ID: 1120963083

View in Genome Browser
Species Human (GRCh38)
Location 14:90142667-90142689
Sequence CAGTGCCAAGGCAATTCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 1, 1: 0, 2: 12, 3: 70, 4: 427}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120963083_1120963088 16 Left 1120963083 14:90142667-90142689 CCAAGTGAATTGCCTTGGCACTG 0: 1
1: 0
2: 12
3: 70
4: 427
Right 1120963088 14:90142706-90142728 TGTTTTCCCTGTATCCTCCTAGG 0: 1
1: 0
2: 1
3: 35
4: 319
1120963083_1120963091 28 Left 1120963083 14:90142667-90142689 CCAAGTGAATTGCCTTGGCACTG 0: 1
1: 0
2: 12
3: 70
4: 427
Right 1120963091 14:90142718-90142740 ATCCTCCTAGGTTCTTAAGTTGG 0: 1
1: 0
2: 1
3: 10
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120963083 Original CRISPR CAGTGCCAAGGCAATTCACT TGG (reversed) Intronic
900726786 1:4221774-4221796 CATTGCCAAAGCAAGTCACGCGG - Intergenic
901531411 1:9855512-9855534 GGGTGCCAAGACAATTCAGTGGG + Intronic
902064947 1:13677230-13677252 CATTGCCAAGAAAATTCAATGGG - Intergenic
904338582 1:29814605-29814627 AGGTGCAAAGACAATTCACTGGG - Intergenic
906138543 1:43518758-43518780 AAGTGCCAAGGAAATTCAATGGG - Intergenic
906614104 1:47223394-47223416 CAGTGCCAAGGCCCTTCTCGGGG + Intronic
908172527 1:61520742-61520764 GAGAGTCAAGACAATTCACTGGG - Intergenic
908291781 1:62674684-62674706 TGGTGCCAAGGCAATTCAATTGG + Intronic
908430985 1:64057269-64057291 GAGTGCCAAGACAATTCAATGGG - Intronic
908636019 1:66166113-66166135 AGATGCCAAGGCAATTCAATGGG + Intronic
910782784 1:90958693-90958715 AAGTGCCAAGACCATTCAATGGG + Intronic
911140965 1:94502133-94502155 AAGTGCCAAGGCAAATAACTGGG - Intronic
911406851 1:97451979-97452001 CAGTACCAGGGCACTTGACTTGG - Intronic
911699691 1:100938001-100938023 AGATGCCAAGGCAATTCAATGGG - Intronic
911911730 1:103645984-103646006 CACAGCCAAAGCAAATCACTTGG - Intergenic
911916724 1:103705964-103705986 CACAGCCAAAGCAAATCACTTGG + Intronic
911919145 1:103740122-103740144 CACAGCCAAAGCAAATCACTTGG - Intronic
912064120 1:105713998-105714020 GAGTGCCAAGACAATTCAATGGG - Intergenic
912277530 1:108274868-108274890 CAGTGCAAAGACCATTCAATAGG - Intergenic
912290698 1:108419490-108419512 CAGTGCAAAGACCATTCAATAGG + Intronic
913038008 1:114992520-114992542 GAGTGCCAAGACCATTCAATGGG + Intronic
913184046 1:116351418-116351440 CAATGCCAAGACCATTCAATGGG + Intergenic
913572677 1:120136696-120136718 AAGAGCCAAGACAATTCAATGGG + Intergenic
914293521 1:146297610-146297632 AAGAGCCAAGACAATTCAATGGG + Intergenic
914554565 1:148748393-148748415 AAGAGCCAAGACAATTCAATGGG + Intergenic
915382689 1:155456932-155456954 CAGTGCCAAAGCAAGTCATGTGG - Intronic
916300869 1:163272674-163272696 CAGTGCCAAGACAATTCAAAGGG - Intronic
916710956 1:167407624-167407646 AGGTGCCAAGGCAATTCAATAGG + Intronic
917001787 1:170368478-170368500 AAGTGCCAAGGTATTTCAATGGG + Intergenic
918155259 1:181839045-181839067 TAGTGCCAAGACCATTCAATGGG + Intergenic
918587093 1:186200734-186200756 AAGTGCCAAGGCAATTCAATGGG - Intergenic
919867983 1:201797246-201797268 GAGTGCCAAGACAATTCAGTGGG - Intronic
919936849 1:202257584-202257606 CAGTGCTAAGACAATTCAATAGG - Intronic
920077344 1:203347091-203347113 CAGTGCTAAGACAATTCAGTGGG - Intronic
920897328 1:210067069-210067091 GGGTGCCAAGGCCATTCAATGGG - Intronic
921970667 1:221145932-221145954 AAGTGCCAAGGCAATTCAATGGG - Intergenic
921979109 1:221235811-221235833 CACTGCCAAAGCAAGTCACATGG - Intergenic
922112316 1:222572678-222572700 GGGTGCCAAGACAATTCAGTGGG + Intronic
924220307 1:241867687-241867709 CTGTGCCAAGGCAATTAAATGGG - Intronic
924505127 1:244675544-244675566 AGGTGCCAAGACAATTCAGTGGG - Intronic
1062866750 10:862411-862433 CAGTGACCAGGGAATGCACTGGG - Intronic
1063594896 10:7425506-7425528 CAGTCCTAATGGAATTCACTGGG - Intergenic
1065120639 10:22526790-22526812 GGGTGCCAAGACAATTCAGTAGG - Intergenic
1065245991 10:23758323-23758345 GAGTGCCAAGACTATTCACTGGG - Intronic
1065476896 10:26148272-26148294 GAGTGTCAAAGCAATTCAATGGG - Intronic
1065835464 10:29653804-29653826 CAATGCCAAAACAATTCAATGGG - Intronic
1066135694 10:32443580-32443602 CAGTGCCAGTGCACTTCAATGGG - Intergenic
1067320374 10:45214309-45214331 AAGTGCAAAGGCAATTCAGTGGG + Intergenic
1067466848 10:46506653-46506675 GAGTGCCAAGACCATTCAATGGG + Intergenic
1067620339 10:47877952-47877974 GAGTGCCAAGACCATTCAATGGG - Intergenic
1067852994 10:49767539-49767561 AAGTGCAAAAGCAATTCAATGGG - Intergenic
1068139012 10:52980942-52980964 AAGTGCCAAGGTAATTAAATGGG - Intergenic
1068295567 10:55068366-55068388 AATTGCCAAGAAAATTCACTGGG - Intronic
1068503652 10:57871144-57871166 AAGTGACAAGGCAATTAATTGGG - Intergenic
