ID: 1120963962

View in Genome Browser
Species Human (GRCh38)
Location 14:90151011-90151033
Sequence AAGTGTGAACAGGAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 712
Summary {0: 1, 1: 0, 2: 6, 3: 58, 4: 647}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120963962_1120963971 27 Left 1120963962 14:90151011-90151033 CCTTCTTCCTCCTGTTCACACTT 0: 1
1: 0
2: 6
3: 58
4: 647
Right 1120963971 14:90151061-90151083 CCCTGATTGTAAGTTTCCTGAGG 0: 37
1: 5915
2: 8512
3: 6824
4: 4423

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120963962 Original CRISPR AAGTGTGAACAGGAGGAAGA AGG (reversed) Intronic
901054936 1:6444685-6444707 GAGTGTGCCCAGGAGGAAGACGG + Intronic
901453711 1:9351730-9351752 AGGTGTGAACAAAAGGAAGTTGG + Intronic
902248971 1:15140875-15140897 AGGGGTGAACAGCAGGAAAAGGG + Intergenic
902479419 1:16703918-16703940 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
902725471 1:18333029-18333051 AAGTGTGTCCAGGAGGCTGAAGG + Intronic
903395294 1:22997435-22997457 AAGAGAAAATAGGAGGAAGAAGG - Intergenic
903950123 1:26991805-26991827 AAGCCTGAAGAGGAGGCAGATGG - Intergenic
904138011 1:28329023-28329045 AAGTGAGAAGAGGAGGAAGTTGG + Exonic
906140218 1:43530005-43530027 GAGGGTGAACATGAGGATGAAGG + Intronic
907096797 1:51789396-51789418 AAGTATGAACTGGAAGAGGATGG - Exonic
907231267 1:53001260-53001282 AAGTATGAAGAGGAGAAAAAGGG + Intronic
908100296 1:60784183-60784205 AATTGTAAACAGAAGGAACAAGG - Intergenic
908135842 1:61131450-61131472 AACTGTGGACAGTAGGAACAAGG + Intronic
908292803 1:62685738-62685760 AAGGGAGTACAGGAGGAAAAAGG - Intronic
908897662 1:68918680-68918702 GAAGGTGAAGAGGAGGAAGAGGG + Intergenic
909016882 1:70389540-70389562 AAGTTTGAATATGAGGAGGATGG + Intergenic
909033877 1:70574554-70574576 AAGTGGTAAAAGGAGGAAGGAGG - Intergenic
909096366 1:71293214-71293236 AGGTGAGAACAGGAGTGAGAGGG - Intergenic
909191876 1:72563201-72563223 AAATGGGAAAGGGAGGAAGAAGG + Intergenic
909415956 1:75405733-75405755 AAGTGCCCACAGGAGAAAGAAGG + Intronic
909458682 1:75882416-75882438 AAGTGGGGGGAGGAGGAAGAGGG - Intronic
909483083 1:76146519-76146541 AAGTGTGGACAGGAGTGTGAGGG - Intronic
909686539 1:78355188-78355210 GAGGGAGAAGAGGAGGAAGAGGG - Intronic
909970265 1:81975818-81975840 AAATGAGAACAAGAGGCAGAGGG - Intronic
910149186 1:84121570-84121592 AAGTGTGAAGAAGGGGAAGTTGG + Intronic
910478488 1:87633998-87634020 AAGTGAGAAGAGGATGGAGAAGG + Intergenic
910499595 1:87874818-87874840 GAGTGGGAACATGAGGAATACGG - Intergenic
911445387 1:97985638-97985660 AACGGTGAGCAGAAGGAAGATGG - Intergenic
911466287 1:98257403-98257425 AAGTCTGAAAAGGAGAAAAAAGG - Intergenic
912450941 1:109767370-109767392 CAGGGTGAACAGGATGATGATGG - Intronic
913426922 1:118742229-118742251 AAATGTTAACACAAGGAAGAAGG - Intergenic
913473068 1:119209677-119209699 AAGTTTTAAAAGGAGGAAGCAGG - Intergenic
914831037 1:151171120-151171142 AAGAAAGAACAGGAGCAAGAGGG + Intronic
915873103 1:159582985-159583007 GATTGTGAACAGCATGAAGATGG + Intergenic
916028399 1:160855375-160855397 CAGTGTGGGAAGGAGGAAGATGG + Intronic
916332156 1:163628642-163628664 AAATGAGAAGAGGAAGAAGAAGG - Intergenic
916585133 1:166143639-166143661 ATGTGGAACCAGGAGGAAGAGGG + Intronic
916648772 1:166816170-166816192 AAAGGTGAACAAGATGAAGATGG + Intergenic
917623127 1:176818507-176818529 AAATGTGAACATGAGGAAAATGG - Intronic
918703740 1:187636756-187636778 CAGTCTGAACAGCAGAAAGAGGG + Intergenic
919355205 1:196513630-196513652 AAGTGAGAGCTGAAGGAAGAAGG - Intronic
919521742 1:198597989-198598011 AAGTGAGAAAAGGAAGAAAATGG + Intergenic
919862943 1:201754321-201754343 AGGTGGGCAGAGGAGGAAGAAGG + Intronic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
920092942 1:203467039-203467061 AATGGAGAACAGGAGAAAGAAGG + Intergenic
920127396 1:203704246-203704268 AAGTAAGGACTGGAGGAAGAAGG + Intronic
920349490 1:205328541-205328563 AAGTGTGCCCAGGAGGGAGGTGG + Intergenic
920655700 1:207872988-207873010 AAGTGAGAAAAGGAGTATGAAGG + Intergenic
920988079 1:210909308-210909330 GAGTGTGTAAAGGAGGGAGAAGG - Intronic
921326317 1:213988879-213988901 AAGAGAGAGCAGGAGAAAGAAGG - Intronic
922586879 1:226740063-226740085 AAGGGTCTACAGGAGCAAGAGGG - Intergenic
922598445 1:226832086-226832108 AAGTTGGGACAGAAGGAAGATGG + Intergenic
923051018 1:230391562-230391584 AGGTGTGAGGAGGAGGGAGAGGG - Intronic
923102876 1:230831001-230831023 AAATGTGAAGATGATGAAGAGGG - Intergenic
923177895 1:231485913-231485935 AAATGTGAACAGGAGGATCTTGG + Intergenic
923392345 1:233525640-233525662 AAGTGAGAACAGGAGGTATTTGG - Intergenic
923949764 1:238935992-238936014 AAGTGTGAGCACGACCAAGAGGG + Intergenic
924209731 1:241752401-241752423 AAGTGAGGACATGAGGGAGAAGG - Intronic
924440602 1:244082362-244082384 AAGTGAAGACAGGAGGAAGTGGG + Intergenic
924802311 1:247336359-247336381 ATGTGAGAGCAGGAGGAAGAGGG + Intergenic
1063427088 10:5958954-5958976 AGGGGAGAACAGGAGGAAGAAGG - Intronic
1064322867 10:14321957-14321979 TGGTGGGAGCAGGAGGAAGAGGG - Intronic
1064727348 10:18294230-18294252 AGGCATGAACAGGAGAAAGAAGG - Intronic
1065680911 10:28231327-28231349 AAATGTGAACATTAGGAAAAGGG + Intronic
1065694287 10:28365661-28365683 AAGTGAAAAAAGGAGGAAGAAGG + Intergenic
1065788144 10:29235477-29235499 GAGTGTGGATAGGAGGCAGAAGG + Intergenic
1065954537 10:30682155-30682177 AAGTGTGAAAACAAAGAAGATGG - Intergenic
1066562606 10:36686891-36686913 AAGAGGGAAGAGGAGGAGGAAGG + Intergenic
