ID: 1120958779

View in Genome Browser
Species Human (GRCh38)
Location 14:90105882-90105904
Sequence GTCCAGGCCTTGGCAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120958773_1120958779 29 Left 1120958773 14:90105830-90105852 CCGACAAAGGTTTTGTGCTTCCT 0: 1
1: 0
2: 3
3: 12
4: 172
Right 1120958779 14:90105882-90105904 GTCCAGGCCTTGGCAAAAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 189
1120958775_1120958779 9 Left 1120958775 14:90105850-90105872 CCTAGTAAGACGGCATGATGTTC 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1120958779 14:90105882-90105904 GTCCAGGCCTTGGCAAAAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120958779 Original CRISPR GTCCAGGCCTTGGCAAAAGC AGG Intronic
900406533 1:2495422-2495444 GGCCAGGCCTTGGCGAAGGCTGG - Intronic
902082245 1:13829067-13829089 ACCCCGGCCTGGGCAAAAGCCGG - Intergenic
903543501 1:24109833-24109855 GGCCAGGCCGTGGCAGAGGCTGG + Intronic
903643476 1:24876301-24876323 ATCCAGGCCTTGGCCCCAGCAGG - Intergenic
904034916 1:27553395-27553417 GTCCAGTCCTTGTCCAAAGTAGG - Intronic
905111174 1:35595609-35595631 ATCCAGGCCTGGGCTAAAGAAGG - Intergenic
905132894 1:35774796-35774818 GCCCAGGACTTTGGAAAAGCAGG - Intergenic
905264381 1:36740766-36740788 GTCCAGCCCATGGGAGAAGCTGG + Intergenic
906285578 1:44585514-44585536 TTGCTGACCTTGGCAAAAGCAGG - Intronic
906292035 1:44625622-44625644 GAACAGGCCTTGGCAAGAGCGGG + Intronic
906299424 1:44671231-44671253 GCCCAGGCCTTTGCTAAAGCCGG - Intronic
906698179 1:47838905-47838927 GTCCAGGCAGGGGCGAAAGCTGG + Intronic
915492781 1:156260619-156260641 GGCCAGGCCTGGGCAGAAGAAGG + Exonic
917265991 1:173221437-173221459 TTCTAGGCCATGGCAAAAGAGGG + Intergenic
917457839 1:175200836-175200858 GCCCAGCCCTTGTCAACAGCTGG - Intergenic
917810191 1:178650998-178651020 GTCCAGGCAGTGGCAGAAGTGGG - Intergenic
918613997 1:186523710-186523732 GTCCCAGCCTTGGCTAAAACAGG + Intergenic
919584132 1:199415538-199415560 CTCCAGGGCTTGGGACAAGCAGG - Intergenic
919866029 1:201783609-201783631 CTCCAGGCCCTGGGAGAAGCTGG - Exonic
922109597 1:222543992-222544014 GTCCAGGAGGTGGCAGAAGCGGG + Exonic
922987142 1:229874654-229874676 GTCGAGGGCTTGGCAACACCTGG + Intergenic
924129206 1:240888473-240888495 CTCCAGGCCTTAGGAAAAGCCGG - Intronic
1062838908 10:654415-654437 GTCCGGGCCTTTTCAAAGGCTGG - Intronic
1063698801 10:8364586-8364608 GCCCAGGCCTGAGCAGAAGCTGG + Intergenic
1065734380 10:28738360-28738382 GTCCAGGATCTGGCAGAAGCTGG - Intergenic
1067081336 10:43214264-43214286 GTCCAGGCCTGGGCAGCAGCTGG + Intronic
1070411991 10:76150266-76150288 GGACAGGCCTTGTCAAAGGCTGG + Intronic