1068922572 10:62499996-62500018 CAGTCCCAAATCAGTTCACTGGG - Intronic
1069011293 10:63376162-63376184 CAGTGTCAAGACCATTCACTGGG + Intronic
1069203270 10:65650343-65650365 AGGTGCCAAGGCAATGCAATGGG + Intergenic
1069205425 10:65676828-65676850 AAGTGCAAAGACAATTCAATAGG - Intergenic
1069284878 10:66701130-66701152 AAGTTCAAAGGCAATTCAGTGGG - Intronic
1070535662 10:77375440-77375462 GAGTGACAAGGGAATTCACGCGG + Intronic
1071020676 10:81051241-81051263 TAGTGCCAAGGCAATTTAGTAGG + Intergenic
1071699011 10:87909120-87909142 GAGTGCCAAGACTATTCAATGGG - Intronic
1071995595 10:91145735-91145757 GAGTGCCAAGACAATTCAATGGG + Intergenic
1072388013 10:94952005-94952027 GGTTGCCAAGGCAATTCAATAGG - Intronic
1072823077 10:98577702-98577724 CAGTGCCACTGAAATTCATTTGG + Intronic
1074744435 10:116517580-116517602 CAGTGCCATGGTAATACAGTCGG - Intergenic
1075272684 10:121066595-121066617 AAGTGCCAAGACCATTCAATGGG - Intergenic
1076628542 10:131838331-131838353 AAGTGCAAAGACAATTCAATGGG + Intergenic
1076760324 10:132601751-132601773 TGGTGCCAAGACCATTCACTGGG - Intronic
1076812621 10:132896988-132897010 CAGTGCCAAGACCATTCACTAGG + Intronic
1077372205 11:2188271-2188293 AGGTGCCAAGGCCATTCAGTGGG + Intergenic
1077449273 11:2626382-2626404 GAGTGCCAAGACCATTCAATAGG - Intronic
1077675477 11:4190567-4190589 CAGAGCCCAGGGAATACACTGGG - Intergenic
1078345374 11:10543683-10543705 ATATGCCAAGGCAATTCAGTGGG + Intergenic
1078410449 11:11111632-11111654 GATTGCCAAAGCAATTCACAGGG + Intergenic
1079118558 11:17657843-17657865 GTGTGCTAAGACAATTCACTGGG + Intergenic
1080089547 11:28329216-28329238 GAGTGCCAAGACCATTCAATTGG - Intronic
1080506709 11:32921975-32921997 AGGTGCCAAGACAATTCAATAGG + Intronic
1080534733 11:33210515-33210537 CAGTGCCAAGACCACTCAATGGG + Intergenic
1080570845 11:33555536-33555558 AGGTGCCAAGGCTATTCAATGGG + Intronic
1082644834 11:55709790-55709812 CAGTGCCAAGATTATTCAATAGG - Intergenic
1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG + Intronic
1084476454 11:69392190-69392212 CAGTTTCCAGGCAATCCACTGGG - Intergenic
1084837337 11:71812621-71812643 CTGTTCAATGGCAATTCACTGGG - Intergenic
1085425621 11:76402149-76402171 CAGTGCCTAGGCAACACACAGGG - Intronic
1086735747 11:90302967-90302989 CAGTCCCAATGCAATGAACTGGG + Intergenic
1087906012 11:103698511-103698533 TAGTGCCAAGACAATTCAATGGG - Intergenic
1088043043 11:105412257-105412279 AAGAGCCAAGGCATTTCAGTAGG - Intergenic
1088863620 11:113825246-113825268 CAGTGCCAAGATAATTCAATGGG + Intronic
1089758441 11:120704960-120704982 GAGTGCTAAGACTATTCACTAGG - Intronic
1089854130 11:121526219-121526241 AGGTACCAAGGCAATTCAATGGG - Intronic
1089871485 11:121676736-121676758 AACTGCCAAGGTAATTCAATGGG - Intergenic
1091081731 11:132676166-132676188 TAGTGCCAAGGCCATTGAATAGG + Intronic
1091190504 11:133691197-133691219 AGATGCCAAGACAATTCACTGGG + Intergenic
1091198857 11:133755164-133755186 AGGTGCCAAGGCAATTCACTGGG + Intergenic
1091210892 11:133859020-133859042 AGGTGCCAAGGCAATTCAGTGGG - Intergenic
1091313266 11:134590776-134590798 AAGTGCCAGGGCAATTCAATGGG - Intergenic
1092037856 12:5355496-5355518 AAGTGCCAAGACAATTCAATGGG + Intergenic
1092401362 12:8181458-8181480 CTGTTCAATGGCAATTCACTGGG + Intronic
1092632656 12:10399525-10399547 GAGTGCCAAGACCATTCAATGGG + Intronic
1093136357 12:15456465-15456487 CAGAGCCAAGGTATTTTACTTGG + Intronic
1093489503 12:19688770-19688792 CAGTGCCAAGGCTGTTCAGTGGG - Intronic
1093975627 12:25418520-25418542 AGGTGCCAAGTCAATTCAATAGG - Intronic
1094457057 12:30647180-30647202 GAATGCCAAGACAATTCAATGGG + Intronic
1094683510 12:32687400-32687422 CAATGCCAAGACTATTCAATGGG - Intronic
1095989194 12:48022740-48022762 CACTGACCAGGCAATCCACTGGG - Intronic
1096762892 12:53857943-53857965 AAGTGCCAAGACAATTCAGTGGG + Intergenic
1097135661 12:56852589-56852611 GAGTGCCAAGACAATTCAATAGG - Intergenic
1098566005 12:71936713-71936735 ACGTGCCAAGACAATTCAATGGG - Intergenic
1098979310 12:76937796-76937818 GGGTGTCAAGGCAATTCAATGGG + Intergenic
1103423111 12:120806377-120806399 CGGTGCCAAGGTAATTCAACTGG + Intronic
1103508751 12:121459252-121459274 GGATGCCAAGGCAATTCAGTTGG + Intronic
1104403776 12:128500082-128500104 GAGTGTCAAGACAATTCAGTGGG + Intronic
1105268623 13:18847861-18847883 CTGTGCCAAGGAAATGCATTTGG + Intergenic
1105494102 13:20915166-20915188 TAGTGCCAAGACCATTCAATGGG + Intergenic
1107257674 13:38448144-38448166 GAGTGCCAAAACAATTCAGTGGG - Intergenic
1109866011 13:68263961-68263983 AAGTTCCATGGCAATTCAATAGG + Intergenic
1110732463 13:78895069-78895091 AGGTGCCAAGGCAATTCAATGGG - Intergenic
1111207127 13:85025863-85025885 GGGTGCCAAGCCAACTCACTGGG - Intergenic