1067145315 10:43689721-43689743 AGCTGTGAGCGGGAGGAAGAGGG + Intergenic
1067202479 10:44185346-44185368 AATTGAGAAAAGAAGGAAGAAGG + Intergenic
1067208195 10:44237495-44237517 AAGTGGGAAGAAAAGGAAGAAGG + Intergenic
1068145693 10:53067698-53067720 AAGTGAGACCAGGATGAACATGG + Intergenic
1068227928 10:54130784-54130806 GAGTGTGAAAAGGATGAGGATGG + Intronic
1068340204 10:55691906-55691928 AAGAGAGAACAGGTGGAAGAAGG - Intergenic
1068531119 10:58187609-58187631 AAGTAAGAACAGGAAGATGATGG + Intergenic
1068749364 10:60573825-60573847 AAGTGGGAAAGGGAGAAAGAAGG + Intronic
1069409525 10:68139075-68139097 ATGTTGGAGCAGGAGGAAGAAGG - Intronic
1069940150 10:71949677-71949699 AAATGCTAAAAGGAGGAAGAGGG + Intergenic
1070270298 10:74947661-74947683 AAGGGTAAACTGTAGGAAGAAGG - Intronic
1070386261 10:75927441-75927463 AAGTGAGGAGAAGAGGAAGAGGG - Intronic
1071047954 10:81406672-81406694 AGTTGTAAATAGGAGGAAGAAGG - Intergenic
1071186841 10:83056234-83056256 AAGACAAAACAGGAGGAAGAAGG - Intergenic
1071745874 10:88418974-88418996 AAGAGAGAACAGGAGAAAGTAGG - Intronic
1073093794 10:100967953-100967975 AAGTCTGAGAAGGAGGAAGCAGG - Intergenic
1073116563 10:101094808-101094830 AAGTGGGCACAGGTGGAAGGAGG - Intronic
1073169203 10:101488405-101488427 AGGTGTTTATAGGAGGAAGAAGG + Intronic
1074846127 10:117399630-117399652 AAGGGTGCACAGAAGAAAGATGG - Intergenic
1074921528 10:118019353-118019375 AGGAGGGAAGAGGAGGAAGAGGG + Intronic
1076021408 10:127076817-127076839 AAATGCCACCAGGAGGAAGAAGG - Intronic
1076294513 10:129374210-129374232 CAGTGTGAACAGAAAGCAGAGGG - Intergenic
1076513254 10:131027151-131027173 ATGCGTGAACAAGAGGAAAAAGG - Intergenic
1076682114 10:132178345-132178367 AAGGGGGTAGAGGAGGAAGAGGG + Intronic
1077735552 11:4786848-4786870 AACTGTGCTCAGAAGGAAGAAGG - Intronic
1078349018 11:10577264-10577286 AAGGAAGAAGAGGAGGAAGAGGG - Intronic
1078528741 11:12120325-12120347 AGCTGGGAACAGGAGGAGGAGGG + Intronic
1078920672 11:15827234-15827256 AAGTGTAAACAGGAGGTTGGGGG - Intergenic
1079986974 11:27209885-27209907 GTGTGTAAAGAGGAGGAAGATGG + Intergenic
1080170416 11:29295395-29295417 AAGTCTGAAATGTAGGAAGAAGG + Intergenic
1080249551 11:30217756-30217778 AAGTGAGAACAGGAGGAATTAGG + Intergenic
1080384448 11:31802881-31802903 CAGAGTGAAGAGGAAGAAGAGGG + Intronic
1080477790 11:32612349-32612371 AAGTATGATCATGAGGAAAATGG - Intronic
1080944632 11:36957886-36957908 TAGGGTGAAGAGGAGAAAGATGG + Intergenic
1081433928 11:43006126-43006148 AAGAAGGAAGAGGAGGAAGAAGG + Intergenic
1081522332 11:43894664-43894686 AAGAATGTAAAGGAGGAAGATGG - Intronic
1082008705 11:47436175-47436197 GGGGGTGAACATGAGGAAGAGGG + Intergenic
1082073538 11:47958755-47958777 AAGTGGGACCAAGAGGAGGATGG - Intergenic
1082921316 11:58497712-58497734 AAGGGTGAGAAGGAGGAAGAGGG + Intergenic
1084614229 11:70225114-70225136 AATTGTGAACAGGAAGGAGAGGG + Intergenic
1085158809 11:74322109-74322131 AAGTGTAAACAGGAGCCAGATGG + Intergenic
1085799405 11:79575050-79575072 AAGAGTGACCAGGATGATGAGGG + Intergenic
1085885501 11:80517329-80517351 TTGTCTGAGCAGGAGGAAGAGGG - Intergenic
1087728128 11:101746447-101746469 AAGGGTGAAAAGGAGGAGGGAGG - Intronic
1088340373 11:108758716-108758738 AAGTGGAAACAGGAGGCAGAAGG - Intronic
1088764494 11:112962579-112962601 AAGTGTGAACAATAGGGAGCTGG + Intronic
1089038209 11:115419184-115419206 AATTGTGAACAGCATAAAGATGG - Intronic
1089054348 11:115573074-115573096 ACGTGTGAACAGAGGGAAAACGG + Intergenic
1089290282 11:117433512-117433534 AAGTTTGAACAGGATGACAATGG + Intronic
1089490774 11:118882489-118882511 AGGTGTGAAGAGGGGAAAGAGGG + Intergenic
1090055730 11:123422850-123422872 CAGAGTGAACACGAGGGAGAAGG - Intergenic
1090469733 11:126969474-126969496 AGGTGTGAACCAGGGGAAGAGGG + Intronic
1090751392 11:129749186-129749208 AAGTATGTGCAGGAGGCAGAAGG - Intergenic
1091318930 11:134636124-134636146 AAGTGTGGACAGGAGTGAGTCGG - Intergenic
1091337122 11:134780619-134780641 AAGAGTGAGGAGGAGGAGGAGGG - Intergenic
1091887455 12:4027074-4027096 AAGTGTGTGCAGGAGAAAGAAGG - Intergenic
1092739845 12:11616889-11616911 TGGTCAGAACAGGAGGAAGATGG + Intergenic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1093031475 12:14293076-14293098 AAATGTGAAAAGGAGAGAGACGG - Intergenic
1093240507 12:16665114-16665136 AAGTGGGAAAAGTATGAAGATGG + Intergenic
1093640388 12:21520817-21520839 AGGTGTGATCAATAGGAAGATGG - Intergenic
1094322409 12:29199847-29199869 TAGAGTGACCAGGAGTAAGATGG + Intronic
1094716115 12:33016890-33016912 AACTTTGAACTTGAGGAAGATGG + Intergenic
1095238752 12:39832015-39832037 AAGAGTTTACAGGAGGGAGAAGG - Intronic
1095648850 12:44582938-44582960 AAGTGAGCACAAGAGCAAGAAGG - Intronic
1095833503 12:46612555-46612577 AAGAAAGAAAAGGAGGAAGATGG - Intergenic
1096614392 12:52823609-52823631 AAGTCAGAACAGGAGGTAGAGGG - Intronic
1096692996 12:53332738-53332760 AAGGGGGAGGAGGAGGAAGAAGG + Intronic
1097044574 12:56177973-56177995 ATGTGGGGACAGGAGGGAGAAGG + Intronic
1097312959 12:58141185-58141207 AAGTGGGAGCAAGAGAAAGAGGG - Intergenic
1097996785 12:65896547-65896569 CAGGGAGAAGAGGAGGAAGAAGG - Intronic
1098101644 12:67024077-67024099 AAGTGTGAACAGTCTGAAAAGGG - Intergenic
1098519929 12:71423621-71423643 CAGTGTGAGCAAGAGGATGATGG - Intronic
1098834388 12:75403745-75403767 TGGTGTGAACAGAAGGATGAAGG - Intronic
1099349965 12:81554162-81554184 AAATGGCAACAGTAGGAAGAAGG + Intronic