1070628952 10:78070795-78070817 GTCATGGCCTTGGCCTAAGCTGG + Intergenic
1070643513 10:78185758-78185780 GTCCAAGCCTTTGTAAATGCAGG - Intergenic
1071524100 10:86348203-86348225 GTACAGGCCTAGGCACATGCAGG - Intronic
1072038879 10:91589354-91589376 CTCCAGGCCCTGGCAAGGGCAGG + Intergenic
1073185288 10:101612126-101612148 CAACAGGCCTTGGCAAAGGCAGG - Intronic
1074655911 10:115587320-115587342 GACCAAGCCTTGGCAATGGCGGG + Intronic
1075729046 10:124625537-124625559 GTCCAGGCCTGGCCAGGAGCCGG - Intronic
1077075198 11:697704-697726 TTCCAGGCCTTAGCTAAACCAGG - Intronic
1077352132 11:2097868-2097890 GTCCAGGCCAGGGCAGAAGGAGG + Intergenic
1077553675 11:3215657-3215679 GTCCAGGCAGCCGCAAAAGCTGG - Intergenic
1077581262 11:3418751-3418773 TTCCAGGCAGTGGCAACAGCTGG + Intergenic
1077997831 11:7469161-7469183 GATCAGACCTTGGGAAAAGCTGG + Intergenic
1078422505 11:11224070-11224092 GCTCAGGCCTTGGGAAGAGCAGG - Intergenic
1079093833 11:17498325-17498347 GCCCAGGGCTTGGCAAAGGGGGG + Intronic
1080691078 11:34558588-34558610 ATCCAGGCCTTGGCAAAGGTGGG - Intergenic
1081461487 11:43276368-43276390 GAACAGGCCTTGGGAAGAGCTGG + Intergenic
1083619602 11:64042375-64042397 GTCCAGGCCTGGGCAACAGATGG - Intronic
1084682183 11:70672886-70672908 GTCCTGGCTCTGGCAAGAGCTGG + Intronic
1084834225 11:71791245-71791267 TTCCAGGCAGTGGCAACAGCTGG - Intronic
1085327633 11:75619061-75619083 GTCCAGGCCTGGGGCCAAGCAGG + Intronic
1085465785 11:76722358-76722380 CTCCACGCCTTTGCACAAGCTGG + Intergenic
1085640615 11:78190394-78190416 GACCAGGCCTGGGCAAAGGAGGG + Intronic
1085694384 11:78691446-78691468 CTACAGGACTTGGCACAAGCTGG + Intronic
1087207464 11:95412094-95412116 GGGCAAGCCCTGGCAAAAGCAGG - Intergenic
1088797432 11:113275183-113275205 ATCCAGGCCTTGGGGACAGCAGG - Intronic
1093218339 12:16388882-16388904 GTCCAGGCCTGGCCTAGAGCAGG - Intronic
1094509775 12:31089218-31089240 GTCCAGGCCTTGGGAGACGCTGG + Intronic
1102789989 12:115636867-115636889 GCCCTGGCCTTGGCAAAACACGG - Intergenic
1102987031 12:117286505-117286527 AGCCAGGCCTTGTCCAAAGCGGG + Intronic
1103088536 12:118080856-118080878 GTCCAGGTCTGGGGAAAAGAGGG + Intronic
1104830746 12:131749687-131749709 GTCCAGGCCGTGCCACCAGCTGG + Intronic
1105070874 12:133233961-133233983 CCCCAGGCCTTGGAAAAACCTGG - Intronic
1108914226 13:55588301-55588323 GTCAAGGACTTGGAAAATGCAGG - Intergenic
1110455409 13:75685508-75685530 CTCCAGGCCTTGTCAACAGGGGG + Intronic
1112312336 13:98330113-98330135 CTCCAGGCCTTTGCACAGGCTGG - Intronic
1117294879 14:54370334-54370356 GTCCAGGGGTTGGCAAACGTTGG - Intergenic