1112187022 13:97137290-97137312 CAGAGCCAAGCCATATCACTTGG + Intergenic
1112403517 13:99097209-99097231 CAGTGCTAAGACCATTCAGTGGG + Intergenic
1113265650 13:108614698-108614720 CAGTGCCAAGACTATTCTATGGG + Intronic
1113631401 13:111887688-111887710 AGGTGCCAAGACAATTCAATGGG - Intergenic
1114172608 14:20288701-20288723 CCGTGCCAGGCCAATTCAATTGG + Exonic
1114175913 14:20319532-20319554 CAGTGCAAAGGGAATTGGCTAGG - Intronic
1114601376 14:23958096-23958118 CAGAGCCAAGGCAGGTGACTTGG + Intronic
1114611062 14:24040878-24040900 CAGAGCCAAGGCAGGTGACTTGG + Intergenic
1115653420 14:35420196-35420218 CATTGCCAGGGCAATTCACTTGG - Intergenic
1116582904 14:46664347-46664369 AAGTGTCAAGGCAATTCAAAAGG + Intergenic
1117120303 14:52560636-52560658 AAGTGCCAAGGTAATTTAGTGGG + Intronic
1118218948 14:63837171-63837193 GAGTGCCAAGAAAATTCAATGGG + Intergenic
1118298514 14:64592734-64592756 GGGTGCCAAGACAATTCAATGGG + Intergenic
1119082480 14:71708696-71708718 AGGTACCAAGGCAATTCAATGGG - Intronic
1119523832 14:75306506-75306528 AAGTGCCAAGACCATTCAATGGG - Intergenic
1120688888 14:87570434-87570456 CAGGGCTAAGGCAAATCACACGG - Intergenic
1120806518 14:88757199-88757221 TGGTGCCAAGACAATTCAATGGG + Intronic
1120832548 14:89010513-89010535 GGGTGCCATGACAATTCACTAGG + Intergenic
1120963083 14:90142667-90142689 CAGTGCCAAGGCAATTCACTTGG - Intronic
1121976406 14:98408243-98408265 CACTTCCTGGGCAATTCACTCGG + Intergenic
1202830680 14_GL000009v2_random:26096-26118 CTGTGCCAAGGAAATGCATTTGG - Intergenic
1123430482 15:20211418-20211440 CAGAGACCAGGCCATTCACTTGG + Intergenic
1123475651 15:20591321-20591343 CAATGCCAAGGGAATCCACCCGG - Intergenic
1123642360 15:22409042-22409064 CAATGCCAAGGGAATCCACCCGG + Intergenic
1123957150 15:25349145-25349167 AGGTGCAAAGGCAATTCAATGGG + Intronic
1125065644 15:35482591-35482613 AGGTTCCAAGGCAATTCAATGGG + Intronic
1125215374 15:37266974-37266996 GGGTGCCAAGACAATTCAATGGG + Intergenic
1125275638 15:37987630-37987652 GTGTGCCAAGACAATTCACTGGG - Intergenic
1125346972 15:38728212-38728234 CAGTGCGAAGGCCATCCACGTGG - Intergenic
1125830445 15:42712582-42712604 GGGTGCCAAGACAATTCAATGGG - Intronic
1125890642 15:43263536-43263558 AGGTGCCAAGACAATTCAATGGG + Intronic
1126205041 15:46035809-46035831 CAGAACCCAGGCAATCCACTTGG - Intergenic
1126880568 15:53091336-53091358 AGGTGTCAATGCAATTCACTGGG + Intergenic
1127209241 15:56755622-56755644 GTGTGCCAAGACAATTCAATGGG + Intronic
1127283747 15:57514866-57514888 GGGTGCCAAGACAATTCAATGGG - Intronic
1128190190 15:65685794-65685816 AGATGCCAAGGCAATTCAATGGG - Intronic
1128329749 15:66747740-66747762 CAGGGCCAATGCAAATGACTTGG + Intronic
1128381033 15:67112906-67112928 GGGTGCCAAGACAATTCACTGGG - Intronic
1128859693 15:71056980-71057002 AATTGCCAAAGCAATTCAATGGG - Intergenic
1128899322 15:71405456-71405478 AGGTGCCAAGACAATTCATTAGG - Intronic
1129800699 15:78411907-78411929 CAGGGACAAGGCAACTCTCTGGG - Intergenic
1130121952 15:81057891-81057913 AAGTGCCAAAACAATTCAATGGG - Intronic
1130977211 15:88786008-88786030 TGATGCCAAGGCAATTCAATGGG + Intergenic
1131904297 15:97125635-97125657 CCATGTCAAGGCAATTCAATGGG + Intergenic
1131924809 15:97370930-97370952 CAGTGCCAAGACAAATCATCAGG + Intergenic
1132483501 16:178023-178045 CAGGCCCCAGGCAATTCAATAGG + Intergenic
1134502246 16:14778317-14778339 CAGTGCAATGGCTATTCACAGGG - Intronic
1134578316 16:15350580-15350602 CAGTGCAATGGCTATTCACAGGG + Intergenic
1134724275 16:16406969-16406991 CAGTGCAATGGCTATTCACAGGG - Intergenic
1134943156 16:18304891-18304913 CAGTGCAATGGCTATTCACAGGG + Intergenic
1135894777 16:26389319-26389341 AAGTGCCAGTGCAATTCAGTGGG - Intergenic
1136062551 16:27736692-27736714 CAGTGCCATAGGAAGTCACTGGG + Intronic
1136359311 16:29767864-29767886 CAGTTGCAAAGCAATTCAGTAGG + Intergenic
1136854150 16:33639792-33639814 CAGAGACCAGGCCATTCACTTGG - Intergenic
1137939498 16:52669718-52669740 CAGTTCCCAGGCTATTCACAAGG + Intergenic
1137941948 16:52696543-52696565 CATTGACAAGGAAACTCACTTGG + Intergenic
1138005803 16:53336352-53336374 GAGTGCCAAGACAATTCAATGGG + Intergenic
1138486340 16:57346845-57346867 GAGTGCCAAGATAATTCAATGGG + Intergenic
1139499565 16:67351144-67351166 CAGTGCCAAGCTAATCCACAAGG - Intronic
1139807675 16:69582623-69582645 GAGTGCCAAGACCATTCAATGGG - Intronic
1140171195 16:72606793-72606815 AAGTGCCAAGATAATTCAATGGG + Intergenic
1141122840 16:81374847-81374869 AGGTGCCAAGGCAATTTAGTGGG + Intronic
1141538919 16:84703209-84703231 CAGTGACAAGGATATTCACTTGG - Intronic
1203115725 16_KI270728v1_random:1488231-1488253 CAGAGACCAGGCCATTCACTTGG - Intergenic