1100460597 12:94795605-94795627 AAGTCTGCTGAGGAGGAAGAGGG - Intergenic
1100850149 12:98701795-98701817 AAGAAAGAACAGGAGGAGGAAGG - Intronic
1100855151 12:98751302-98751324 AACCTTGAACAGGAGGAAAAGGG - Intronic
1100894413 12:99163617-99163639 AAATGGGAAAGGGAGGAAGAAGG - Intronic
1101952675 12:109188549-109188571 AATTGGGAAAAGGAGGAAGTGGG - Intronic
1102449610 12:113031045-113031067 AAGAGAGAAAAGGAGGGAGATGG - Intergenic
1104703002 12:130921440-130921462 AAGTGGGAGCAGAAGGAAGGGGG + Intergenic
1104744121 12:131200319-131200341 AACTGTGATAAGGATGAAGATGG - Intergenic
1105018969 12:132803944-132803966 AAGCGTGAACAGGAGTGGGAAGG - Intronic
1106487930 13:30189184-30189206 AGGTCTGAAAAGAAGGAAGATGG + Intergenic
1107227888 13:38072845-38072867 AAGGTTGGTCAGGAGGAAGATGG - Intergenic
1107448966 13:40491646-40491668 AAGAAGGAACAGGAGCAAGATGG + Intergenic
1107705460 13:43098709-43098731 AACTGAGAACAGGAAGATGAGGG - Intronic
1107814675 13:44233688-44233710 AACTGTGAAAAGCAAGAAGATGG - Intergenic
1108204198 13:48071821-48071843 AAGAGAGGACAGGAGGAAAAAGG - Intronic
1109621701 13:64916804-64916826 AAGAGTGAGGAGGAGGAAGGAGG - Intergenic
1110228403 13:73143600-73143622 ATGGGTGAACAAGAGGAGGAAGG - Intergenic
1111355426 13:87094818-87094840 AAGTGTGAATAGGACGAGCAGGG + Intergenic
1112311079 13:98318019-98318041 AAGAGGGAGGAGGAGGAAGAAGG - Intronic
1113067810 13:106389783-106389805 AAGTGGGTTCAGGAGGTAGAGGG - Intergenic
1113248852 13:108428962-108428984 AAGTCTGTAGAGGAGGAAGGCGG - Intergenic
1114366662 14:22034294-22034316 CAGTGTGAACAGGAAGAGGCAGG + Intergenic
1115498288 14:34027456-34027478 AAGGGAGGAGAGGAGGAAGAAGG + Intronic
1115894844 14:38074881-38074903 AAATGTGAACAGGAGTGATATGG - Intergenic
1116056208 14:39866657-39866679 GAGGGAGAGCAGGAGGAAGAAGG + Intergenic
1116367995 14:44092849-44092871 AAATGTGAATAAGAGGAACAGGG - Intergenic
1116720823 14:48493463-48493485 AAGTGAGAACATGAGGAATTTGG - Intergenic
1116945550 14:50831581-50831603 AAGGGTGTTCAGGAGGCAGAAGG + Intergenic
1117164342 14:53018715-53018737 AAGGGTGAGTGGGAGGAAGAGGG - Intergenic
1118150893 14:63189397-63189419 GAATGTGAATAAGAGGAAGATGG - Intergenic
1118533905 14:66737210-66737232 AAGGGAGAACAGGAAGAGGAAGG - Intronic
1118979093 14:70701676-70701698 AAGGAGGAACAAGAGGAAGAGGG + Intergenic
1118995423 14:70831315-70831337 AAAGGAGAGCAGGAGGAAGAAGG - Intergenic
1119004776 14:70914095-70914117 AAGTGAGAACATGTGGTAGATGG - Intronic
1119180384 14:72601044-72601066 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1119219214 14:72893021-72893043 AAGGATGAAAAGGAGGAGGAAGG + Intronic
1119471054 14:74899484-74899506 AACTCTCAACAAGAGGAAGAGGG - Intronic
1119554407 14:75542320-75542342 AATTCTGAATAGGAGAAAGATGG + Intronic
1119850161 14:77861293-77861315 AAGGGGGAGGAGGAGGAAGAGGG - Intronic
1120117611 14:80638155-80638177 AAATATGAAGAGAAGGAAGAAGG - Intronic
1120811135 14:88804432-88804454 AAGAGGGAACAAGAGGAAGCTGG - Intergenic
1120963962 14:90151011-90151033 AAGTGTGAACAGGAGGAAGAAGG - Intronic
1121026795 14:90622040-90622062 AACTGTCAACACGATGAAGAGGG + Intronic
1121402436 14:93691730-93691752 AGGTCTGAAAAGGAAGAAGACGG - Exonic
1121688855 14:95860106-95860128 AGGTGTTGACAGCAGGAAGATGG + Intergenic
1121876856 14:97460725-97460747 AAGTGTGAACAGGATGCCCATGG + Intergenic
1122680382 14:103456411-103456433 AAGTGTGAATGAGGGGAAGAGGG - Intronic
1122771689 14:104100554-104100576 AGGAGGGAACAGCAGGAAGAAGG - Intronic
1124717154 15:32074016-32074038 AAATGGGAACAGGAAGAAGGAGG - Intronic
1125187480 15:36948124-36948146 AAGTGTGAAAATTAGGAAGATGG + Intronic
1125972528 15:43923444-43923466 AAGTGTGAAAAGGAGTTAGCTGG + Intronic
1126373296 15:47969543-47969565 AAGTGTGGGCAGGAGAAAAAGGG - Intergenic
1126697668 15:51340026-51340048 TGGTGGGAGCAGGAGGAAGAGGG + Intergenic
1126841701 15:52723567-52723589 TAGTGTGGAAAGGAGGGAGAAGG - Intergenic
1127609916 15:60626940-60626962 AAATCTGAACAGGAGGAGGCAGG - Intronic
1127996568 15:64156375-64156397 AAGGGTGAGGAGGAGGAAGAGGG + Exonic
1128383112 15:67127734-67127756 AAGCGTGTACAGTAGGATGAGGG - Intronic
1129115267 15:73362078-73362100 GGGTGTGAACAGGAAGAAGCTGG - Intronic
1129828262 15:78650034-78650056 GAGTGTGCCCAGGAGGAGGATGG + Intronic
1130241332 15:82195679-82195701 AAGTTTGAGCAGGAGGAAAATGG - Intronic
1130372747 15:83299975-83299997 AAGGGTGAACATCAGGAGGAAGG + Intergenic
1130459091 15:84145474-84145496 AAGTTTGAGCAGGAGGAAAATGG + Intergenic
1130993203 15:88889047-88889069 GAGAGGGAAGAGGAGGAAGACGG + Intronic
1131119426 15:89813679-89813701 AGGGGTGACCAGGAGGAAGTGGG - Intronic
1131943118 15:97589125-97589147 GAGTGTGATTATGAGGAAGAGGG + Intergenic
1132210650 15:100019845-100019867 AAGTGTGAGCTGGAGGGAGATGG - Intronic
1132733441 16:1374426-1374448 AGGTGAGGACAGGAGGAAGGGGG - Intronic
1133485380 16:6214579-6214601 AAGTGGGAGAAGGAGGGAGAAGG + Intronic
1133882363 16:9794928-9794950 AAGGATGAAGAGGAGGAGGAGGG + Intronic
1134119183 16:11571652-11571674 AAGTTTGAACCAGAGGAGGAGGG - Intronic
1135294821 16:21270057-21270079 AAGTGGGAAAAGAAGGAAGAAGG + Intronic
1135524180 16:23201268-23201290 CAGTTTGAAAAGGGGGAAGAGGG - Intronic
1135851454 16:25967712-25967734 AAGTGAGAAGAGAAGGAAGAGGG + Intronic
1135865841 16:26101098-26101120 AAAAGTGAAGAGGAGCAAGAAGG - Intronic
1135979668 16:27138180-27138202 ATGTGTGGAGAGGAGAAAGAAGG + Intergenic
