ID: 1120961349

View in Genome Browser
Species Human (GRCh38)
Location 14:90127953-90127975
Sequence TTGGTAGTTGCCCAGGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120961349 Original CRISPR TTGGTAGTTGCCCAGGTTGA AGG Intronic
902097649 1:13959747-13959769 TTGGTAATTTCCCAGGGTGGAGG - Intergenic
902590816 1:17473163-17473185 TTGCTGGTTGCCCATTTTGATGG - Intergenic
902701466 1:18175319-18175341 TTGGTAGAAGCTAAGGTTGAAGG + Intronic
902930820 1:19730286-19730308 GTTGTAGATGCCCAGGTCGAGGG - Intronic
903021110 1:20395868-20395890 TTAGTGGTTGCCAAGGTTTAGGG + Intergenic
903934540 1:26886111-26886133 TGTGTAGTAGTCCAGGTTGAAGG + Exonic
906357328 1:45117945-45117967 TTGGTAGTTGTTCATGTGGAAGG + Intronic
906725370 1:48040394-48040416 TTGGAAGTGGCCCAGAATGATGG + Intergenic
908819134 1:68065320-68065342 TTAGTAGTTGCCAAGGGTTAAGG + Intergenic
910067036 1:83166517-83166539 TTGGTAGTTGCCAGGGTTAGGGG - Intergenic
910306399 1:85769327-85769349 TTGGTAGAGGCACAGGTAGAAGG + Intronic
910848111 1:91623397-91623419 TTGGGATCTGCCCAGGTAGAGGG - Intergenic
911416201 1:97577876-97577898 TTGCCAGTTGCCCAGGCTGGAGG + Intronic
917046589 1:170867282-170867304 CTGTTAGTTTCCCAAGTTGAAGG + Intergenic
917080657 1:171253843-171253865 ATGGTGGTGGCCCAGGTAGAAGG + Intronic
918766947 1:188499121-188499143 GTGGTAGCTGCCAAGGTTTATGG - Intergenic
921267569 1:213436105-213436127 TTGGGAGTTTCTCAGGTAGAAGG + Intergenic
923884001 1:238135237-238135259 ATGTTATTTGCCCAGGGTGATGG - Intergenic
924719248 1:246607185-246607207 TTGGTAAGTGTCCAGGTCGACGG + Intronic
924722441 1:246636310-246636332 TTGGTAAGTGTCCAGGTCGACGG + Intronic
1063149844 10:3326384-3326406 TTTGTAGTTGCCCAGGGACAGGG - Intergenic
1069630280 10:69893452-69893474 TTGGGAGTTTCCCAGTTTGGAGG + Intronic
1069869281 10:71523392-71523414 TTGGTAGTCCCCGAGTTTGAGGG - Intronic
1069958641 10:72066993-72067015 CTCGTACTTGTCCAGGTTGATGG + Exonic
1074054224 10:109907586-109907608 TTGGTTGTGGCCCTGGTTGTGGG + Intronic
1074681824 10:115914640-115914662 TTGGTACTTCCCCATGCTGAAGG + Intronic
1075054960 10:119210835-119210857 TTTGTAGTTGTCCATGTTGGTGG + Intronic
1075419208 10:122288441-122288463 TTTATAGTTGCACAGGATGATGG + Intronic
1075726412 10:124613041-124613063 TGGGGAGGTGTCCAGGTTGAGGG + Intronic
1077502548 11:2915977-2915999 TTGGTAGTGGCCCAGGAAGGTGG + Intronic
1079155884 11:17947650-17947672 ATGGTGGTTTTCCAGGTTGAAGG - Intronic
1080332664 11:31157661-31157683 ATGGTGGTTGCCAGGGTTGAGGG + Intronic
1083882558 11:65555713-65555735 CTGGTAGTAGCACAGGTTGAAGG - Intronic
1086839923 11:91672445-91672467 TTGTTTGTTGCCCAGGCTGGTGG - Intergenic
1087219844 11:95535051-95535073 TTAGTAGTTGTCAAGGTTTAAGG + Intergenic
1088352263 11:108903227-108903249 TTAGTAGTTGCCAAGGATGAGGG - Intronic
1095278930 12:40326591-40326613 TTGATAGTTGTCCAGATTGAGGG + Intronic
1100338940 12:93659763-93659785 ATGGTAGTTGCCAAAGTTGTAGG + Intergenic
1100529114 12:95448043-95448065 TTGGTAATAGACCAGGCTGAAGG - Intergenic
1101202762 12:102454312-102454334 TTGGTAGTAGCCATGGTTAATGG - Intronic