1120529104 14:85610646-85610668 GTCCAGGTCTAGGCAAGAGCAGG - Intronic
1120547087 14:85825401-85825423 TTCCTGGCCGTGGCAATAGCAGG + Intergenic
1120751719 14:88204073-88204095 GTAGAGGCCTTGGAAAATGCAGG - Intronic
1120958779 14:90105882-90105904 GTCCAGGCCTTGGCAAAAGCAGG + Intronic
1121831902 14:97060003-97060025 GTGCAGGGCTTGGCAAACTCTGG - Intergenic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1122771543 14:104099987-104100009 GTCCAGGCCTGGGCCATGGCGGG + Intronic
1126734399 15:51716857-51716879 GTCCAGGCCTCTGGAACAGCTGG + Intronic
1128538872 15:68511224-68511246 GGCCTGGCCGTGGCAACAGCAGG + Intergenic
1129960343 15:79679022-79679044 TTCCAGGCCTTTGCCAATGCTGG - Intergenic
1131072045 15:89472028-89472050 GGCCAGAGCTTGGCAATAGCTGG - Intronic
1131341233 15:91603196-91603218 GCCCAGTTCTTGGCAAAAGTTGG + Intergenic
1131729247 15:95261954-95261976 GGTCAGGCCTGGGCAAAACCAGG - Intergenic
1132912700 16:2323559-2323581 GTCCTGGGTTTGGGAAAAGCGGG + Exonic
1133050779 16:3116078-3116100 GGTCAGGCCTGGGCCAAAGCTGG + Intronic
1134814834 16:17197252-17197274 GTCCAGGCAGGGGCAAAGGCAGG - Intronic
1135323713 16:21512988-21513010 GTCCAGGCCTGTGTAAAACCTGG - Intergenic
1136335196 16:29606253-29606275 GTCCAGGCCTGTGTAAAACCTGG - Intergenic
1138205309 16:55120217-55120239 GTCCTGGCCTTGGCATCAGAAGG - Intergenic
1141244832 16:82296016-82296038 GGGCAGGCCTTGGCTACAGCAGG + Intergenic
1142035920 16:87862087-87862109 GTCCAGGCCTGTGTAAAACCTGG - Intronic
1143013144 17:3877285-3877307 CCCCAGGCCTTGGGACAAGCAGG + Intronic
1145095577 17:20022673-20022695 GCCCAGGCCCTAGCAACAGCAGG - Intronic
1148216344 17:45835823-45835845 GTCCAGGCCTTCACAAATGCTGG - Exonic
1152473967 17:80505697-80505719 GGCCAGGGCTGGGCAAAGGCAGG + Intergenic
1152555003 17:81048765-81048787 ATCCAGGCCTTGACCACAGCAGG - Intronic
1152799807 17:82325570-82325592 GTCAAGTCCTTGACACAAGCCGG + Intronic
1153078612 18:1194206-1194228 GTGCAGGCCCTGCCATAAGCAGG - Intergenic
1153904388 18:9648136-9648158 GTTCAGGTCCTTGCAAAAGCAGG - Intergenic
1155435842 18:25811964-25811986 GACCATGGCTTGGAAAAAGCAGG - Intergenic
1156890995 18:42189194-42189216 GTCAAAGACTTGGCAAAAACGGG - Intergenic
1160322111 18:77905719-77905741 GGCCTGGCCTCGGCAAAGGCTGG + Intergenic
1160892792 19:1388028-1388050 GTCCACGCAGTGGCAAAGGCTGG + Intronic
1161219893 19:3113661-3113683 GGCCACGCCTTGGCAGGAGCCGG + Intronic
1163577375 19:18118534-18118556 GTCCAGGGCTGGGCAGAACCAGG + Intronic
1164098802 19:22035882-22035904 GTCCTGGCCCTGCCAAAAGTGGG - Intergenic
1164201764 19:23024949-23024971 GTCCCGGCCCTGCCAAAAGTGGG - Intergenic