1136938466 16:34498866-34498888 AAGTGAGAAAAGAAGGAAGGAGG - Intergenic
1136961353 16:34849691-34849713 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1137506222 16:49056223-49056245 AAGTGTTGCCAGGTGGAAGAAGG - Intergenic
1137591062 16:49694191-49694213 AAGGGGGAGCAGGAGGGAGAGGG + Intronic
1137801283 16:51264270-51264292 AAGAGTGAACATGAGGATAATGG - Intergenic
1138036439 16:53611695-53611717 AAGTCTCAACAGAAAGAAGACGG + Intronic
1138291877 16:55854866-55854888 GACTGAGAACAGAAGGAAGAAGG - Intronic
1138309610 16:56012041-56012063 AGGTGTGAATGGGAGGCAGATGG - Intergenic
1138313538 16:56048909-56048931 AAGTAAGAAAAGGAGGAAGGAGG - Intergenic
1138352145 16:56351822-56351844 GAGGGTGACCAGGAGGAAGGGGG - Intronic
1138949912 16:61899559-61899581 AAGGGTGAGAAAGAGGAAGAGGG + Intronic
1139027081 16:62831744-62831766 AAGTGTGAATAGCAAGCAGACGG + Intergenic
1139114977 16:63939430-63939452 AAGTGTGAAAAGGAATAAAAAGG - Intergenic
1139177533 16:64707616-64707638 AAAAGTGAAGAGGAAGAAGAAGG - Intergenic
1139615838 16:68090714-68090736 CAGTATGAAAAGGAGGAAGTTGG + Intronic
1139821475 16:69724758-69724780 AAGTGAGAAGAGAAGGCAGAAGG - Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140417624 16:74787412-74787434 GAGTGGGAACAGGGGGAAGAAGG - Intergenic
1140940600 16:79718431-79718453 AACTGTGAAGAAGAGGAATATGG + Intergenic
1141322784 16:83027412-83027434 AAGAGTTAACAGGGTGAAGAAGG + Intronic
1141476750 16:84279231-84279253 GAGTCTGAAGGGGAGGAAGAGGG + Intergenic
1141562274 16:84877417-84877439 CACTGTGAACAGGAGCAAGGGGG - Exonic
1141646230 16:85369515-85369537 ATGTGAGAACAGGAGCAAGTGGG - Intergenic
1141674186 16:85509010-85509032 AGGTGGGAACAGCAGGGAGAGGG + Intergenic
1141703628 16:85653308-85653330 AAGTGGGAGGAGGAGGAGGAGGG - Intronic
1141974694 16:87507772-87507794 AAGTGTGACCAGGAGGAGGCTGG + Intergenic
1142208934 16:88798414-88798436 ACGGGTGATCATGAGGAAGATGG + Intergenic
1142872245 17:2828525-2828547 AGGTGTGAAGATGAGGAAGGAGG + Intronic
1143633894 17:8153481-8153503 GAGTGTCAACAGGAGAAAGGGGG + Intronic
1143718533 17:8793843-8793865 TAGCCTGAACAAGAGGAAGAAGG - Intergenic
1144038951 17:11391429-11391451 AAGTGTAACAAGGAGGAAGAGGG - Intronic
1144670476 17:17129986-17130008 AAGTGTGACCAGGGAGGAGAGGG + Intronic
1146552963 17:33797974-33797996 CAGTGTGCAAAGGAGGAAGTGGG + Intronic
1146554033 17:33807659-33807681 ATGTGTGAAGAGGATGAGGAGGG - Intronic
1146817666 17:35956135-35956157 AAGGGTGGAGAGTAGGAAGAGGG - Intergenic
1147038068 17:37696487-37696509 GAGTGTGAGCAGGAGGGAGAAGG - Intronic
1147510404 17:41064204-41064226 AAGAGTGAAGAGGAAGATGATGG - Intergenic
1147572246 17:41578599-41578621 AAGAGACAACATGAGGAAGAAGG - Intergenic
1147625833 17:41899344-41899366 GACTGCGAACAGGAGGAATATGG - Intronic
1148127091 17:45242490-45242512 ATGTGGGCACCGGAGGAAGAGGG + Intronic
1148319379 17:46737442-46737464 AACGCTGAACAAGAGGAAGAGGG + Intronic
1148661692 17:49339116-49339138 AAGTGTGATCAGGAGGGGAATGG + Intronic
1149661370 17:58335767-58335789 ATGTGAGTACAGGTGGAAGAGGG + Intergenic
1150244582 17:63664818-63664840 AAGTGGGAAAAAGAGGAAGGAGG - Intronic
1150909023 17:69369037-69369059 AACTGTGAACAGTGGGAAGATGG - Intergenic
1151022645 17:70635827-70635849 AAAGGTGAATGGGAGGAAGAAGG - Intergenic
1151765356 17:76130876-76130898 TGGTGAGAGCAGGAGGAAGAGGG - Intergenic
1152204886 17:78969332-78969354 CAATGAGATCAGGAGGAAGAAGG - Intergenic
1152558007 17:81064138-81064160 GAATGAGAAGAGGAGGAAGAAGG - Intronic
1153185250 18:2478905-2478927 AAGAGGGAGGAGGAGGAAGAAGG + Intergenic
1153513006 18:5875926-5875948 AGGTGTGAACAGAAGGATGAAGG + Intergenic
1153750417 18:8223886-8223908 AAGAGAGAACACTAGGAAGAAGG - Intronic
1153761306 18:8334879-8334901 AAGTGGGAACAGGAGGAGCAAGG - Intronic
1153813319 18:8771008-8771030 ATGAGTGAACAGGAGGAAGGGGG + Intronic
1153992243 18:10410864-10410886 AAGTGTGAACAAGTGGGAGAAGG - Intergenic
1154282723 18:13020468-13020490 AAGTGTCCACAGAAGGATGAGGG - Intronic
1155399510 18:25422563-25422585 AGGTCTCAACAGGAGGGAGAGGG - Intergenic
1155537384 18:26831581-26831603 AAGTTTGAAGAGGATGAAGCTGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156111419 18:33731847-33731869 ATGTGTGAGGAGGAGGAAGGGGG - Intronic
1156376812 18:36521934-36521956 ATGTGTGAACCAGATGAAGATGG - Intronic
1156671760 18:39479222-39479244 AAGGGGAAACAGGAGAAAGAAGG + Intergenic
1156721396 18:40074363-40074385 AAGTGTGAAAAGAACCAAGATGG + Intergenic
1156824112 18:41409229-41409251 AAGTTTGAACAGAAGGATTAGGG + Intergenic
1156897216 18:42259420-42259442 GAGTGTGAGCAGGATGAAGTTGG - Intergenic
1157323768 18:46654639-46654661 GAGTGTGATGGGGAGGAAGAAGG - Intronic
1157475451 18:48020906-48020928 AAGGGAGGACAGGAGGAAGTGGG - Intergenic
1157729055 18:49988158-49988180 TTGGGTGAAGAGGAGGAAGAAGG + Intronic
1158775961 18:60580315-60580337 AGGTGGGAACAGGCTGAAGATGG - Intergenic
1159524503 18:69569948-69569970 AAGTGAGAACAGGTGGTATATGG - Intronic
1159789822 18:72764737-72764759 AAATGTGGATAAGAGGAAGAGGG - Intronic
1159824279 18:73187731-73187753 AAATGTGTACAAGAGAAAGAGGG - Intronic
1159953037 18:74498825-74498847 GTGTTTGAAGAGGAGGAAGAGGG + Intronic
1160209102 18:76861327-76861349 CAGTGAGAACGGGAGGAGGAAGG + Intronic
1160701430 19:509239-509261 AACGGGGAGCAGGAGGAAGATGG + Intronic
1160821128 19:1058693-1058715 TAGTGTGAAGAGAAGGAAGAGGG - Exonic
1161489892 19:4556093-4556115 AGGTGGGGACAGGAGGAAGCGGG + Intronic