1102424107 12:112827220-112827242 TTAGTGGTTGCCCAGGCTGGGGG - Intronic
1103113863 12:118308310-118308332 TTGCTGGTTGCCCAGTTTTATGG - Intronic
1103507531 12:121452127-121452149 ATGGTGGTTGCCCGGGCTGAGGG + Intronic
1105328946 13:19396515-19396537 TAGGCAGGTGCACAGGTTGAAGG - Intergenic
1107131486 13:36900944-36900966 TTGGTGGTTGCCAGGGTCGATGG - Intronic
1108442261 13:50466836-50466858 TTGGCAGTAGCCAAGGATGAGGG + Intronic
1108990227 13:56646516-56646538 TCGTTTGTTGCCCAGGTTGGAGG - Intergenic
1110950111 13:81475565-81475587 TTAGCAGTTGCCTAGGATGAGGG + Intergenic
1116246527 14:42421360-42421382 ATGGTACTTGCCCACATTGAGGG - Intergenic
1118726949 14:68635285-68635307 AGTGGAGTTGCCCAGGTTGAAGG - Intronic
1119625991 14:76176190-76176212 TTGGTAATGTCCCAGGATGAAGG + Intronic
1120961349 14:90127953-90127975 TTGGTAGTTGCCCAGGTTGAAGG + Intronic
1125433656 15:39624038-39624060 TTGGTCACTGGCCAGGTTGATGG + Intronic
1125460890 15:39905781-39905803 TTAGTGGTTGCCAAGGGTGAAGG + Intronic
1129386428 15:75198636-75198658 AGGGTAGTTGCCCAGGTTCTTGG + Intronic
1131496533 15:92916219-92916241 ATGGTATGTGCCCAGGGTGATGG - Intronic
1134563370 16:15230038-15230060 TGGTTAGTTGCCCTGGTTGGAGG - Intergenic
1134743674 16:16570834-16570856 TGGTTAGTTGCCCTGGTTGGAGG + Intergenic
1134923895 16:18141664-18141686 TGGTTAGTTGCCCTGGTTGGAGG - Intergenic
1137993951 16:53188016-53188038 TTGGTGGTTGCCTAGGGTTAGGG - Intronic
1141163256 16:81643351-81643373 TTGGTAGTTGCCCAGGGGCTGGG + Intronic
1145237783 17:21221243-21221265 GTGGAAGTTGCCCAGGGAGATGG + Intergenic
1147388612 17:40096002-40096024 CTGGTTGTTGGCCAGGTTCATGG + Exonic
1148655552 17:49280638-49280660 TTGCTGGTTGCCCAGGCTGCTGG - Intergenic
1148663143 17:49352945-49352967 TCGATAGTTGCCCAGGGTGAGGG + Intronic
1148673550 17:49431613-49431635 TTGGTGGTTGCCTAGGGTAAGGG + Intronic
1151073590 17:71246042-71246064 TTGGTATTTTCCCATTTTGAAGG - Intergenic
1151990056 17:77568867-77568889 TTGGGGGTTGCCAAGGTTGTGGG + Intergenic
1152552777 17:81038146-81038168 TGGGTAGTGGCCCAGATGGAGGG + Intronic
1157870046 18:51221649-51221671 TTGGAAGGAGCCCAGGTAGAAGG - Intergenic
1159386633 18:67734485-67734507 TTAGTAGTTGCCAGGGTTTAGGG - Intergenic
1159687666 18:71443605-71443627 TTGAGAGTTTCCCAGTTTGAGGG + Intergenic
1161433194 19:4246300-4246322 CTGGTGGTTGCCCATGTTTATGG - Intergenic
1165573426 19:36794323-36794345 TTGGTGGTGGCCCAGGGTTAGGG - Intergenic
1165898429 19:39156723-39156745 TCGGTGGGTGCCCATGTTGAGGG + Intronic
1166910297 19:46149544-46149566 CTGGTGGTTGCCAAGGGTGAGGG - Intronic
1166923452 19:46249038-46249060 CTGGTAGTTGCCAAGGGTGAGGG + Intergenic
926037110 2:9644433-9644455 ATGGTAGTTCCCCAACTTGAAGG + Intergenic
926284207 2:11474551-11474573 TTGTCATTTGCCCAGGTTGCTGG - Intergenic
926948713 2:18217627-18217649 TTGGTATTTGCAGAGGTAGAGGG + Intronic
927131794 2:20066372-20066394 TTGGCAGCTGCCCAGGTCCAGGG - Intergenic
929471607 2:42199321-42199343 TTGGAATTTGCCCAGGCTAATGG + Intronic
936152074 2:110027507-110027529 GGTGTAGTTGTCCAGGTTGAAGG + Intergenic
936192604 2:110343906-110343928 GGTGTAGTTGTCCAGGTTGAAGG - Intergenic
