ID: 1120960153

View in Genome Browser
Species Human (GRCh38)
Location 14:90117195-90117217
Sequence CAGTGTATACAGCTGGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120960148_1120960153 8 Left 1120960148 14:90117164-90117186 CCTAGATGGTTACTCATTGACTC 0: 1
1: 0
2: 2
3: 16
4: 175
Right 1120960153 14:90117195-90117217 CAGTGTATACAGCTGGACAAAGG 0: 1
1: 0
2: 1
3: 19
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120960153 Original CRISPR CAGTGTATACAGCTGGACAA AGG Intronic
900231265 1:1559562-1559584 TAGTGTATATACCTGGACCAGGG - Intronic
902389518 1:16094957-16094979 CAGTTTATCCATCTGGACAATGG + Intergenic
903278871 1:22238815-22238837 CAGTTTACACATCTGTACAATGG - Intergenic
904751547 1:32743645-32743667 CAGTGTATACTCCAGGGCAATGG + Intronic
905251059 1:36648726-36648748 CAGTGTATACTGCTTGAAGATGG + Intergenic
905980827 1:42225183-42225205 CAATGTTTACATGTGGACAAAGG + Intronic
906072866 1:43029952-43029974 CAGTGGTTAAGGCTGGACAATGG - Intergenic
906439562 1:45829453-45829475 CTATGTACACTGCTGGACAAAGG - Exonic
911369891 1:96984219-96984241 CAGTGTCTTCATCTGGAAAATGG - Intergenic
916180125 1:162076213-162076235 GAGGGTAGACAGCAGGACAAGGG - Intronic
917078594 1:171233324-171233346 CAGTATTTACAGATGGAAAAAGG + Intergenic
921065404 1:211619129-211619151 CAGTTTCTGCAGCTGTACAATGG - Intergenic
921805407 1:219448568-219448590 AGGTGTAGACAGATGGACAATGG - Intergenic
924271381 1:242336649-242336671 CAGTGTTTGCATCTGGGCAAGGG + Intronic
924806011 1:247362419-247362441 CAGTGAATCCAGCTACACAAAGG + Intergenic
1063546434 10:6986437-6986459 TAGTGTAGACAGCTGGATGAAGG - Intergenic
1063581950 10:7316209-7316231 CAATGTTTACAGCTGGGCTAGGG + Intronic
1066713284 10:38259479-38259501 CAGTGTTTGCATCTGGGCAAGGG - Intergenic
1069630328 10:69893678-69893700 CAGTGGAAACAGCTGGACCTTGG + Intronic
1072784183 10:98268844-98268866 CAGTGTTCCCAGCTGCACAATGG - Intergenic
1074273839 10:111982256-111982278 CAGTGTCTACAACAGGACAAAGG + Intergenic
1079428645 11:20366956-20366978 CAGTCTATATAACTGGACTAGGG - Intronic
1082092999 11:48104947-48104969 CGGTGTCTACATCTGGAAAATGG + Intronic
1087078766 11:94150361-94150383 CAGTTTAAACAGGTGGAGAAGGG + Intronic
1088560166 11:111106662-111106684 CTGTCTATACTGCTGGACACTGG - Intergenic
1089134244 11:116236505-116236527 CATTGTCTACACCTGAACAAAGG + Intergenic
1091181321 11:133606989-133607011 CAGTGTATACACGTGGACACAGG - Intergenic
1092026415 12:5244634-5244656 CAGTGTAAACAGCAGAAGAAAGG - Intergenic
1092306228 12:7303941-7303963 CAGTGTATAAAGCAGGCGAAAGG + Intergenic
1094339254 12:29392534-29392556 TAGTGTATATAAGTGGACAAAGG + Intergenic
1095710888 12:45286834-45286856 CAGTGTCTGCACCTGGAAAATGG - Intronic
1095999989 12:48121226-48121248 CAGGGTAGCCACCTGGACAAGGG + Intronic
1096136978 12:49210695-49210717 CAGTTTATTCAACAGGACAATGG + Intronic
1102189411 12:110975391-110975413 CAGTGTCTCCACCTGGAAAATGG + Intergenic
1102454516 12:113063396-113063418 CAGTTCACACAGCTGGACAGAGG + Intronic
1102760288 12:115379296-115379318 CAGTTTTTCCAGCTGGAAAATGG - Intergenic