1162044690 19:7990801-7990823 TAGAGGGAAGAGGAGGAAGAGGG + Intronic
1162502076 19:11059837-11059859 GAGAGTGAGGAGGAGGAAGAGGG + Exonic
1162648229 19:12065260-12065282 AAGTTTTAACAGGAGAAAGGGGG - Intronic
1162845566 19:13389691-13389713 AAATGTGAACAGGCGGATCAGGG - Intronic
1167191248 19:47991609-47991631 AGGAGGGAAGAGGAGGAAGAGGG - Intronic
1168042247 19:53768058-53768080 AAGTGTGAACAGAAGGGCAAAGG - Intergenic
1168332374 19:55578144-55578166 AAGGCCGAGCAGGAGGAAGAAGG - Exonic
1168405307 19:56107570-56107592 AAGGGTCACCAGGAGAAAGAGGG + Intronic
1168506144 19:56936840-56936862 TGGTGTGCACAGCAGGAAGAGGG - Intergenic
1202713458 1_KI270714v1_random:29824-29846 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
926118700 2:10229305-10229327 AAGCGTGAACAGGGGGAGGGTGG + Intergenic
926211958 2:10877977-10877999 GGCTGTGAACAGGAGGAGGAAGG + Intergenic
926247915 2:11134100-11134122 AAGTGTGACCAGCGGTAAGAAGG + Intronic
926449589 2:12986171-12986193 GAGTGTGAACAGTAGAAAGTTGG - Intergenic
926800377 2:16655032-16655054 TAGTGTGAAAGGGAGAAAGAGGG + Intronic
927528521 2:23771641-23771663 AAGTGAGAAAAAGAGGAAAAAGG - Intronic
928102623 2:28448309-28448331 AAGTTTCAACAAGAGGAAGGAGG - Intergenic
928387992 2:30885745-30885767 AATTGTGAAAAGGAACAAGAGGG - Intergenic
929766490 2:44848181-44848203 AATGGGGAACAGGAGGAAGCTGG - Intergenic
930911845 2:56638316-56638338 CATTGAGACCAGGAGGAAGAAGG + Intergenic
931811212 2:65856770-65856792 AAGTTTGCACAGGAGGAAAGTGG + Intergenic
932220550 2:69995734-69995756 AGGTGGGAAGAGCAGGAAGAAGG + Intergenic
932452756 2:71825414-71825436 AAGTGCAAACAGGAGAAAGAAGG + Intergenic
932893104 2:75612882-75612904 AAGGGACAAAAGGAGGAAGATGG + Intergenic
933378574 2:81513905-81513927 AAGTGTGAACAAGCGTAAGAGGG - Intergenic
933648414 2:84830515-84830537 AAGAGTGAACCAGAGGGAGAAGG + Intronic
934481234 2:94647376-94647398 AAGTGTCCACAGGAGAAAGCAGG + Intergenic
934948273 2:98557912-98557934 CAGAGTGTACAGGAGGAAGGCGG - Intronic
935455380 2:103261513-103261535 TGCTGTGAACAGGAGGAAAAAGG - Intergenic
935998342 2:108798794-108798816 AGGTGTGGAGAGGAGGAGGAAGG - Intronic
936073878 2:109389291-109389313 CTGTGCAAACAGGAGGAAGAGGG + Intronic
936677756 2:114734968-114734990 ATGTGAGAACATGAGGGAGAAGG - Intronic
937264193 2:120605852-120605874 AAGTGAGAAAAGGAGAAGGAAGG + Intergenic
937774168 2:125756060-125756082 GTGTGAGAAGAGGAGGAAGAGGG + Intergenic
937792398 2:125976146-125976168 AAGTGTTAAAAGGTGGGAGACGG - Intergenic
938828523 2:135031210-135031232 AAGTGAATACAGGAGGATGATGG + Intronic
939224647 2:139349547-139349569 AAGTGTCCACAGGAGAAAGCGGG - Intergenic
939259912 2:139793642-139793664 AAGTGTGGACTGGAGGCAGAGGG - Intergenic
940599701 2:155843195-155843217 AAGTGAGAAAGGAAGGAAGATGG - Intergenic
940879186 2:158929449-158929471 AAGGATGAGCAGGAGGAGGAAGG - Intergenic
941151455 2:161919654-161919676 GAGGGTGAACAAGATGAAGAGGG - Intronic
942035063 2:172002744-172002766 ATGGGTGAAAGGGAGGAAGAGGG - Intronic
942709341 2:178815007-178815029 ATGTGGAGACAGGAGGAAGATGG + Intronic
943347336 2:186754933-186754955 CATTTTGAACAGAAGGAAGATGG + Intronic
943853890 2:192763543-192763565 AAGTGGGAAGAGTAGGGAGAAGG + Intergenic
944320800 2:198339571-198339593 AAGTCTGCACAGGATGAAGGAGG - Intronic
945488738 2:210429366-210429388 GAGTGTGAAGAGGAGGAGAAAGG + Intergenic
946100206 2:217314123-217314145 AAGTCAGAACAAGAGGAAGGGGG - Intronic
946128517 2:217585940-217585962 AAATGAGAACTGGGGGAAGATGG + Intronic
946181312 2:217950783-217950805 AAGAGTGCAGAGGAGGAAGAGGG - Intronic
946324918 2:218980410-218980432 AAGTGAGAGCAGGACGAGGAGGG + Intergenic
946483732 2:220080761-220080783 AATTGTGACCAGGAGCCAGATGG - Intergenic
946831891 2:223735853-223735875 AAGTTTGAACATGAGGAGGAGGG - Intergenic
946992227 2:225346802-225346824 AAAAGAGAAGAGGAGGAAGAGGG - Intergenic
947008151 2:225536233-225536255 TTGGGAGAACAGGAGGAAGAAGG - Intronic
947243108 2:228017832-228017854 CAGTGAGATCAAGAGGAAGACGG - Exonic
947783550 2:232793186-232793208 AAGTGTGAAAAGGAGGATATTGG + Intronic
948046306 2:234948040-234948062 AAGTGGGAGCAAGAGAAAGAGGG + Intergenic
948223334 2:236290364-236290386 ATATGTGCTCAGGAGGAAGAGGG + Intergenic
948742231 2:240055615-240055637 AAGCAGGAAGAGGAGGAAGAGGG + Intergenic
948768683 2:240236365-240236387 AGGTGCAAACAGGAGGACGATGG - Intergenic
1168810874 20:703788-703810 CAGTGTGAACAGGAAGTTGACGG + Intergenic
1169679864 20:8198893-8198915 AAGTGTGAAGGAGAGAAAGAGGG + Intronic
1169709755 20:8548238-8548260 AAGGGTGAAAAAGAGGAAGAGGG - Intronic
1170034309 20:11973845-11973867 AAGGAAGAAGAGGAGGAAGAAGG + Intergenic
1170146896 20:13185423-13185445 GAGGGTGACAAGGAGGAAGAAGG - Intergenic
1170662665 20:18358243-18358265 GAGGATGAACAGGAGGATGAAGG + Intergenic
1170731103 20:18975442-18975464 AAGGGAGAAAAAGAGGAAGAGGG - Intergenic
1171749012 20:29029099-29029121 AGGTGTGAACAGGAGGCAGGAGG + Intergenic
1172993541 20:39053237-39053259 AGGTGTGAACAGGAAGAAAGAGG + Intergenic
1174570485 20:51497724-51497746 GATTGAGAACAGGAAGAAGATGG + Intronic
1174592736 20:51658981-51659003 CAGAGGGAACGGGAGGAAGATGG - Intronic
1174656693 20:52177611-52177633 CACCGAGAACAGGAGGAAGACGG + Intronic
1174753042 20:53131076-53131098 AAATAAGAACATGAGGAAGAGGG + Intronic
1175002793 20:55647907-55647929 AAGTATGTAGAGGAGGAAGGTGG - Intergenic
1175054413 20:56185213-56185235 TTGTGGGAACAGGAGCAAGAAGG - Intergenic