1143488160 17:7266806-7266828 CTGTACAAAGGCAATTCAGTGGG - Intergenic
1144877403 17:18407458-18407480 CAATGACAAAGCAATTGACTGGG + Intergenic
1145154825 17:20536945-20536967 CAATGACAAAGCAATTGACTGGG - Intergenic
1150134372 17:62688002-62688024 CAGTGCCTAGGCCAAGCACTAGG - Intronic
1150921092 17:69483821-69483843 GAGTGCCAAGACAATTCAGGGGG + Intronic
1151503360 17:74507283-74507305 AAGTGCCAAGAACATTCACTGGG - Intergenic
1153503949 18:5776154-5776176 GGGTGCCAAGGCCATTCAATGGG - Intergenic
1153613949 18:6917110-6917132 AACTGCCAAGGCAATTCAGTGGG + Intergenic
1153870551 18:9315667-9315689 AAGTGCCAATGAAATTCAATGGG + Intergenic
1153961411 18:10143197-10143219 CACTGGCAAGGTAATTCACATGG - Intergenic
1154233206 18:12577021-12577043 AAGTGCCAAGGTAGTTCAATGGG + Intronic
1154419403 18:14212140-14212162 CTGTGCCAAGGAAATGCATTTGG - Intergenic
1154972666 18:21426465-21426487 CAGTGCCAAGAAAATTCAAGGGG - Intronic
1155022324 18:21907904-21907926 CAGAGCCAATGCAATCCTCTGGG + Intergenic
1155406923 18:25499022-25499044 ACGTGCCAAGTCAATTCAATGGG + Intergenic
1156979380 18:43266117-43266139 CAGTCCCAATGCAATGAACTGGG + Intergenic
1157686778 18:49649172-49649194 AAGTGCCAAGACAAGTCAATAGG + Intergenic
1158005080 18:52662876-52662898 AAGTGACAATGCAACTCACTGGG + Intronic
1158986489 18:62822882-62822904 AGGTACCAAGGCAATTCAGTAGG + Intronic
1159206859 18:65264660-65264682 CAGTGCCAAAGTGAGTCACTAGG + Intergenic
1159701062 18:71628301-71628323 GAGTGCCAAGAAAATTCAATGGG + Intergenic
1160084514 18:75763238-75763260 CATTGTCAATGCAATTCTCTGGG + Intergenic
1162240552 19:9350080-9350102 GAGTGCCAAGACAATTCAATGGG - Intronic
1165638051 19:37360189-37360211 AGGTGCCAAGGTAATTCAATGGG - Intronic
1165803536 19:38566984-38567006 CAGCCCCAAGGCCACTCACTCGG - Exonic
1165876370 19:39010372-39010394 CGGTGCCAAGACCATTCAGTGGG - Intronic
1202642016 1_KI270706v1_random:101681-101703 CTGTGCCAAGGAAATGCATTTGG + Intergenic
925678396 2:6390802-6390824 AAATGCCAAGGCAATTCATTAGG - Intergenic
925733151 2:6937237-6937259 AAGTGCCATAGCATTTCACTTGG - Intronic
926586157 2:14687783-14687805 CAGTGGCAAAGCAATTCCCAGGG + Intergenic
926903481 2:17783722-17783744 GAGTGCCAAGACAATTCAATGGG + Exonic
927823884 2:26293664-26293686 CAGTGCCAAGACCATTCATGGGG + Intergenic
928008886 2:27588530-27588552 AGATGCCAAGGCAATTCAGTAGG - Intronic
928529689 2:32178349-32178371 GGGTACCAAGGCAATTCAATGGG - Intronic
929378930 2:41326026-41326048 AGGTGCCAAAGCAATTCAATGGG + Intergenic
929786697 2:44998722-44998744 CAGTGCCAGGGCTCTTCCCTGGG + Intergenic
929903028 2:46022329-46022351 CTGTGACAATGCAATTCATTGGG + Intronic
930225117 2:48784317-48784339 GCATGCCAAGACAATTCACTGGG - Intergenic
930478917 2:51922130-51922152 CAGTGCCTAGGTAACTCACAGGG + Intergenic
931896676 2:66739397-66739419 GGGTGCCAAGACAATTCAATGGG - Intergenic
931951632 2:67370015-67370037 ATGTGCCAAGGCAGTTCAATGGG - Intergenic
932170110 2:69547026-69547048 GGGTGCCAAGACAATTCAATGGG + Intronic
933413414 2:81953087-81953109 AGGTGCCAAGACAATTCAATGGG + Intergenic
933643562 2:84790139-84790161 AGGTGCCAAGGCAATTCAATGGG + Intronic
933673377 2:85030599-85030621 GAGTGCCAAGACAATGCATTGGG - Intronic
933763476 2:85691700-85691722 ACGTGCCAAAGCAATTCAATGGG + Intronic
933863417 2:86493489-86493511 GAGTGCCAAGACCATTCAATGGG - Intergenic
934102792 2:88668821-88668843 AAGTGCCAAGGCCATGCAATGGG - Intergenic
934497849 2:94825161-94825183 CTGTGCCAAGGAAATGCATTTGG + Intergenic
934878237 2:97947907-97947929 GGGTGCCAAGGCAATTCAATTGG + Intronic
935195442 2:100812021-100812043 AAGTACCAAGACAATTCAATGGG - Intergenic
935437212 2:103047504-103047526 CAGAGCCAAACCAAATCACTGGG + Intergenic
935791911 2:106600526-106600548 GGGTGCCAAGGCCATTCAATTGG - Intergenic
936240040 2:110779684-110779706 AGTTGCCAAGGCAATTCAATGGG + Intronic
936242896 2:110803395-110803417 CAGAGCCAAGACAATTCAATGGG + Intronic
936936443 2:117842938-117842960 CAGTGCCAAGACCATTCTATGGG - Intergenic
937327351 2:120998722-120998744 AAGTGCCAAGGCAATTCAATAGG + Intergenic
937908741 2:127065167-127065189 CAGTCCCAACCCAAGTCACTGGG - Intronic
937992036 2:127669143-127669165 GAGTGCCAAGACCATTCAATGGG + Intronic
938202033 2:129380091-129380113 CAGTGCCAAGTACATTAACTTGG - Intergenic
938770044 2:134493882-134493904 AGGTGCCAAGGTAATTCAATGGG - Intronic
938877083 2:135543235-135543257 CAGTGCCAAGACAATTCAATGGG - Intronic
939916512 2:148050670-148050692 GAGTGCTAGGGCAATTCAATGGG - Intronic
940186074 2:150986000-150986022 CTGTGCCAAGGCAGTTTCCTTGG - Intergenic
940533659 2:154910006-154910028 ATGTGCCAGGGCAATTCAATGGG - Intergenic
940952821 2:159695645-159695667 GAATGCCAAGGTAATTCAATGGG - Intergenic
