73877166-73877188 CTGACCTTGGTCAAGGTCAAGGG + Intergenic
1155420094 18:25646481-25646503 CAAAACATGTTGAAGGTCAAAGG - Intergenic
1156371326 18:36474067-36474089 CTTAAACTGTTCAAGGTCAATGG - Intronic
1156553690 18:38044095-38044117 CTTAACATTGTGAAGTTCATGGG - Intergenic
1156654571 18:39270059-39270081 TTTTACATAGTAAAGGTCAAAGG - Intergenic
1157376803 18:47174866-47174888 ATTAACTCGGTGAAGGTGAAGGG - Intronic
1158811915 18:61047533-61047555 CATAACATGGGGAGGGTGAAAGG + Intergenic
1158902864 18:61982640-61982662 CATAAAGTGGCGAAGGTCAAAGG + Intergenic
1159019496 18:63131699-63131721 CTTGACATTGAGAAGGTCAGTGG + Intronic
1159667190 18:71176228-71176250 CATAACATGGCAAAGGTCAAAGG + Intergenic
1160655411 19:264782-264804 CTTAACACCGTCAAGGTCATTGG + Intergenic
1162178292 19:8847858-8847880 CCAATCATGGTGAAGGCCAAGGG - Intergenic
1165121798 19:33564515-33564537 CTAAACATGGAGAAGATCACAGG - Intergenic
1167040099 19:47019027-47019049 CTTAACATGGGGAAAGAAAATGG - Intergenic
926747609 2:16171879-16171901 CTAAACATGCTGAATATCAAAGG - Intergenic
927355300 2:22166292-22166314 CTGCACATGGTGAAGGATAAAGG + Intergenic
928872859 2:36001218-36001240 CTTAACATTCTGAATGACAAGGG + Intergenic
931334594 2:61326752-61326774 CCTAGCATGCAGAAGGTCAATGG + Intronic
935410659 2:102758456-102758478 CTTACCATGGAGGAGGTAAAAGG - Intronic
936637360 2:114273863-114273885 CTTGGAATGGTGAAGGTCAGAGG + Intergenic
937739220 2:125330104-125330126 ATTGACATAGTGAAGGGCAAAGG - Intergenic
939588381 2:144032894-144032916 CTTAGCATTGTGAAACTCAAGGG + Intronic
940370193 2:152892829-152892851 ATAAAAATGGTAAAGGTCAAAGG - Intergenic
942205023 2:173611536-173611558 TTTAACTTGGTGATAGTCAATGG - Intergenic
944350178 2:198717477-198717499 CTTAACATGGGAAAGATGAAAGG + Intergenic
946922631 2:224595511-224595533 CAAAACATGATGAGGGTCAAAGG - Intergenic
1169292981 20:4368573-4368595 GTTACCATGGTGAAGGAAAATGG + Intergenic
1169910211 20:10641980-10642002 CTTAACATGGCAAAGGGCACAGG - Intronic
1170125588 20:12959918-12959940 TTTAATATGGTGATGGGCAATGG - Intergenic
1172012102 20:31851519-31851541 CTGAAGATGGTGGAGGTGAAGGG + Intronic
1177086264 21:16709072-16709094 GTTAACATGGTGGAAGGCAAAGG + Intergenic
1178786300 21:35656770-35656792 CATAACATGGTGGAAGTCAAAGG - Intronic
1183241844 22:36663567-36663589 TTTGACATGGTGAAGATCACAGG + Intronic
949256402 3:2051703-2051725 CTTAAGAAAATGAAGGTCAAGGG + Intergenic
950887449 3:16374112-16374134 CATGAGATGGTGAAGGTGAAAGG - Intronic
953921434 3:46954583-46954605 CTTAAAATGGGGTGGGTCAAGGG + Intronic
956286384 3:67614622-67614644 CTTCACAGGCTGAAGGTGAAGGG + Intronic
957569320 3:81926011-81926033 CTGAACATGGACAAGGGCAAGGG - Intergenic
959245493 3:103862711-103862733 CTCAAGATGGTGCAGGGCAATGG - Intergenic
961141306 3:124558939-124558961 CATAACATGAGGAAGCTCAAAGG + Intronic
961529590 3:127532450-127532472 CATAACATGGCCAGGGTCAAAGG + Intergenic
961699488 3:128731407-128731429 ATTAACATGGTGCAGGTCAGAGG - Intronic
963824181 3:149933162-149933184 CTTAAGATGGTGCAGGGCAGAGG + Intronic
964642055 3:158918948-158918970 CTTAAAATGGGGAAGGTTACTGG + Intergenic
964663590 3:159148803-159148825 TTTAAGATGGATAAGGTCAAAGG + Intronic
967080516 3:186045297-186045319 CTTATCATGGTGAAGCTGAGAGG + Intergenic
971264230 4:25084074-25084096 CTGAAGATTGTGAAGGTCAAAGG - Intergenic
972575958 4:40351636-40351658 CTTAAAATGGTAAAGGCCATGGG - Intronic