1175638853 20:60609829-60609851 GAGGGTGAAGAGGGGGAAGAGGG + Intergenic
1175840042 20:62020931-62020953 CAGCGTGAACATGAGGAAGGAGG + Intronic
1176956064 21:15105387-15105409 AAGAGGGAAGAGGAAGAAGAGGG - Intergenic
1177004044 21:15648725-15648747 CAGTGAGAAAAGGAGGAAGAGGG - Intergenic
1177009832 21:15718628-15718650 AAGTGTGAACATGAGGTATTTGG - Intergenic
1177056753 21:16315216-16315238 AAGAATGGACAGGAGTAAGAAGG - Intergenic
1177259182 21:18706909-18706931 GAGGGTGAACAGGGGGAAGAGGG - Intergenic
1177259190 21:18706936-18706958 AAGGGGGAAGAGGGGGAAGACGG - Intergenic
1178395688 21:32241041-32241063 AAATGTGAACTTGAGGAATAGGG - Intergenic
1178452336 21:32714237-32714259 AAGTGGTAACAGGTTGAAGAGGG + Intronic
1178463112 21:32821032-32821054 AAGTGTTATCAGAAAGAAGAGGG - Intergenic
1178689322 21:34738265-34738287 AAGTGGGAAAGGCAGGAAGAAGG - Intergenic
1179818786 21:43924546-43924568 GATTGCTAACAGGAGGAAGATGG - Intronic
1180157677 21:45986035-45986057 AAGTGGGAGCAGCAGGAAGGAGG - Intronic
1180393977 22:12312526-12312548 AGGTGTAAGCAGGAGGCAGAAGG - Intergenic
1180405770 22:12552224-12552246 AGGTGTAAGCAGGAGGCAGAAGG + Intergenic
1181366673 22:22381677-22381699 AAATGGGAAAAGGAGGATGACGG - Intergenic
1181506459 22:23361582-23361604 GACTGAGAACAGAAGGAAGAAGG - Intergenic
1182219000 22:28742843-28742865 AAGTGAGAATTGGAGGGAGAGGG + Intronic
1182268156 22:29135481-29135503 AAGTGTGAAGAGAAGGAAGTGGG + Intronic
1182962407 22:34488170-34488192 AAGTGAGGAAAGGAGGAGGAGGG - Intergenic
1183989900 22:41590683-41590705 ATGTGTGGACAGAAGGAATAAGG - Intergenic
1184128557 22:42503677-42503699 AAATGTGAACTGAAGGAACAAGG + Intergenic
1184137351 22:42556992-42557014 AAATGTGAACTGAAGGAACAAGG + Intronic
1185093900 22:48795323-48795345 AAGTAAGAACTGGAGGAAGTAGG - Intronic
1185184011 22:49381770-49381792 AAGAGTTAACAGGAGAAGGAGGG - Intergenic
1185355092 22:50363846-50363868 AAGTGTGAAAAAGAATAAGAAGG + Intronic
949368641 3:3310460-3310482 CAGTGTGAGCTGGAGGCAGAGGG - Intergenic
949669703 3:6385063-6385085 AAGTGAGAACAGGCTGAAAATGG + Intergenic
949853078 3:8438465-8438487 AAGTGAGGACATGGGGAAGAAGG + Intergenic
950427868 3:12934417-12934439 AAGAGAGAACAGGGGGCAGACGG + Intronic
950892013 3:16412611-16412633 AAGTGTGAACACCAGGAGGTGGG - Intronic
950954348 3:17035559-17035581 AAGTGGGAACAGGAAGCAGGTGG - Intronic
950978650 3:17277793-17277815 AAGTGGGAACAGGAGCCAGGGGG + Intronic
951464244 3:22985082-22985104 AAGCTTTAACAGGAAGAAGATGG + Intergenic
951912981 3:27770589-27770611 AAGTGTGAAATGGAGACAGAGGG + Intergenic
952002350 3:28800646-28800668 AAGGGAGAGGAGGAGGAAGAAGG - Intergenic
952004210 3:28823449-28823471 AACTTTGAACAGGAGAAAAAGGG - Intergenic
952049282 3:29363415-29363437 AAATGTGAAAAGGATGATGAAGG + Intronic
952149802 3:30577044-30577066 AAGTGAGAAGTGGAGAAAGAGGG - Intergenic
954215074 3:49120244-49120266 AAGTGTGTAAAGGAGGAAGGAGG + Intronic
955128833 3:56143105-56143127 AAGTGTGAGGAGGGGGAATATGG + Intronic
955737702 3:62057322-62057344 CAGTGTAAACTGGAGGATGAAGG - Intronic
957652921 3:83032539-83032561 AAGAGGGAAGAGGAGGGAGAAGG - Intergenic
958057965 3:88438352-88438374 AAAGGTAAACAGGAGAAAGAAGG - Intergenic
959927670 3:111941926-111941948 AGGTGGGAAAAAGAGGAAGATGG - Intronic
960396550 3:117144485-117144507 ATGAGTGAGCAGGAGGAGGAAGG + Intergenic
960444303 3:117729255-117729277 GAGTGTGAAAGGGAGGAAAAGGG - Intergenic
960535992 3:118815145-118815167 AAGAGGGAACAGGAGAGAGAAGG + Intergenic
961850585 3:129813554-129813576 AAGTGAGAACATGAGGTATATGG - Intronic
962179686 3:133192754-133192776 GAGTATGCACAGGAGGAAGCGGG + Intronic
962221612 3:133569091-133569113 ATGTGTGAACTGAAGGATGAGGG - Intergenic
962678493 3:137774239-137774261 AAGTGAGACCAGGAAGAAGCAGG - Intergenic
962821741 3:139055018-139055040 AGGTGTGCAGAGGGGGAAGACGG + Intronic
963116729 3:141736688-141736710 AAGTTTGAACTGGGGGAACATGG - Intergenic
963271166 3:143287080-143287102 AAGTGGGACCAGAAGGAAGGAGG - Intronic
963442112 3:145354231-145354253 AAGTGAGAAGAGAGGGAAGAGGG + Intergenic
963442399 3:145356484-145356506 CAGTATGAACAGCAGAAAGAGGG - Intergenic
964590647 3:158359851-158359873 GAGGGTGAACAAGATGAAGAGGG + Intronic
965024071 3:163275847-163275869 GAATGGGGACAGGAGGAAGAAGG + Intergenic
965585511 3:170314372-170314394 CAGTGTGCACAGGAGAAAGGAGG - Intergenic
967019103 3:185506906-185506928 AAATGTGAGAAGGAGGAGGAAGG + Exonic
967127942 3:186442634-186442656 AAATGTCAACAGGATGAAAAAGG - Intergenic
967775938 3:193386063-193386085 AAGTCTGAACAGTATGGAGAGGG + Intergenic
967787479 3:193513204-193513226 AACTGAGAACTGGAGGAAGTTGG - Intronic
967842648 3:194019216-194019238 AAGTGTAACCAGGAGGGTGATGG - Intergenic
968190920 3:196666507-196666529 ATGCGTGGACATGAGGAAGAAGG + Intronic
968284494 3:197500131-197500153 GAGTGAGGAGAGGAGGAAGAGGG + Intergenic
968294711 3:197567062-197567084 AAGAGAAAACAGGGGGAAGAAGG - Intronic
968725180 4:2243788-2243810 CAGTTTGGACAGGAGGAAGTGGG + Intergenic
968914350 4:3490741-3490763 AGGAATGAGCAGGAGGAAGAAGG - Intronic
968914442 4:3491156-3491178 ATGAATGAGCAGGAGGAAGAAGG - Intronic
969046506 4:4340365-4340387 AAGTGTGAACAGGATGGTGGGGG + Intergenic
969571753 4:8012901-8012923 AAGGGTGAACAGAGGGTAGATGG - Intronic
969798094 4:9541550-9541572 AAGTCAGAACAAGAGGAGGAGGG + Intergenic
971185201 4:24368840-24368862 GAGAGTGAACGGGAGGGAGATGG + Intergenic