942894542 2:181036291-181036313 AAATGCCAAGGTAATTCAGTAGG + Intronic
944457028 2:199905885-199905907 AAGTGCCAAGATAATTCAATGGG - Intergenic
944722540 2:202438727-202438749 GGGTGCCAAGACAATTCAATGGG - Intronic
944900583 2:204210406-204210428 TAATGTCAAGGCAATTCAGTGGG - Intergenic
945113330 2:206386330-206386352 ATTTGCCAAGGCAATTCAGTGGG + Intergenic
945198787 2:207261490-207261512 CAGGCACAAGGCAATTCACACGG + Intergenic
945202973 2:207303096-207303118 CAATGCCGAGACAATTCAATTGG + Intergenic
947055587 2:226097788-226097810 AATTGCCAAGGCAATTAAATGGG + Intergenic
947825507 2:233103606-233103628 CACTTCCAGGGCAAGTCACTTGG + Intronic
947911799 2:233805793-233805815 GGGTGCCAAGACAATTCAGTGGG + Intronic
948579658 2:238976745-238976767 AAGTGCCAAGATAATTCAATGGG + Intergenic
1169237147 20:3939461-3939483 GGGTGCCAAGACAATTCAGTGGG - Intronic
1169949272 20:11025195-11025217 GGGTGCCAAGACAATTCAATAGG - Intergenic
1170273655 20:14557099-14557121 GAGTGCCAAGACAATTCAATGGG + Intronic
1172747104 20:37219818-37219840 ATGTGCCAAGGCAATTCGTTAGG - Intronic
1172961518 20:38803912-38803934 GAGTGCCAAGACAATTTAATGGG - Intergenic
1173238721 20:41273619-41273641 CAGTGCCAAGATGATTCACTGGG - Intronic
1174727856 20:52882249-52882271 AAGTGCCAAGATAATTCAGTGGG - Intergenic
1176609868 21:8870934-8870956 CTGTGCCAAGGAAATGCATTTGG - Intergenic
1176853903 21:13947158-13947180 CTGTGCCAAGGAAATGCATTTGG + Intergenic
1177165371 21:17596547-17596569 AAGTGCCAAAGCAATTCAATGGG - Intronic
1177535213 21:22417768-22417790 CAGTGCCAAGCCTATTCAATGGG - Intergenic
1177795511 21:25774692-25774714 AGGTGCCAAGGTAATTCAATAGG + Intergenic
1177813059 21:25945664-25945686 TAGTGCCAAGACCATTCAATGGG + Intronic
1180111539 21:45657414-45657436 AAGTGCTAAGGCCATTCAATAGG - Intronic
1180191172 21:46163611-46163633 GAGTGCCAAGACAATTCAGGAGG - Intronic
1180359928 22:11880183-11880205 CTGTGCCAAGGAAATGCATTTGG - Intergenic
1180665825 22:17511288-17511310 GAGTGCCAAGGAAATGCACCAGG - Intronic
1181718434 22:24753399-24753421 GTGTGTCAAGGCAATTCAATAGG - Intronic
1182318464 22:29463353-29463375 CAGTTCCAAGGCAAAAGACTTGG + Intergenic
1184128548 22:42503621-42503643 CAGTGCAAAGGCATTCGACTGGG - Intergenic
1184137342 22:42556936-42556958 CAGTGCAAAGGCATTCGACTGGG - Intronic
1184905132 22:47477858-47477880 GGGTGCCAAGACAATTCAGTGGG - Intronic
1184983280 22:48111073-48111095 CCGTGCCAAGACCATTCACTAGG + Intergenic
949345643 3:3074018-3074040 AAATGCCAAGGCAATTCACTGGG + Intronic
951451518 3:22844734-22844756 CAGACCCAAGGCCATCCACTTGG + Intergenic
951679732 3:25282272-25282294 CAGTGCAAAGGCCCCTCACTGGG - Intronic
951793755 3:26515824-26515846 AAGTGCCAAGAACATTCACTGGG - Intergenic
951905372 3:27701334-27701356 TGGTGCAAAAGCAATTCACTGGG - Intergenic
951921539 3:27860002-27860024 CATTGCCAAAGCAAGTCACATGG - Intergenic
952246306 3:31596386-31596408 CAGTGCCAAACCAGTTCAATGGG - Intronic
952318157 3:32250137-32250159 GAGTGCCAAGATAATTCAATGGG - Intronic
953045064 3:39287423-39287445 CAGTGCTGAGTCATTTCACTCGG + Intergenic
953480382 3:43246464-43246486 CAGGACCAATCCAATTCACTTGG + Intergenic
953484363 3:43281154-43281176 AATTGCCAAGGCAATTTAATTGG + Intergenic
954287929 3:49632051-49632073 GAGTGCCAAGACCATTCAGTAGG + Intronic
954893093 3:53949741-53949763 AGATGCCAAGGCAATTCTCTGGG + Intergenic
955282339 3:57605136-57605158 CATTCCCAAGGCAATAAACTGGG - Intergenic
956462810 3:69488460-69488482 AGGTGCCAAGTCAATTCAATAGG + Intronic
957968284 3:87349693-87349715 CAGAGCCATTGCAATTCAATAGG - Intergenic
959518168 3:107293962-107293984 AGGTGCAAAGGCAATTCAATGGG - Intergenic
959535410 3:107479392-107479414 AGGTGTCAAGGCAATTCACTGGG + Intergenic
959851427 3:111092561-111092583 GAGTACCAAGTCAATTCAATGGG - Intronic
962347636 3:134630261-134630283 CAGCCCCCAGGCAATTCTCTTGG + Intronic
962347911 3:134634468-134634490 AAGTGCAAAGACAATTCAGTTGG + Intronic
963274278 3:143314751-143314773 CAGTGCCAGGGCATTTGCCTGGG - Intronic
963480837 3:145872291-145872313 TAGTGCCAAGGCTGTTCATTGGG + Intergenic
963731954 3:148983254-148983276 TCGTGCCAAGACAATTCAGTGGG + Intergenic
964278632 3:155036990-155037012 AGGTGCCAAGGCAATTCAATGGG - Intronic
964603069 3:158524770-158524792 AACTACCAAGGCAATTCAATTGG + Intronic
964653891 3:159044612-159044634 CTATGCCAATGCAATACACTAGG + Intronic
964725617 3:159811549-159811571 AGGTGCCAAGGTAATTCAATGGG - Intronic
965256314 3:166417550-166417572 AACTGCTAAGGTAATTCACTGGG + Intergenic
965611820 3:170552216-170552238 TAGTGTCAAGACAATTCAATAGG + Intronic
966033671 3:175382560-175382582 CAGTCTCATTGCAATTCACTTGG - Intronic