1165465402 19:35971748-35971770 GTCAAGTCCTTGGGAAAAGAGGG - Intergenic
1168609351 19:57786704-57786726 CTCCAGGCCTTTGCCTAAGCCGG - Intronic
925534431 2:4901276-4901298 TGCCAGGCCTTTGCAGAAGCAGG + Intergenic
927436777 2:23073461-23073483 GTCCATGCCTGGGAAAAGGCGGG - Intergenic
929562644 2:42965376-42965398 GGCCAGACATAGGCAAAAGCTGG + Intergenic
933561142 2:83887739-83887761 GTCCAGCACTTGGCAAAGGCAGG + Intergenic
936969969 2:118168007-118168029 GCCCAGGCCCTGGCATGAGCTGG + Intergenic
938172218 2:129089312-129089334 CTCCAGGCATTCACAAAAGCAGG - Intergenic
946043177 2:216800047-216800069 GTCCTGGCCTTGGCAACAAGGGG + Intergenic
946490797 2:220147012-220147034 GTTCAAGCATTGGCAATAGCTGG + Intergenic
948060690 2:235041650-235041672 GTCCAGGTCGTGGCAAGACCGGG - Exonic
948094313 2:235321404-235321426 TTCCAGGCGTTGGAAAGAGCAGG - Intergenic
948517419 2:238512381-238512403 GTGCAGGGCTTGGCACAAGGCGG - Intergenic
948684934 2:239664441-239664463 GTCCTGGCCTTTGCCAAAGCGGG - Intergenic
948869265 2:240790106-240790128 GTCCAGGGCCTGGGAAATGCTGG - Intronic
1168773707 20:431940-431962 GGCCAGGCCCTGGCAAGAGAGGG - Intergenic
1171020954 20:21583677-21583699 GTCCAGGCTTTAGAGAAAGCAGG - Intergenic
1172187446 20:33039962-33039984 ATCCAGGCCTTTGCACATGCTGG - Intronic
1172847013 20:37935527-37935549 CTCCAGGCCTTTGCACAGGCTGG + Intronic
1175033433 20:55977207-55977229 GGCCAGGCCTTGGCATACCCTGG + Intergenic
1181685345 22:24524160-24524182 GTCTAGGCCTTGACGATAGCAGG + Intronic
1183012317 22:34956850-34956872 GTCCAGGTCTGTGCAAAACCTGG - Intergenic
1185126930 22:49016618-49016640 CTCCAGGCCTTGGTGGAAGCAGG - Intergenic
1185421656 22:50738380-50738402 GTCCAGGGCTAGGGAAAAGGAGG + Intronic
950723411 3:14900499-14900521 GTCCAGGCTTTGGCGCAAGGAGG - Intronic
951502976 3:23411134-23411156 TTCCAGGCCTAAGGAAAAGCAGG + Intronic
953332007 3:42061450-42061472 ACCCTGGCCATGGCAAAAGCAGG + Intronic
953339726 3:42123338-42123360 TTCCTGGCCTTGGCTCAAGCAGG + Intronic
953753581 3:45628142-45628164 TTCCAGGCCTTGGCACAGGGAGG + Intronic
954274585 3:49533935-49533957 TTCCAGCCCCTGGCAACAGCGGG - Exonic
954750647 3:52811555-52811577 GCCCAGGGCCTGGCATAAGCTGG + Intergenic
960122052 3:113957103-113957125 TTCCAGGCCATGGCAAAATTTGG + Intronic
960869476 3:122234121-122234143 GTCCAGTTCATGGCAAAAGTAGG + Intronic
960901165 3:122555806-122555828 GCCCTGGCCCTGGTAAAAGCTGG - Exonic
961300707 3:125920327-125920349 TTCCAGGCAGTGGCAACAGCTGG - Intergenic
961412628 3:126733735-126733757 GTCCAGGACTTAGCACATGCTGG + Intronic
962212604 3:133491592-133491614 GTCCAGGCATTGGTTGAAGCTGG - Intergenic