1104589484 12:130072889-130072911 CAGTGTAGACAGCTGGGCCCTGG - Intergenic
1104743501 12:131195540-131195562 CTGTGTTTACAGCTGGATCACGG - Intergenic
1104790832 12:131481144-131481166 CTGTGTTTACAGCTGGATCACGG + Intergenic
1105282312 13:18974008-18974030 CAATGTTTACTGGTGGACAAGGG - Intergenic
1105821991 13:24087992-24088014 TACTAAATACAGCTGGACAAAGG - Intronic
1106058906 13:26266335-26266357 GAGTGTATAGAGCAAGACAAGGG + Intronic
1106309025 13:28536649-28536671 TAGTGTATACAAGTGGACAAAGG + Intergenic
1106355833 13:28982169-28982191 CAGTGAAGACAGATGGAAAAAGG + Intronic
1106751626 13:32776478-32776500 CAGTTTATACAACTGTATAAAGG - Exonic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107892602 13:44927399-44927421 CTGTGTACACAGATGGGCAATGG - Intergenic
1109708319 13:66129418-66129440 CAGTATAAACAGCTGGTCATTGG + Intergenic
1110205285 13:72904827-72904849 CAGTGCATACAGCTGTGTAAAGG - Intronic
1110604232 13:77412580-77412602 CAGTGTAAACATCTTCACAAAGG - Intergenic
1111390450 13:87587908-87587930 CAATGTATCCATCTAGACAAAGG + Intergenic
1114626551 14:24133856-24133878 CAGTGTTTGCAACTGTACAATGG - Intergenic
1115125214 14:29984457-29984479 CAGTTGATATAGCTGAACAATGG - Intronic
1117544005 14:56776062-56776084 AAGTGTATACAGATGGTCAGAGG - Intergenic
1119504854 14:75163695-75163717 AAGTGTTTACAGCTGGTAAACGG - Intronic
1120960153 14:90117195-90117217 CAGTGTATACAGCTGGACAAAGG + Intronic
1121240490 14:92426465-92426487 GAATTTCTACAGCTGGACAAGGG - Intronic
1121510616 14:94510147-94510169 CAGTGTACTCACCTGTACAATGG + Intronic
1122650044 14:103221154-103221176 AAGGGTGTACAGCTGGACGATGG + Intergenic
1127291012 15:57571193-57571215 TAGCATATAGAGCTGGACAAAGG + Intergenic
1128506228 15:68274831-68274853 CAGTTTCTACATCTGTACAATGG - Intergenic
1128789823 15:70424865-70424887 CAGTGTTTTCATCTGAACAATGG - Intergenic
1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG + Intergenic
1134070135 16:11255677-11255699 CAGTGGACACAGCTAGAAAATGG + Intronic
1134366025 16:13579902-13579924 CAGGGTTTTCAGCTGGAAAATGG + Intergenic
1134667409 16:16028776-16028798 CAGTTTTTACACCTGGAAAATGG - Intronic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1136274492 16:29170419-29170441 CTATGTGTTCAGCTGGACAAAGG + Intergenic
1136349870 16:29699773-29699795 AAGTGTAGCCAGATGGACAAGGG - Intergenic
1137392045 16:48089548-48089570 CTGTGTAAACAGCTGGAAATAGG + Intronic
1141150598 16:81562245-81562267 CAGTGTGTTCTGCTGCACAATGG - Intronic
1142078778 16:88136073-88136095 CTATGTGTTCAGCTGGACAAAGG + Intergenic
1142127075 16:88415478-88415500 CAGTGTGTTCAGCTGTAAAATGG - Intergenic
1147299825 17:39517455-39517477 CAGGCCACACAGCTGGACAAGGG - Exonic
1147860601 17:43520200-43520222 CAGTGTGTACAGCTGCTCCATGG - Exonic
1148131148 17:45263255-45263277 CAATGTGGACAGCTGGACAAAGG + Exonic
1148664741 17:49365902-49365924 CAGTGTCAGCAGCTGAACAAGGG - Intergenic
1150899775 17:69259472-69259494 CACTTTATATAACTGGACAATGG - Intronic
1151508339 17:74543559-74543581 TGGTGAATACAGCTGGATAAGGG + Intronic
1151999043 17:77633309-77633331 CAGTGTTTACATCTGGAGAGGGG - Intergenic