975355886 4:73403430-73403452 CTATGCCTGGTGAAGGTCAAGGG + Intronic
977619292 4:99118574-99118596 TTTAACATACTGAAGGTCCATGG + Intergenic
978962243 4:114695130-114695152 CTTAAAATGGTTAAGAACAAAGG + Intergenic
979862849 4:125715906-125715928 CTTCACATGGTGAAGGGAAAAGG - Intergenic
980266067 4:130517531-130517553 CATTGCATGGTGGAGGTCAAAGG - Intergenic
982714517 4:158792807-158792829 CTTAGAATGGAGAAGGTAAATGG + Intronic
983230744 4:165126495-165126517 CCTCTCATGATGAAGGTCAATGG + Intronic
987467831 5:18293334-18293356 CTTAAGATGGTGCATTTCAAAGG - Intergenic
987762886 5:22188304-22188326 CACAACATGGTGAAGGCCAAAGG - Intronic
989630363 5:43476045-43476067 TTTTACACCGTGAAGGTCAATGG + Intronic
990242274 5:53827343-53827365 CTGAAGATTGAGAAGGTCAAGGG + Intergenic
991090180 5:62686802-62686824 CTTCACATGCTGACAGTCAAGGG + Intergenic
991897673 5:71421702-71421724 CACAACATGGTGAAGGCCAAAGG - Intergenic
994798471 5:104338194-104338216 CTTAACATGATTAAGGATAACGG - Intergenic
994856780 5:105131617-105131639 CTTAAGATGATGAAAATCAATGG - Intergenic
995215407 5:109589301-109589323 CTGCAGATGGAGAAGGTCAATGG + Intergenic
998589897 5:143465781-143465803 CACAACATGGCGCAGGTCAAAGG + Intergenic
999275324 5:150326105-150326127 CTTACTATGGTGAATGTCACAGG - Intronic
999900194 5:156079088-156079110 CTGAACATGGTGGAAGGCAAAGG + Intronic
1000856073 5:166399839-166399861 TCTAACATGGTGAATGGCAAAGG + Intergenic
1002207704 5:177575012-177575034 TCTAACAGGCTGAAGGTCAAGGG - Intergenic
1003397227 6:5763784-5763806 TTTAACATAGAGAAGGTAAAGGG + Intronic
1005519264 6:26584341-26584363 ATTGACATGGTGAAGGTCAGGGG + Intergenic
1005623034 6:27637481-27637503 CTGAAGACTGTGAAGGTCAAAGG + Intergenic
1010836308 6:80591214-80591236 CTTATCATGGTGGAAGGCAAAGG + Intergenic
1010984661 6:82410222-82410244 CACAACATGGTGAAGGTCACAGG + Intergenic
1011277720 6:85645719-85645741 ATTAAGATAGAGAAGGTCAAGGG - Intergenic
1014362831 6:120501991-120502013 TTTCCCATGGTGAAAGTCAAAGG + Intergenic
1014676787 6:124377698-124377720 CTTCTCATGGTAAAGTTCAATGG - Intronic
1015536765 6:134274339-134274361 TTTAAGATGGTCAAGATCAAAGG + Intronic
1016737552 6:147495541-147495563 CCTCACATGGTGGAGGTCAGGGG + Intergenic
1017834273 6:158163018-158163040 CTTTACATGGTGCTGGTCACAGG - Intronic
1018413019 6:163574389-163574411 CTTAACTTGGGTAAAGTCAAAGG + Exonic
1023486685 7:40695107-40695129 ATTAAAATGGTGAAAGTCTAAGG - Intronic
1034762160 7:153682943-153682965 CATAAGAAGATGAAGGTCAAAGG - Intergenic
1040345456 8:46488576-46488598 CTTAAAATGTTGAAGGACATGGG - Intergenic
1041412449 8:57571751-57571773 TTTAACACAGTGAAGGTCTATGG + Intergenic
1045500297 8:102739551-102739573 CTTAACATTTTGAAGGTCGGGGG - Intergenic
1046956189 8:120065053-120065075 TTTTACATGTTGGAGGTCAAAGG - Intronic
1047454488 8:124997379-124997401 TGTGACTTGGTGAAGGTCAATGG + Intergenic
1051580086 9:18662368-18662390 CTTAACAAGGTCCAGGCCAATGG + Intronic
1059440743 9:114305469-114305491 CTTAACATGATGAAGGAAAGTGG + Intronic
1187982085 X:24768480-24768502 GTTATAATGGTGAAGGTCATAGG + Intronic
1190566345 X:51733751-51733773 CATATCATAGGGAAGGTCAAAGG - Intergenic
1191784733 X:64905184-64905206 TTTCACATTGTGAAAGTCAATGG - Intergenic
1194642921 X:96425002-96425024 ATTAACAAGGTTAAGGGCAAAGG - Intergenic
1196527839 X:116748228-116748250 CTTAACAAGGTGCAGCTCAGTGG - Intergenic
1200024663 X:153247249-153247271 CTTCACATGGTGAAGGGCCTGGG - Intergenic