971188075 4:24400335-24400357 AAATGTGAAAAGGAGAGAGATGG + Intergenic
971266584 4:25101226-25101248 AAGGGTGAGGAGGTGGAAGAGGG - Intergenic
971276857 4:25206548-25206570 CAGTGAGAACAAGAGAAAGATGG - Intronic
971518368 4:27516827-27516849 AAATGTGTACAGGAGGGGGAAGG + Intergenic
971806341 4:31362746-31362768 TAATGAGAAAAGGAGGAAGATGG + Intergenic
973747075 4:53974182-53974204 AAGTGAGAACAGGAGGTATTTGG + Intronic
973810671 4:54566941-54566963 AGGTGTGACCAGGAAGAACAGGG + Intergenic
974392421 4:61289329-61289351 AAGTAAGAAAAGGAGAAAGATGG - Intronic
975147062 4:70980143-70980165 GAGTGTGTACAGGGGGAAGATGG - Intronic
975546735 4:75568087-75568109 CCATGTGAAGAGGAGGAAGAGGG - Intergenic
975936077 4:79582512-79582534 TGGTGTGAAGAGGAGGAGGATGG + Intergenic
977004463 4:91547530-91547552 AAAAGTAAACAGAAGGAAGAAGG - Intronic
977104340 4:92861782-92861804 AAATGTGAACAATAGGAACAAGG - Intronic
977492231 4:97730237-97730259 AAGTGAGAACATGAGGAATTTGG + Intronic
977503556 4:97873229-97873251 AAATGTGGAAAGGAGAAAGAAGG - Intronic
978195238 4:105963995-105964017 AAGAGTTAACAGGAAGAACATGG + Intronic
978235813 4:106458533-106458555 AATTTTGAAGAGGAAGAAGAAGG + Intergenic
978386506 4:108180785-108180807 AAGAGGGAAGAGAAGGAAGAAGG + Intergenic
979532843 4:121787438-121787460 GAGTGGGAAAAGGATGAAGATGG - Intergenic
980269681 4:130567912-130567934 AAGAGAAAATAGGAGGAAGAAGG + Intergenic
980629012 4:135409951-135409973 AATTGTTAACATGGGGAAGAGGG + Intergenic
980706768 4:136507232-136507254 CCGTGTGAACAAGAGGATGATGG + Intergenic
981134559 4:141195459-141195481 AGGTGGGGAAAGGAGGAAGAGGG - Intronic
981898072 4:149828263-149828285 AAGAGTAAACAGAAGGCAGATGG - Intergenic
981965151 4:150591465-150591487 ATGTGTGAACATGTGGACGAGGG - Intronic
982420040 4:155184005-155184027 AAGCGGAGACAGGAGGAAGAAGG - Intergenic
982436734 4:155388945-155388967 AAATGTGCAGAGGAGAAAGATGG + Intergenic
983852332 4:172596471-172596493 AAGTGTGACCAAGATCAAGAAGG + Intronic
984149800 4:176113147-176113169 AAGAGTGTAAAGGAGGTAGATGG - Intronic
984524735 4:180844719-180844741 AGGGGTGAATAGGTGGAAGACGG - Intergenic
984868762 4:184308999-184309021 GAGGCTGAAGAGGAGGAAGAGGG + Intergenic
984949282 4:184994737-184994759 AGGTGTGGAGAGGAAGAAGACGG + Intergenic
985026481 4:185744045-185744067 AAGGGGGAGAAGGAGGAAGAAGG - Intronic
985280312 4:188280014-188280036 AAGTCTGGGCAGGAGGAAGCGGG + Intergenic
985919872 5:2961950-2961972 ATGGTTGAACAGGAGGATGAAGG + Intergenic
986026207 5:3853776-3853798 AAATGTGAAAAAGAGGAAGAAGG + Intergenic
986027264 5:3862961-3862983 AAATGTGTACAGGATGAAGAGGG + Intergenic
986083857 5:4422926-4422948 TAGTGTGAACTAGAGGAAAATGG - Intergenic
986262761 5:6162896-6162918 AAGTGTGAACAGGCTGGAGTTGG - Intergenic
986599670 5:9459226-9459248 GAGTGTGAACAGGAGGAAGCAGG - Intronic
986796926 5:11221831-11221853 AAGTGTCACCAGGAGGAGAAAGG + Intronic
987108418 5:14663305-14663327 AAATGTGCACAGAGGGAAGAAGG - Intergenic
987246504 5:16054382-16054404 AAGGGGGAACAAAAGGAAGAAGG + Intergenic
987370288 5:17186761-17186783 AAATGTGAAAAGGGGGAAGCCGG - Intronic
987589477 5:19904823-19904845 TTGTGGGAACAGGAGGAGGAAGG + Intronic
988925608 5:35988663-35988685 AAATGTGAACAGTGAGAAGATGG + Intronic
990231286 5:53715853-53715875 GAGAGTGAACAGAAGCAAGATGG + Intergenic
991510061 5:67366131-67366153 GAGTGAGAAGAGGAGTAAGAAGG + Intergenic
991926297 5:71708390-71708412 GGGTGTGAATAGGAGGAAGCAGG - Intergenic
993442794 5:87977637-87977659 TAGTGGGAGCAGGAGGAAGGGGG - Intergenic
994171019 5:96660197-96660219 AGGTGTGAACAGAAGGAGAAGGG - Intronic
994269276 5:97757982-97758004 AGGTGTGTACAGGAGGAAGATGG - Intergenic
994343539 5:98660491-98660513 AAATGTGATCAAGAGGAAGGTGG + Intergenic
995566955 5:113440755-113440777 AAGAAAGAAGAGGAGGAAGAAGG + Intronic
995686796 5:114780598-114780620 GAGGGTGTACAGGAGAAAGAGGG - Intergenic
996060839 5:119031625-119031647 AAGAATGAACAGGAGGATGTGGG - Intergenic
996225252 5:120985202-120985224 AAATGAGAACAAGAGGAAGGTGG + Intergenic
996985149 5:129552992-129553014 GAGAGTCAACAGTAGGAAGATGG - Intronic
997496036 5:134327042-134327064 AACTGGGAGCTGGAGGAAGAGGG - Intronic
997509946 5:134447186-134447208 AAGAAAGAACAGGAGGAGGAGGG + Intergenic
997530099 5:134576733-134576755 AAGTGAGAGGAGGAGGGAGATGG - Intronic
997721683 5:136082871-136082893 AAGAGTGAACAGGATGGAAAGGG - Intergenic
998171237 5:139873033-139873055 AAGTGAGAGGAGGAGGAGGAGGG + Intronic
998543778 5:143008052-143008074 AAGTGGGAAGAGAAGGAAGGAGG + Intronic
998565575 5:143213326-143213348 GAGTGTGGGGAGGAGGAAGAAGG - Intronic
998684519 5:144508551-144508573 AAGAGAGAGCAGGAGAAAGAGGG + Intergenic
999545273 5:152622500-152622522 AAGGGTGACCAGGATGATGATGG - Intergenic
999684364 5:154089030-154089052 GGGTGTGAACTGGAGGAAGGGGG + Intronic
999796129 5:154991358-154991380 AAGTGTAAACTCTAGGAAGAGGG + Intergenic
1000216596 5:159163460-159163482 AAGTGGAAACAGTGGGAAGAGGG - Intronic
1000444181 5:161299644-161299666 AAGGAGGAAGAGGAGGAAGAGGG - Intronic
1000821740 5:165993309-165993331 AAGAGTGGCCAGGAGGAAGGAGG - Intergenic
1000927928 5:167216308-167216330 AAGGATCACCAGGAGGAAGAAGG + Intergenic
1001132964 5:169079742-169079764 AGGAGAGAAGAGGAGGAAGAGGG + Intronic
1001264989 5:170267711-170267733 AAGTGTGAACAAGATAAATAAGG - Intronic
1001848740 5:174944145-174944167 AGGTGAGAACAGAAAGAAGAGGG + Intergenic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1003173456 6:3737865-3737887 AGGTGTAATCAGGAGAAAGAAGG - Intronic