1154977954 18:21477333-21477355 CACTGGATACAGCTGGATACTGG + Exonic
1156967267 18:43109463-43109485 CAGTGTATACAGGGGCACAAAGG - Intronic
1159018078 18:63118692-63118714 CATTTTCTACATCTGGACAATGG + Intergenic
1159585436 18:70279320-70279342 AAATGTCTACAGCTGGATAATGG - Intergenic
1159726227 18:71963306-71963328 TAGTGTATACAGCTAGATCAAGG + Intergenic
1160307112 18:77750216-77750238 CAGTGGTTACAGCTGGAAAAAGG + Intergenic
1160467562 18:79094304-79094326 CAGTGGAGAAAGCTGGACGAGGG - Intronic
1163116520 19:15192068-15192090 CTGTGTAGCCAGCTGGACACTGG + Exonic
1168154917 19:54467985-54468007 CAGTTCATACAGCTGGCAAAGGG - Intronic
1168527878 19:57103327-57103349 CAGTGTAACCAGGTGGATAATGG - Intergenic
925093182 2:1171791-1171813 GATATTATACAGCTGGACAAAGG + Intronic
926344060 2:11929667-11929689 CAGTTTCTACAGCTGTAGAAAGG + Intergenic
926532168 2:14062118-14062140 CCGTGGATCCAGGTGGACAAAGG + Intergenic
926920528 2:17935575-17935597 CAGTGTATATGGCTGGAAAGTGG - Intronic
927050564 2:19324109-19324131 CAGTGTCTACATCTGTAAAATGG + Intergenic
930684643 2:54295028-54295050 GAGTGTATACAGCTGTGCACTGG + Intronic
931111099 2:59112559-59112581 CAGTGTCTACAGCTTTAAAAAGG - Intergenic
931433871 2:62230959-62230981 AAGTGTACACAGATGGGCAAAGG - Intergenic
931816485 2:65908216-65908238 GAGGGTGTACAGCTGGACATGGG - Intergenic
932977008 2:76614971-76614993 CAGTGGATCCAGCTGTGCAAAGG - Intergenic
933275349 2:80278064-80278086 TAATGTATACACCTGGACAACGG - Intronic
934632092 2:95937786-95937808 CAGTGTATACAGCTATACTATGG + Intronic
934801415 2:97165492-97165514 CAGTGTATACAGCTATACTCGGG - Intronic
935753392 2:106258683-106258705 CAGTATATACAGTTTGACACAGG - Intergenic
936008134 2:108908099-108908121 CACTGTCCACAGCTGGGCAATGG - Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938374856 2:130798458-130798480 CTGGGTACACAGCAGGACAATGG + Intergenic
938979191 2:136509405-136509427 CAGAATATAAAGCTGGACACAGG + Intergenic
939763174 2:146210427-146210449 AAGTATCTACACCTGGACAATGG + Intergenic
943382606 2:187170596-187170618 CAGTGACTACAGCTGGACGTTGG - Intergenic
945881181 2:215326934-215326956 CAGTGTGTACAGCTGGGCAGGGG - Exonic
1168784852 20:529409-529431 TGGCATATACAGCTGGACAAAGG - Intronic
1169322130 20:4641666-4641688 CAGTGGACACAGCTCAACAACGG + Intergenic
1170301480 20:14889216-14889238 CAGTGTATACTACTGGCCAAAGG + Intronic
1174220863 20:48954111-48954133 CAGTGTCCACAGGAGGACAAGGG + Intronic
1174347017 20:49937495-49937517 CAGTGTATTCACCTGTAAAATGG - Intronic
1175388294 20:58611066-58611088 CAGTGTCTACAGCTGTAAAATGG - Intergenic
1175420285 20:58827999-58828021 CAGTGTAGACATCTTGAAAAAGG + Intergenic
1182276838 22:29195271-29195293 CAGTGTGTTCACCTGGAAAATGG - Intergenic
1183002393 22:34872176-34872198 CAGTCTAGAGAGCTGGGCAAAGG - Intergenic
1183473950 22:38025704-38025726 CAGTTTATGCATCTGTACAATGG - Intronic
950029091 3:9840188-9840210 CAGTGGCTGCAGCTGGACCAGGG + Exonic
950555249 3:13691724-13691746 CACTGCACCCAGCTGGACAAGGG + Intergenic
952069739 3:29619610-29619632 CAGTGTATCCATCTATACAATGG + Intronic