966364727 3:179173225-179173247 AGGTGCCAAGGTAATTCAATGGG + Intronic
967618022 3:191597093-191597115 AAATGCCAAGGCAATTCAATAGG - Intergenic
967877865 3:194279103-194279125 CATTGCCAAGGCAACACACAGGG + Intergenic
967906265 3:194503046-194503068 GGGTGCCAAGACAATTCAATGGG + Intergenic
968095460 3:195927079-195927101 ATGTGCCATGGCAATTCAATGGG - Intergenic
1202736549 3_GL000221v1_random:5719-5741 CTGTGCCAAGGAAATGCATTTGG - Intergenic
968543805 4:1185033-1185055 AAGTGCCAAGACCATTCAATGGG + Intronic
968791251 4:2664340-2664362 AATGGCCAAGGCAATTCAATAGG - Intronic
969434193 4:7175425-7175447 AAGTGCCAAAACAATTCAATGGG - Intergenic
969699149 4:8756698-8756720 CGGTGCAAAGGCAATTCAATAGG + Intergenic
969778745 4:9380112-9380134 CTGTTCAATGGCAATTCACTGGG - Intergenic
970411386 4:15811539-15811561 GAGTGCCAAGGCCATTCAATGGG - Intronic
970904134 4:21195285-21195307 GACTGCCAATGCAATTCAATTGG + Intronic
971023157 4:22559069-22559091 GGGTGCCAAGACAATTCAATGGG - Intergenic
971229164 4:24784879-24784901 CAGTGCCAAGGTAATTTAATGGG - Intergenic
971285284 4:25283254-25283276 AGGTGCCAAGGCAATTCAATGGG + Intergenic
971871840 4:32251018-32251040 CAGTGGCAAGGTAATTAGCTGGG - Intergenic
972551434 4:40138668-40138690 GAGTGCCAAGAAAATTCAATGGG - Intronic
972761431 4:42109031-42109053 GAGTGCCAGGACAATTCAATGGG - Intergenic
972968071 4:44537256-44537278 CAGTGTAAAGGCAATTCAATAGG + Intergenic
973977568 4:56278383-56278405 GAGTGCTAAGACAATTCAATGGG + Intronic
974029861 4:56766895-56766917 AACTGCCAAGACAATTCAATGGG + Intergenic
974205111 4:58691906-58691928 CAGTGCCAAGGTAATTCAATGGG + Intergenic
974394042 4:61312142-61312164 AAGTGCAAAGGCAATTTAATAGG + Intronic
974754285 4:66183516-66183538 CAGTGGCAAGGCAATTATCTGGG + Intergenic
974926037 4:68298821-68298843 GAGTGCCAAAGCAGTTCAATAGG + Intergenic
975611716 4:76210428-76210450 AGGTGTCAAGGCAGTTCACTGGG + Intronic
975776902 4:77797125-77797147 AACTGCCAAGGATATTCACTGGG + Intronic
976709016 4:88049336-88049358 CAGGTGCAAGGCAATTCACTGGG - Intronic
977236446 4:94512999-94513021 AAGTGCCAAGACCATACACTGGG - Intronic
977398545 4:96501947-96501969 AAGTGCCAAGAATATTCACTGGG + Intergenic
978176439 4:105737730-105737752 AAGTGTCAAGGACATTCACTGGG - Intronic
978258958 4:106728948-106728970 GAGTGCCAAGACCATTCAATGGG + Intergenic
978310659 4:107381980-107382002 CAGTAACAATGCAAATCACTGGG + Intergenic
979500985 4:121439685-121439707 CAGTGCCCAAGCACTTCACCTGG - Intergenic
979590070 4:122468402-122468424 GGGTGCCAAGACAATTCAGTGGG + Intergenic
980821222 4:138020181-138020203 GGGTGCCAAGACAATTCAATGGG + Intergenic
980823617 4:138047462-138047484 CAAAGCCAAAGCAAATCACTAGG - Intergenic
981084019 4:140664694-140664716 GGGTGCTAAGACAATTCACTGGG + Intronic
981620528 4:146692841-146692863 CAGTGCCAGGACAGTTCTCTGGG - Intergenic
981999232 4:151007166-151007188 AAGTGCCAAGGTAATTCAATGGG + Intronic
982562908 4:156952732-156952754 CAATACCAAGGAAATTTACTTGG - Intronic
982566005 4:156987609-156987631 AGATGCCAAGGCAATTCAATGGG - Intergenic
984699535 4:182809691-182809713 CAGTGCCAAGGCAAGTGAAAGGG + Intergenic
985483630 5:136045-136067 GGGTGCCAAGACTATTCACTGGG + Intergenic
985662524 5:1164252-1164274 CAGTGCCCAGGCCACTCACGAGG - Intergenic
986935462 5:12879011-12879033 GGGTGCCAAGACCATTCACTAGG - Intergenic
990479148 5:56190975-56190997 GAGTGCCAAGACCATTCAATAGG - Intronic
990861345 5:60331226-60331248 CAGACCCAAGGCAACTGACTTGG - Intronic
991018369 5:61955500-61955522 AAGTGCCAAGAACATTCACTGGG - Intergenic
991047722 5:62240387-62240409 CAGAGACCAGGCCATTCACTTGG + Intergenic
994654627 5:102575684-102575706 GGGTGCCAAGACAATTCAATGGG - Intergenic
995284655 5:110373969-110373991 AGGTGCCAAGGAAATTCAATGGG - Intronic
995531884 5:113099697-113099719 CAGTGCGGAGGCACTACACTAGG - Intronic
995712560 5:115050033-115050055 AAGGGGCAAGGCAATTCTCTTGG + Intergenic
995788140 5:115853721-115853743 AAGTACCAAGGCAATTCAATAGG - Intronic
996258699 5:121438792-121438814 CAGTGCCAAGCACATACACTGGG - Intergenic
997098998 5:130946885-130946907 CAGTGCCAAGACCACTCAATGGG + Intergenic
997156751 5:131569440-131569462 AGGTACCAAGGCAATTCAATGGG + Intronic
997760044 5:136436922-136436944 AAGTGCCAAGGTAATTCAATAGG - Intergenic
999555482 5:152737828-152737850 TAGTGCCAAAGCCATTCAATGGG - Intergenic
1000034723 5:157436785-157436807 CGGTGCCAAGACCATTCAATAGG + Intronic
1001509228 5:172307073-172307095 AGGTGCCAAGGCAATTCAATGGG + Intergenic
1001634244 5:173198356-173198378 CATGGCCAAGGCAAGTCACAGGG + Intergenic
1003055481 6:2814756-2814778 ATGTGCCAAGGCAATTCTATGGG - Intergenic
1003710897 6:8588632-8588654 AAGTGCCAATGCCATTTACTTGG + Intergenic