966552338 3:181219225-181219247 GTCCAGGCCTTGGGCAAATCTGG + Intergenic
967073019 3:185978681-185978703 GGCCTGGCCTTGGCAAAGGCTGG + Intergenic
967343031 3:188422079-188422101 GTCAAGGCCAGAGCAAAAGCTGG - Intronic
975632726 4:76418988-76419010 GTCCAGGCCTGGGGAAAAGAGGG - Intronic
975762285 4:77631887-77631909 GTCCAGTTCTTCACAAAAGCTGG + Intergenic
976577366 4:86689704-86689726 GTCCAGGTCTTGGGGAAATCTGG - Intronic
976638684 4:87313889-87313911 CTTCAGGCCTTGGGAAAAACTGG - Exonic
977149142 4:93487582-93487604 GTCCAGGGCTTGCCAAATGAGGG - Intronic
978901690 4:113958122-113958144 CTCCAGGCAGTGGCAACAGCTGG - Intronic
978959070 4:114653443-114653465 GTGCAGGACTTGGCTAAAACAGG - Intronic
979834294 4:125343882-125343904 ATCCAGGCCTGTGCAAAAGGAGG + Intronic
979985632 4:127310468-127310490 GTCAAAGCCTTGACATAAGCAGG - Intergenic
980245285 4:130231108-130231130 ATCCAGGGCTTGACAAATGCAGG - Intergenic
981424633 4:144588909-144588931 GTCCAGGCCTTTGCTGAAGCTGG + Intergenic
981542693 4:145861945-145861967 TCCCAGGCCTTGGAGAAAGCTGG + Intronic
984087321 4:175329051-175329073 GTCAAGTACTTGGCAAAGGCTGG + Intergenic
993461229 5:88184919-88184941 GTGCAGGCCTAGGCTAATGCAGG - Intergenic
993936376 5:94009312-94009334 GTCCAGTCTTTGGAGAAAGCAGG - Intronic
994016512 5:94972853-94972875 GGCCAGGCTATGGGAAAAGCTGG - Intronic
996160630 5:120158319-120158341 GTCCAGCCCTTGTCTAAAGCTGG - Intergenic
1001276295 5:170354057-170354079 ACCCAGGTCTTGGAAAAAGCTGG + Intronic
1002835255 6:860311-860333 GTCCACACCTTGGCAGAACCAGG + Intergenic
1005873246 6:29993243-29993265 GTCCATGCCTGGGCAAAATAGGG - Intergenic
1006191228 6:32210790-32210812 GTCCAGGCCTTGCCAGAACGGGG - Exonic
1006912871 6:37575440-37575462 GTCAAGGCCTTGCCACAGGCAGG + Intergenic
1007081606 6:39109170-39109192 CTCCAGGCCTTGGCTCAGGCTGG - Intronic
1008045285 6:46845343-46845365 GTGGTGGCCTTGGGAAAAGCAGG + Intergenic
1008595813 6:53040548-53040570 GTCAAGGTGTTGGCCAAAGCTGG - Intronic
1008692663 6:53998550-53998572 TTCCAGGCCTTTGCACATGCAGG - Intronic
1011351701 6:86431299-86431321 GTGCAGGCAATGGCACAAGCAGG - Intergenic
1016406576 6:143737802-143737824 GTCCAGGCCTAAACTAAAGCAGG - Intronic
1016829100 6:148416049-148416071 GTCCAGGGCTTTAGAAAAGCTGG + Intronic
1018237455 6:161740351-161740373 GTCCAGGCCTCAGGAAATGCAGG - Intronic
1018971703 6:168534426-168534448 GTCCGGGCCCTGGCAGACGCAGG - Intronic
1019101369 6:169633250-169633272 CTCCAGGTGTTGGCAAGAGCAGG + Intronic
1019709498 7:2511773-2511795 GTCCAGGCCTTGGTGAGGGCAGG - Intergenic