952871418 3:37904435-37904457 CAGTGTGAAGAGCTGTACAAGGG + Intronic
954222599 3:49163695-49163717 CAGGGTAGACACCTGGATAAAGG + Exonic
957453339 3:80408668-80408690 CTGCGTATACAGCTTTACAAAGG + Intergenic
961625569 3:128261098-128261120 CATTGTTGACACCTGGACAATGG - Intronic
962907917 3:139822360-139822382 CAGTGAGAACACCTGGACAAAGG + Intergenic
963213818 3:142723462-142723484 CAGTGTATACTGCTCGATGATGG + Intergenic
964828748 3:160859587-160859609 GAGTGAATACAGCTAGACCAGGG - Intronic
968079178 3:195834838-195834860 CAGTGTATCCATCTGGGAAAGGG - Intergenic
969386531 4:6853427-6853449 CAGTTTCTACATCTGGAAAAGGG - Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
973623844 4:52751735-52751757 CAGTGGACACAGGTGGCCAATGG - Intergenic
973796786 4:54435256-54435278 CAGTTTATACTGCTGCAAAATGG - Intergenic
976005380 4:80423789-80423811 CACTGTATAAAAATGGACAAAGG + Intronic
977332013 4:95648329-95648351 CAGGCTATACAGCTGGGAAATGG - Intergenic
977727721 4:100316702-100316724 CTCTGTACACAGCTGGACATTGG - Intergenic
978999017 4:115194658-115194680 CAATCTATACATCTGGACAAAGG - Intergenic
981916572 4:150040413-150040435 CAGTATATACAGATTGAAAAGGG + Intergenic
984162876 4:176275531-176275553 CTGTGTAAACTGCTGGAGAAAGG - Intronic
984779910 4:183515697-183515719 CAGTTTGTTCAGCTGGAAAATGG + Intergenic
984798712 4:183692098-183692120 CAGTGTATTCATCTGTAAAATGG + Intronic
986339953 5:6780377-6780399 CAGTGCATACATCTGCAGAAAGG + Intergenic
987381357 5:17288855-17288877 CAGAGGGAACAGCTGGACAAAGG + Intergenic
990389365 5:55303275-55303297 CAGTGTGTACATCTGCAGAATGG + Intronic
999232058 5:150067373-150067395 CCTTGTCTACAGCTGGTCAAAGG - Intronic
1000644793 5:163748239-163748261 CAGTATATACAGCTAAAAAAAGG + Intergenic
1002080784 5:176736230-176736252 CAGTGTTTCCATCTGTACAATGG + Intergenic
1002135240 5:177103730-177103752 CAGTGTCCACATCTGGAAAATGG - Intergenic
1002762972 6:216076-216098 CATTCTTAACAGCTGGACAATGG + Intergenic
1002919584 6:1557406-1557428 CAGTGTACTCAGGTGGAAAATGG - Intergenic
1003333164 6:5146448-5146470 CAGTCCATAGAGCTGGAAAAGGG + Intronic
1003400300 6:5785150-5785172 CAGAGGATACAGCAGGAGAAGGG + Intergenic
1004935663 6:20505817-20505839 AACTGAAAACAGCTGGACAAAGG - Intergenic
1005405755 6:25486087-25486109 CAGTGTTTACAGCTGGAAAAAGG - Intronic
1005898941 6:30200757-30200779 CAGTGTATCCATCTGTAAAATGG + Intronic
1006449048 6:34095478-34095500 CAGTTTCTTCAGCTGCACAATGG + Intronic
1007717345 6:43864963-43864985 CAGCTTTTACAGCTGGAAAAGGG - Intergenic
1008096912 6:47348492-47348514 CTGTGTATACAGGCGGACACTGG - Intergenic
1014131530 6:117839874-117839896 CAGTGTCTACAGGGGGAAAAGGG + Intergenic
1014181408 6:118388412-118388434 TTATTTATACAGCTGGACAAAGG + Intergenic
1014405895 6:121050113-121050135 CATTGTATACAAAAGGACAACGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018155190 6:160979042-160979064 CACTGTAAACAACTGGAAAATGG + Intergenic
1021363635 7:19748498-19748520 CAGTGTATACAGCTCATAAATGG + Intronic
1021729205 7:23580232-23580254 CACTGTATCCAGCTGGGCAGTGG + Intergenic