937903991 2:127043001-127043023 AGGGTAGGTGCCCCGGTTGAGGG - Intergenic
943219827 2:185090512-185090534 GTGGAAGTTGCCAAGGCTGAGGG - Intergenic
943832881 2:192485214-192485236 TTGGAAGCTGCCAAGGTTTAGGG - Intergenic
943884210 2:193192748-193192770 TTGGTGGTTGCCTAGGTCAAGGG - Intergenic
943975230 2:194467981-194468003 TAGGAAGTTGCCCAAGTCGAAGG - Intergenic
944448340 2:199815195-199815217 TTTGTAGTTGGCCAGCTTGTGGG - Intronic
945880617 2:215321153-215321175 TTGGTGGTTGCCGAGGCTGGAGG - Intronic
947695990 2:232189558-232189580 TTCGTAGTTGCCAAGATTGAGGG + Intronic
1170710119 20:18783067-18783089 TTGTTAGTTGGACAAGTTGATGG + Intergenic
1172684923 20:36746194-36746216 TCGGTAGTTCCCGAGGTGGACGG - Intergenic
1175769044 20:61611391-61611413 TTGGTCTTTGCCCAGGTTCCCGG - Intronic
1176381918 21:6117948-6117970 ATCGTAGTCGCCCAGGTTGGAGG - Exonic
1177402001 21:20617129-20617151 TTGGTAGTAGACCTGGCTGAAGG + Intergenic
1177743795 21:25186090-25186112 TTGCTTGTTGCCCAGGCTGGAGG - Intergenic
1179741554 21:43420291-43420313 ATCGTAGTCGCCCAGGTTGGAGG + Exonic
1181736631 22:24886676-24886698 CTGGTAGTGGCCCAGGAGGAAGG - Exonic
1181786445 22:25230737-25230759 GTGTTAGGTGCCCAGGGTGAAGG + Intronic
1181818614 22:25458563-25458585 GTGTTAGGTGCCCAGGGTGAAGG + Intergenic
1183321949 22:37170258-37170280 TTGGTGTTTGCCAAGGTTGGGGG + Intronic
1183381781 22:37493888-37493910 ATGGTGATTGCCAAGGTTGAGGG - Intronic
1184938008 22:47739313-47739335 TTGGCAGATGCCCAGGCTGATGG - Intergenic
1185109922 22:48895120-48895142 ATGGCAGCTGCCCAGGTGGAAGG - Intergenic
951590124 3:24255604-24255626 GTAGGAGTTGCCCAGGTGGAAGG + Intronic
952116550 3:30188688-30188710 TTGACACTTGCCCAGGTTGAAGG - Intergenic
956833641 3:73077569-73077591 TAGGTCTTTCCCCAGGTTGAGGG + Intergenic
959188968 3:103085216-103085238 TTGGGAGTTGCCTGAGTTGAAGG - Intergenic
962594396 3:136925534-136925556 TTAGTAGTTGCCAGGGTTAACGG - Intronic
963372770 3:144422570-144422592 TTGAAAGTTGCCCAGGCTGGAGG - Intergenic
965739569 3:171859697-171859719 ATGGTTGTTGCCAAGGCTGAGGG + Intronic
967222442 3:187258753-187258775 TTGGTATTTGCCTTGTTTGAAGG - Intronic
970333902 4:15011836-15011858 TTGATAATTCCCCAGGTGGAAGG - Intronic
970953434 4:21782984-21783006 TTAGTAGCTGCCAAGGATGAGGG + Intronic
973656996 4:53058018-53058040 ATGGAAGTTGCCGAGGATGAAGG - Intronic
982396001 4:154916334-154916356 TTGGAAGTTGCCAGGGATGAAGG + Intergenic
984761832 4:183369007-183369029 TTGGTGGTTGCACGGGTTAATGG - Intergenic
989165630 5:38431188-38431210 GTGCCAGTTGCCCAGGGTGAGGG - Exonic
990143910 5:52736847-52736869 CTAGTAGTTGCACAGGTTGCTGG - Intergenic
998913024 5:146981756-146981778 TTAGTAGTTGCCAAGGCTTAAGG - Intronic
999713116 5:154335998-154336020 TTGGTGGTTGCCAGGGTTTAGGG - Intronic
1006301406 6:33195241-33195263 TTGGGAGATTTCCAGGTTGAGGG + Intronic
1006604339 6:35245279-35245301 TGGGTAGTTGCCCGGGTAGTTGG - Exonic
1010722493 6:79299656-79299678 TTGGTATTTGCCAGTGTTGATGG - Intergenic
1011915725 6:92504116-92504138 TTTGTAGTTGCACAGGAAGAGGG + Intergenic