1004268458 6:14171709-14171731 GACTGCCAAGACAATTCAATAGG + Intergenic
1004435374 6:15587612-15587634 AGGTGCCAAAGCAATTCAATGGG + Intronic
1004446346 6:15702638-15702660 AGATGCCAAGGCAATTCAATGGG - Intergenic
1005596757 6:27386631-27386653 AAGTGCCAAGACCATTCAATGGG + Intronic
1005907160 6:30273276-30273298 TACTGCCAAGGCAATTCAGTGGG + Intergenic
1009479438 6:64138584-64138606 CAGAGGCAAGGCAATTAAATAGG + Intronic
1009560076 6:65228885-65228907 CAGTGTAAAGGCGATTCAGTGGG + Intronic
1010313624 6:74419119-74419141 CAGTGCCAAGAACACTCACTGGG - Intergenic
1011688568 6:89844558-89844580 CAGTGCCTAGGCTCTTTACTGGG + Intronic
1012266792 6:97154711-97154733 GAGTGCCAAGACAATTTAATTGG - Intronic
1013143969 6:107369043-107369065 AAGTGCCAAGACAATTCAATGGG + Intronic
1013355617 6:109343672-109343694 CAGTGCCAGGGCAAATAATTTGG - Intergenic
1015193253 6:130495392-130495414 AAGTGCCAAGGTAACTCAATGGG - Intergenic
1016421705 6:143891952-143891974 AGATGCCAAGGTAATTCACTGGG + Intronic
1016555703 6:145334750-145334772 TAATGCCAAAGAAATTCACTGGG - Intergenic
1016697400 6:147013700-147013722 TGGTGCCAAGGTAATTCAGTTGG + Intergenic
1016699435 6:147037702-147037724 GAGTGCAGAGGCTATTCACTGGG - Intergenic
1017721897 6:157249356-157249378 AGGTGCAAAGGCAATTCAATGGG - Intergenic
1019081202 6:169431062-169431084 TAGAGCCATGGCAGTTCACTTGG - Intergenic
1019138406 6:169927123-169927145 CACTGCCAAGGCAATGAGCTCGG - Intergenic
1019367109 7:639309-639331 GGGTGCCAAGGCAAGTCAATGGG + Intronic
1019456752 7:1131946-1131968 GAGTGCCATGACAATTCAGTGGG + Intronic
1019836811 7:3394304-3394326 ACATGCCAAGGCAATACACTAGG - Intronic
1022847486 7:34225530-34225552 AAGTGACATGGCACTTCACTTGG - Intergenic
1023893394 7:44411019-44411041 GAGTACCAAGACAATTCAATGGG + Intronic
1024171152 7:46788417-46788439 GAGTGCCAAGATAATTCAATAGG - Intergenic
1024435576 7:49350220-49350242 AGGTGCCAAGGCTATTCAATGGG - Intergenic
1024539343 7:50463368-50463390 CAGTGCCAAAAAAATCCACTTGG - Exonic
1026410882 7:70121073-70121095 GAGTGCCAAGACACTTCAATGGG + Intronic
1026871381 7:73854599-73854621 CAGTTTTCAGGCAATTCACTTGG - Intergenic
1027610221 7:80351321-80351343 CAGTTCTAAGCAAATTCACTTGG - Intergenic
1027887395 7:83926808-83926830 CAGTGCCAAGAAAATTCAATGGG - Intergenic
1029340292 7:99937430-99937452 GAGTGTCAAGACAATTCAGTCGG - Intergenic
1030015414 7:105215063-105215085 GATTGCCAAGACAATTCAATTGG + Intronic
1030506444 7:110430074-110430096 CAGTTCCAAGGTAATTCAATGGG + Intergenic
1031091082 7:117355447-117355469 GGGTGCCAAGACAATTCAATGGG + Intergenic
1031269395 7:119627401-119627423 ATGTGCCAAGACAATTCCCTGGG - Intergenic
1031462977 7:122074741-122074763 TAGTGCTAAGACAATTCAATGGG - Intergenic
1032276250 7:130458300-130458322 GGGTGCCAAGACAATTCACTAGG - Intergenic
1032363870 7:131281303-131281325 GAGTGCCAAGACAATTCGATAGG - Intronic
1032893212 7:136222268-136222290 CAGTCCCAATGCAATGAACTGGG - Intergenic
1033060598 7:138102738-138102760 AAATGCCAACGCAATTCAATGGG + Intronic
1033345680 7:140523976-140523998 CAGTGCCAAGCCCTTTCACAGGG - Intronic
1033966211 7:146977778-146977800 CAGCGCAAAGGCATTTCACTTGG - Intronic
1034891572 7:154844107-154844129 CTGTGCCAAGGCAATACAGATGG + Intronic
1034912919 7:155012126-155012148 CAGAGCCAAAGCAAGTCACAAGG + Intergenic
1035549905 8:514331-514353 GAGTGCCAAGACAATTCAATGGG + Intronic
1036039764 8:5063038-5063060 AAATGCCTAGGCATTTCACTGGG + Intergenic
1036043338 8:5111366-5111388 GAGTGCCAAGGGAAGTCACTAGG + Intergenic
1036554453 8:9846373-9846395 GAGTGCCAAGACAATTCAGTGGG + Intergenic
1037136340 8:15466293-15466315 CAGTGCCAAAGAAATTCACAAGG - Intronic
1037460079 8:19100123-19100145 CAGGGGAAAGGCACTTCACTAGG + Intergenic
1040556369 8:48481423-48481445 GGGTACCAAGGCAATTCAATGGG - Intergenic
1043737778 8:83768926-83768948 CAGTGCCCAGGCTATTCACGTGG + Intergenic
1043916741 8:85931253-85931275 GAGTGCCAAGACCATTCAATGGG + Intergenic
1044594535 8:93945644-93945666 GGGTGCCAAGACAATTCAGTTGG + Intergenic
1045239893 8:100390942-100390964 GGGTGCCATGACAATTCACTGGG + Intronic
1045599223 8:103694060-103694082 CAGTGCCAAGCCAAACCACATGG - Intronic
1047376044 8:124297475-124297497 AGGTGCCAGGGCAATTCAATGGG - Intergenic
1047562396 8:126001800-126001822 AAGTGCCAAAGGAATTCAATGGG + Intergenic
1047676008 8:127202975-127202997 AGGTGCCAAGGCAATTGAGTAGG + Intergenic
1049926448 9:413135-413157 GAGTGCCAAAACAATTCAATGGG + Intronic
1050188850 9:3003894-3003916 CAGTGGCTAGGCAATCCACCAGG + Intergenic
1050748786 9:8911319-8911341 AAGTGCCAAGGCAATTCAGTTGG + Intronic
1050994662 9:12201001-12201023 CAGTGCCATGGCAGTTTACAAGG + Intergenic