1022047510 7:26633925-26633947 CAGTGTATACTGCTGGGTGATGG + Intergenic
1022400554 7:30032491-30032513 CAGTGTCTTCATCTGGAAAATGG - Intronic
1024989628 7:55222969-55222991 CAGTGCATATAGGGGGACAAGGG + Intronic
1026632952 7:72053733-72053755 CAGTGTATACTGCTGGGTGATGG - Intronic
1027615878 7:80423353-80423375 CAATGGATCCTGCTGGACAATGG - Intronic
1028818823 7:95182070-95182092 CAGTGTATACTGCTGGGTGATGG + Intronic
1031701021 7:124926892-124926914 GAGTGTACAGAGATGGACAATGG + Intronic
1034857034 7:154560309-154560331 CAGTGTTTAGAGCAGGACAAAGG - Intronic
1038793172 8:30686741-30686763 CAGTGCTTACATCTGTACAATGG + Intronic
1039532548 8:38276541-38276563 CAGTGCATGAAGCTGGACACAGG + Intronic
1040594470 8:48824133-48824155 CAGTGTATACAGTTGTAACAGGG + Intergenic
1043527144 8:81109784-81109806 CAGTGTCTTCATCTGTACAATGG - Intronic
1043798558 8:84578267-84578289 GGGTGTCTACATCTGGACAAGGG + Intronic
1046307277 8:112385872-112385894 TAGTGTATATAGCTGAATAATGG + Intronic
1047506837 8:125486785-125486807 CAGTGTTTTCACCTGTACAATGG + Intergenic
1047521907 8:125601472-125601494 CAGTGAAGTCATCTGGACAATGG - Intergenic
1048511827 8:135069961-135069983 CAGAGACTACAGCTGGACATTGG + Intergenic
1048636760 8:136304847-136304869 GAGTGTTTACACCTGGAGAAGGG + Intergenic
1051175375 9:14354890-14354912 CAGTGTTCACAACAGGACAAGGG - Intronic
1051741529 9:20257181-20257203 CTGTGTATACTGCTGAACAAGGG - Intergenic
1052113962 9:24625951-24625973 CAGTGTATACAGTTGGAAAGGGG + Intergenic
1052957514 9:34264885-34264907 CAGCATATACAACTGGAAAAAGG + Intronic
1053557204 9:39149729-39149751 AAATGTAGACAGCTGGAAAAAGG - Intronic
1054090189 9:60838149-60838171 AAATGTAGACAGCTGGAAAAAGG - Intergenic
1054111600 9:61113706-61113728 AAATGTAGACAGCTGGAAAAAGG - Intergenic
1054609257 9:67217419-67217441 AAATGTAGACAGCTGGAAAAAGG + Intergenic
1055427755 9:76213678-76213700 AAGTGGGTACAGCTGGTCAAAGG - Intronic
1058538975 9:105992454-105992476 CAGTGGAAACAGATGTACAATGG - Intergenic
1059716806 9:116920779-116920801 CAGTGTATTCATCTGTAAAATGG - Intronic
1060160739 9:121360928-121360950 CAGTGTATACACTGGGAAAATGG + Intronic
1060380737 9:123168727-123168749 CAGAGTAGCCAGCTGGTCAAAGG + Intronic
1060399043 9:123336955-123336977 CAGTTTCTCCAGCTGGTCAATGG - Intergenic
1061126401 9:128679115-128679137 CAGTGTATATATCTGTAAAATGG - Intergenic
1187163154 X:16782839-16782861 CAGAGTTTATAGCTGGACACAGG - Intergenic
1188615047 X:32147841-32147863 GAGTGTATACAGTTAGAAAATGG - Intronic
1189092806 X:38105149-38105171 CAGTGTGTCCAACTGGACAAAGG + Intronic
1191821733 X:65317473-65317495 CAGTGTATACAGCTCGATGATGG - Intergenic
1192179507 X:68907590-68907612 CAGTGTCTCCATCTGTACAATGG - Intergenic
1192538978 X:71952351-71952373 GAGTGTTTACAGTTGGAGAAGGG + Intergenic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1195929579 X:110061022-110061044 CTCTGTAGGCAGCTGGACAAGGG + Intronic
1196990942 X:121328076-121328098 CACTGGATACAGCTGGAAAAGGG - Intergenic
1201252262 Y:12071295-12071317 CAGTCTATACATCTGAAAAAGGG - Intergenic
1201597971 Y:15693584-15693606 CTGTGAACACAGCTTGACAAGGG + Intergenic