1012197835 6:96366628-96366650 ATGGTGGTTGCCAAGGTTGGGGG + Intergenic
1012474831 6:99607123-99607145 CAGGTACTTGCCCAGCTTGAAGG - Exonic
1013801400 6:113949811-113949833 TTGCTCGTTGCCCAGGCTGGAGG + Intronic
1013904437 6:115198585-115198607 GTGGAAGTTGCCCAGGCTTAGGG + Intergenic
1014350723 6:120341598-120341620 TTAGTGGTTGCCAAGGCTGAGGG + Intergenic
1015809962 6:137152523-137152545 TTAGTAGTTGCCGGGGCTGAGGG + Intronic
1020805764 7:12788810-12788832 TTAGTAGTTGCCAGGGTTTAAGG + Intergenic
1022804162 7:33805157-33805179 TTGGGAGGTGCCTAGGCTGATGG - Intergenic
1023732257 7:43203482-43203504 TTGCTTGTTGCCCAGGCTGGAGG + Intronic
1023812617 7:43923900-43923922 CTCGCTGTTGCCCAGGTTGAAGG + Intronic
1026233020 7:68501780-68501802 ATGGTATCTGTCCAGGTTGAAGG + Intergenic
1027277076 7:76568236-76568258 TTGGTAGTTGCCAGGGTTAGGGG + Intergenic
1032692100 7:134297691-134297713 TTGGCAGATGTCCAGGTTGATGG + Intronic
1033360227 7:140633886-140633908 TTGGTAGTAGCCGAGGTTGGAGG - Intronic
1035853514 8:2946405-2946427 TTAGTGGTTGCCTGGGTTGAAGG - Intronic
1037002115 8:13732435-13732457 TTAGTGGTTGCCCAGGATGGAGG - Intergenic
1039860844 8:41456015-41456037 TTGGTGGTTGCCTAGGATGAGGG - Intergenic
1039968941 8:42305475-42305497 TTGTTAGTTGCTCAAGTTGCAGG + Intronic
1044467633 8:92525845-92525867 TGGGTTGGTGCCCAGGTTGGTGG - Intergenic
1045588627 8:103567007-103567029 TTAGTGGTTGCCTAGGATGAGGG - Intronic
1045825630 8:106394726-106394748 TTGGTGGTTGCCAAGGTTTGAGG + Intronic
1046267224 8:111846602-111846624 TTGGAAGTTGCCAAGGCTTATGG + Intergenic
1048472524 8:134716095-134716117 TTTGTTGCTGCCCAGGTTGGAGG - Intergenic
1051317932 9:15863305-15863327 TTTCTTGTTGCCCAGGTTGCAGG + Intronic
1052088226 9:24293802-24293824 TTTGTTCTTGCTCAGGTTGACGG + Intergenic
1055392130 9:75834395-75834417 TTGGTGGTTGCCAAGGTACAGGG + Intergenic
1057536213 9:95909467-95909489 TCAGTAGTTGCCCAAGGTGAGGG - Intronic
1057598937 9:96440387-96440409 GGAGTTGTTGCCCAGGTTGAGGG + Intergenic
1060195485 9:121620837-121620859 TTGGGAGTAGCCCAGGTTCAGGG - Intronic
1061234038 9:129332141-129332163 GTGGTGGTGTCCCAGGTTGAAGG + Intergenic
1062268238 9:135697106-135697128 ATGGCAGCTCCCCAGGTTGAAGG - Intronic
1186364750 X:8879748-8879770 GTGGTAGGTGCCCTGGATGAAGG - Intergenic
1189727540 X:43983311-43983333 TTGATAGGTACCTAGGTTGATGG - Intergenic
1192091057 X:68156554-68156576 TTAGTGGTTGCCCAGGCTGGTGG - Intronic
1193672281 X:84401916-84401938 GTGTTAGTTGCTCAGGGTGATGG - Intronic
1194079658 X:89444177-89444199 ATGGTGTTTGCCCATGTTGAGGG + Intergenic
1194893268 X:99406694-99406716 TTGGAAGCTGCCAAGGCTGACGG - Intergenic
1195117117 X:101710579-101710601 TTGCTGGTTGCCCAGTTTTATGG - Intergenic
1195915065 X:109927872-109927894 TTGGTAGCTCCCCAGGGAGAGGG + Intergenic
1197520860 X:127494660-127494682 TTAGTGGTTGCCAAGCTTGAGGG + Intergenic
1200432280 Y:3099481-3099503 ATGGTGTTTGCCCATGTTGAGGG + Intergenic
1200865952 Y:8043497-8043519 TTGGTACTTCCCTAGGTTTATGG - Intergenic
1200877521 Y:8173762-8173784 TTGGTGTTTGCCCAAGATGATGG + Intergenic
1201406498 Y:13655343-13655365 TTGCTAGTTGCCCATTTTTATGG - Intergenic