1051004960 9:12332724-12332746 TGGTGCCAAAGCAATTCAATAGG + Intergenic
1051807641 9:21013294-21013316 CAATGCCAAGACCATTCAATGGG - Intronic
1051950815 9:22630505-22630527 AAGTGTCAAGGCAGTTCAATGGG + Intergenic
1052004788 9:23333659-23333681 GGGTGCCAAGACAATTCAATAGG + Intergenic
1052275050 9:26665961-26665983 CAGTCTAAAGGCATTTCACTTGG + Intergenic
1052606302 9:30706836-30706858 TTTTGGCAAGGCAATTCACTGGG + Intergenic
1053398104 9:37793456-37793478 AGGTGCCAAGACAATTCAATGGG + Intronic
1053659302 9:40255329-40255351 CTGTGCCAAGGAAATGCATTTGG - Intronic
1053909673 9:42884693-42884715 CTGTGCCAAGGAAATGCATTTGG - Intergenic
1054360338 9:64108092-64108114 CTGTGCCAAGGAAATGCATTTGG - Intergenic
1054371429 9:64401631-64401653 CTGTGCCAAGGAAATGCATTTGG - Intronic
1054525296 9:66120887-66120909 CTGTGCCAAGGAAATGCATTTGG + Intronic
1054679050 9:67891346-67891368 CTGTGCCAAGGAAATGCATTTGG - Intronic
1055203984 9:73704663-73704685 AAGTACCAAGACAATTCAATGGG + Intergenic
1055204757 9:73714750-73714772 AAGTGGAAAGGCAATTCAATAGG - Intergenic
1055405985 9:75974158-75974180 GAGTGCCAAGTCACTTCACTGGG - Intronic
1056378792 9:86038661-86038683 AGGTGCCAAGACAATTCAGTGGG + Intronic
1056394686 9:86170912-86170934 GAGTACCAAGACAATTCAATCGG - Intergenic
1056510814 9:87303590-87303612 GAGTGCCAAGACAATTTAATGGG + Intergenic
1056606257 9:88088138-88088160 GAGTGCATTGGCAATTCACTAGG - Intergenic
1057344468 9:94236462-94236484 AAGTGCTAAGGCAATCCAGTAGG + Intergenic
1057753857 9:97814227-97814249 GGGTGCCAAGGCCATTCAATGGG - Intergenic
1057756505 9:97842398-97842420 CAGTGCCAAGGTAATTCAATGGG + Intergenic
1058304211 9:103416754-103416776 GAGTGCCAAGACAATTCAATGGG - Intergenic
1058617839 9:106852743-106852765 GAGTGTCAAAGCAATTCACATGG - Intergenic
1059163157 9:112054262-112054284 GAGTGCCAAGACCATTCAATAGG + Intronic
1059855554 9:118393331-118393353 CAGTGCCTAAGGCATTCACTAGG + Intergenic
1061011519 9:127958061-127958083 CAGTGCCAAAATAATTCAGTGGG + Intronic
1203694268 Un_GL000214v1:81267-81289 CTGTGCCAAGGAAATGCATTTGG + Intergenic
1203705281 Un_KI270742v1:36158-36180 CTGTGCCAAGGAAATGCATTTGG - Intergenic
1203558723 Un_KI270744v1:29647-29669 CTGTGCCAAGGAAATGCATTTGG + Intergenic
1203642005 Un_KI270751v1:22796-22818 CTGTGCCAAGGAAATGCATTTGG - Intergenic
1186513957 X:10152130-10152152 TGTTGCCAAGGCAATTCAGTAGG - Intergenic
1186824827 X:13329052-13329074 CAGTGCCATGTGAATTCCCTGGG - Intergenic
1187228813 X:17401114-17401136 GGGTGCCAAGACAATTCAATGGG + Intronic
1187421896 X:19142414-19142436 GAGTGCCAAAACAATTCAATAGG + Intergenic
1188424972 X:30036131-30036153 CAGTGCCAAGAACATACACTGGG - Intergenic
1189862264 X:45285634-45285656 GGGTGCCAAGACAATTCAATTGG - Intergenic
1190640505 X:52479435-52479457 AAGTGCCAAGAGAATTCAGTGGG - Intergenic
1190647167 X:52533430-52533452 AAGTGCCAAGAGAATTCAGTGGG + Intergenic
1190649299 X:52553610-52553632 AAGTGCCAAGATAATTCAGTGGG + Intergenic
1190841278 X:54146859-54146881 AAGTGCAAAGGTAATTCAATGGG + Intronic
1190854735 X:54282697-54282719 GGGTGCCAAGGCTATTCAATGGG + Intronic
1191206352 X:57837192-57837214 CAGGGCCAAGGCAACTCAACAGG + Intergenic
1191664492 X:63685692-63685714 AGGTGCCCAGGCAATTCAATAGG + Intronic
1192241547 X:69333812-69333834 GAGTGTCAAGACAATTCAGTGGG - Intergenic
1192382367 X:70631495-70631517 CAGTCCCAAATCAGTTCACTGGG - Intronic
1194921331 X:99769414-99769436 CAGTGCCAAGGAAACACAATAGG + Intergenic
1195580742 X:106498577-106498599 GAGTGCCAGGACAATTCAATGGG - Intergenic
1195791568 X:108593678-108593700 AAGTGCTAATGCAATTCATTGGG - Intronic
1196067436 X:111480125-111480147 GAGTGCCAAGACAATTCAATGGG - Intergenic
1196121208 X:112052877-112052899 GAGTGCCAAGACCATTCAATGGG - Intronic
1196808315 X:119607893-119607915 CAGTGCAAAGGCAAATGACTGGG + Intergenic
1197261365 X:124322207-124322229 TTGTTCCAAGGCAATTCAATAGG - Intronic
1197403634 X:126025068-126025090 GAGTGCTAAGACAATTCAGTGGG - Intergenic
1197740642 X:129890654-129890676 AGATGCCAAGGCAATTCAATGGG + Intergenic
1198134541 X:133735334-133735356 TAGTGCCAAGACAATTCATGGGG + Intronic
1198180511 X:134203491-134203513 GAGTGCCAAGACAATTCAAAAGG + Intergenic
1198315158 X:135458086-135458108 GAGTGCCAAGATAATTCAATAGG - Intergenic
1198465458 X:136900967-136900989 GAGTGCTAAGGCAATTCACTGGG - Intergenic
1199512544 X:148638535-148638557 CAGAGCCAAAGCATATCACTTGG + Intronic
1199722879 X:150555280-150555302 AGGTGCCAAGACAATTCAATGGG + Intergenic
1199742071 X:150745179-150745201 CAGTGCCAGGGCAATGGACCTGG + Intronic
1199923548 X:152436607-152436629 GGGTGCCAAGGTAATTCAATGGG + Intronic
1202581045 Y:26381004-26381026 AGGTGCCAAGACCATTCACTGGG - Intergenic