1020111464 7:5450529-5450551 GCCCAGGCCTTGCCCAGAGCAGG - Intronic
1020321223 7:6940075-6940097 TTCCAGGCAGTGGCAACAGCTGG + Intergenic
1023162244 7:37308799-37308821 GTCCAGTGCTTGCCAAAGGCTGG + Intronic
1024341557 7:48268678-48268700 GTCCAGGCCATGGCACAGGAAGG - Intronic
1026024198 7:66732071-66732093 CACCAGGCCCTGGCAGAAGCAGG - Intronic
1026888922 7:73970963-73970985 CACCAGGCCCTGGCAGAAGCAGG - Intergenic
1028850323 7:95530532-95530554 TTCCAGGCCTAAGGAAAAGCAGG + Intronic
1034079026 7:148259543-148259565 GTCTAGGCCATGGAAAAAGCGGG + Intronic
1034375848 7:150643222-150643244 GTCCAGGATTTGGCATTAGCAGG - Intergenic
1036195354 8:6708799-6708821 GTCCAGCGCTTGGTAGAAGCGGG - Exonic
1037899987 8:22682469-22682491 GACCAGGCCTGGGCAGAAGCAGG + Intergenic
1039804245 8:40984970-40984992 GGCCAGGCCTGGGAAAGAGCAGG - Intergenic
1041140503 8:54813427-54813449 ATCCATGCCATGGTAAAAGCAGG + Intergenic
1041223829 8:55678252-55678274 GTCCAGGCCTTGGAACAGGGTGG - Intergenic
1041536154 8:58927587-58927609 GCCCAGGACTTGGCAAGAGTCGG + Intronic
1046009324 8:108527334-108527356 GTCTAGGCCTTGGGACAAGAGGG + Intergenic
1047447374 8:124931369-124931391 CTCCAGGTCTTGGCTAAACCTGG - Intergenic
1047763081 8:127968565-127968587 GGCCTGGCTTAGGCAAAAGCTGG + Intergenic
1048376295 8:133825482-133825504 GTCCAGGCACTGGTAAAAGGTGG - Intergenic
1049427828 8:142545150-142545172 GTCCAGGCCCAGGGCAAAGCAGG - Intergenic
1049719031 8:144107138-144107160 GTCCAGGCATTGGTTGAAGCTGG - Exonic
1050360156 9:4822527-4822549 CACCAAGCCTGGGCAAAAGCTGG - Intronic
1058140623 9:101353825-101353847 GTCTAGGCCTTGACCAAAGGTGG + Intergenic
1058429765 9:104907742-104907764 GCCCAGTCCTTAGCTAAAGCTGG - Intronic
1060587044 9:124793136-124793158 GTGCAGGCCCTGGGAAATGCCGG + Intronic
1060934290 9:127506581-127506603 GTCCAGCCCTTGGCACAAGCAGG + Exonic
1062138820 9:134944283-134944305 GTCCAGCCCCTGGAGAAAGCTGG - Intergenic
1062219122 9:135404821-135404843 GTCCAGGCCTGGGCTTAGGCTGG - Intergenic
1062364946 9:136204006-136204028 GCACAGGACTTGGCAAAGGCAGG + Intronic
1186440025 X:9577773-9577795 GTCCTGGCCTTGGCATTACCAGG - Intronic
1187116118 X:16353077-16353099 GTACAGGCCTTGGCAAATTATGG - Intergenic
1187124830 X:16445303-16445325 CTGCAGGACTTGGCAGAAGCAGG - Intergenic
1194531933 X:95060096-95060118 GCATAGGCCTTGGGAAAAGCTGG + Intergenic
1195931502 X:110081911-110081933 GTCCTGTGCTTGGCAAAGGCTGG + Intronic
1198926869 X:141807386-141807408 GCCAAGGCCTTGGCCAAAGAAGG + Intergenic
1199911143 X:152288159-152288181 TTCCAAGCCCAGGCAAAAGCAGG + Intronic
1199974592 X:152885627-152885649 GTCCAGGCCTGGCTCAAAGCAGG + Intergenic