ID: 1120963630

View in Genome Browser
Species Human (GRCh38)
Location 14:90148393-90148415
Sequence CTCCCCTTCTGGGCCATGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120963630_1120963635 7 Left 1120963630 14:90148393-90148415 CCCATCATGGCCCAGAAGGGGAG 0: 1
1: 0
2: 0
3: 16
4: 160
Right 1120963635 14:90148423-90148445 TGCAAACAGATCATTTCATATGG 0: 1
1: 0
2: 1
3: 15
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120963630 Original CRISPR CTCCCCTTCTGGGCCATGAT GGG (reversed) Intronic