1006385536 6:33728765-33728787 AAGGGTGCTCAGGAGGCAGAGGG - Intronic
1007040701 6:38719467-38719489 AAGTGTGAACATGAGGTATTTGG + Intronic
1007386615 6:41524368-41524390 AGGAGTGAAAAGGGGGAAGAGGG + Intergenic
1007779421 6:44244234-44244256 AAGTGTGAACCATAGGAGGATGG - Intergenic
1007978869 6:46130090-46130112 AAGGGGGACCTGGAGGAAGAGGG - Exonic
1008048339 6:46874336-46874358 AAGAATCAGCAGGAGGAAGAGGG - Intronic
1008484563 6:52021738-52021760 AAGAGGGAAGAGGAAGAAGAAGG - Intronic
1008493395 6:52108694-52108716 AAATGTAAAGAGGAGGAAAAGGG + Intergenic
1009783690 6:68302736-68302758 AAGTGTCCACAGGAGAAAGTGGG - Intergenic
1009956456 6:70460722-70460744 TAGTGTGACCAAGAGCAAGAAGG + Intronic
1010094335 6:72022333-72022355 AAGTTTGAACAAGGGGAACAGGG - Intronic
1010389279 6:75319069-75319091 GAGGATGAAGAGGAGGAAGAAGG - Intronic
1010585819 6:77657885-77657907 TAGTGTGAACAGGAGGAGGAGGG - Intergenic
1010758441 6:79694291-79694313 ACGTGGTAAGAGGAGGAAGAGGG - Intronic
1010971776 6:82270546-82270568 AAGTGAGAAGAGTTGGAAGAGGG + Intergenic
1011519928 6:88194310-88194332 ATTTGTGAAGAGGAGTAAGAAGG + Intergenic
1011733260 6:90287964-90287986 AAGTGAGCACAGAAGGAGGATGG + Intronic
1011859489 6:91737369-91737391 AAGGGTGATAAGGATGAAGACGG - Intergenic
1013272811 6:108559442-108559464 AAGTGGGGAGAGGAGGGAGAAGG - Intergenic
1013815001 6:114087150-114087172 AAGGGTGAATTGGAGGAAGAGGG - Intronic
1014294952 6:119606688-119606710 AAGTCTGACAATGAGGAAGATGG + Intergenic
1014510982 6:122322006-122322028 AAGTAGGAGTAGGAGGAAGAAGG + Intergenic
1015229868 6:130902197-130902219 AAGTGTCCACAGGACTAAGATGG - Intronic
1015528810 6:134200248-134200270 AAGTGTGAGCAGTAAGATGACGG + Intronic
1017071068 6:150576039-150576061 CAGTGTCTACACGAGGAAGATGG + Intergenic
1017276437 6:152574479-152574501 AAGTGAGAGCAAGAGGAGGAAGG - Intronic
1017592142 6:155989463-155989485 TGGTGTGAACCAGAGGAAGAGGG - Intergenic
1018038092 6:159898710-159898732 AAGAGGGAGGAGGAGGAAGAGGG - Intergenic
1018425334 6:163674882-163674904 CAGAGTGAAGAGGGGGAAGATGG + Intergenic
1018571221 6:165212060-165212082 AAATGGCAAGAGGAGGAAGATGG - Intergenic
1018908878 6:168090506-168090528 CAGTGAGAACAGGGAGAAGATGG - Intergenic
1019903307 7:4041585-4041607 AGGGGTGAACAGGAGGAGCATGG - Intronic
1020787359 7:12589096-12589118 AAGTGCTAAATGGAGGAAGAGGG + Intronic
1020850708 7:13348887-13348909 AAGTGGTAAAAGAAGGAAGAGGG + Intergenic
1020917464 7:14213984-14214006 AAGAGAGAAAAAGAGGAAGAAGG - Intronic
1021205299 7:17772838-17772860 AGGTCTGAACAGCTGGAAGAAGG + Intergenic
1021623640 7:22571992-22572014 ATGTGGGCCCAGGAGGAAGAAGG + Intronic
1022093559 7:27123881-27123903 AAGTTTGAACAAGAGAAAGGGGG - Intronic
1022552969 7:31259285-31259307 AAGTTTTAAAAGGAGGAAGCAGG - Intergenic
1022560344 7:31341937-31341959 AAGAGAAAACAGGAGGAAGGTGG - Intergenic
1022801060 7:33777743-33777765 AAGTGTGAAAGGGAGGGAGTGGG - Intergenic
1023229604 7:38012815-38012837 AAGGGTGAAGAGTGGGAAGAGGG - Intronic
1023728453 7:43167614-43167636 ATGTGTGTTCAGGAGGAATAAGG + Intronic
1023878724 7:44306865-44306887 AGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1023878754 7:44306982-44307004 GGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023878757 7:44307002-44307024 GGGTGTGAGCAGGAAGAAGAGGG + Intronic
1024204529 7:47145640-47145662 AAGTAGGAAAAGGAGGAAAAAGG + Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024944935 7:54799038-54799060 AAGTGAGATGAGGAGGAAGGAGG + Intergenic
1025871554 7:65439118-65439140 AAGAGGGAACAGTATGAAGAGGG - Intergenic
1026489149 7:70847843-70847865 CAGTATGAACAGCAGAAAGAGGG + Intergenic
1026519066 7:71099966-71099988 AACTTTGAACAAGAGGAAGAAGG + Intergenic
1026849132 7:73714060-73714082 ATGGGAGAAGAGGAGGAAGATGG - Intronic
1026944481 7:74307056-74307078 AATAGTGAACAGGAAGAAGGGGG - Intronic
1027542966 7:79491731-79491753 CAGTGTGAAGACAAGGAAGATGG - Intergenic
1028354156 7:89886248-89886270 AAGTGAGAACAGGAGGTATTTGG + Intergenic
1029584780 7:101463519-101463541 AAGGGGGAAGAGGGGGAAGAGGG - Intronic
1030560847 7:111083981-111084003 AAGAGTGAACAGTAAGAAGTAGG + Intronic
1031187368 7:118500088-118500110 AGGTGTGGACAGGAGGGAGGTGG - Intergenic
1031828609 7:126598524-126598546 AAGTGAGGACATTAGGAAGAAGG - Intronic
1031968831 7:128048915-128048937 CCGTGTGAACAGCTGGAAGAAGG - Intronic
1032190034 7:129759596-129759618 TAGTGAGGAAAGGAGGAAGAAGG + Intergenic
1032429117 7:131846550-131846572 GAGTAGGAACAGCAGGAAGATGG + Intergenic
1032472725 7:132190106-132190128 AGATGGGAACAGGAGGGAGAAGG - Intronic
1032492066 7:132331223-132331245 AGCTGAGAGCAGGAGGAAGATGG + Intronic
1032739793 7:134727568-134727590 TAGCTTGAACAGGAGGAACAAGG + Intergenic
1033124745 7:138697810-138697832 AAGAGAGAAGAGAAGGAAGAAGG + Intronic
1034468510 7:151243682-151243704 CAGTGCCAAGAGGAGGAAGATGG - Exonic
1034955739 7:155333336-155333358 GAGTGAGAACACGGGGAAGAAGG + Intergenic
1035796263 8:2360004-2360026 AAATGTGGGCAGCAGGAAGAGGG + Intergenic
1036516706 8:9450989-9451011 AACCGTGTCCAGGAGGAAGAGGG + Intergenic
1036806924 8:11841407-11841429 GGGTGTGTATAGGAGGAAGAGGG + Intergenic
1037041683 8:14244198-14244220 AAGAAGGAAGAGGAGGAAGAAGG - Intronic
1039088763 8:33806028-33806050 GAGTGGGACAAGGAGGAAGAGGG - Intergenic
1039364436 8:36915632-36915654 CAGTGTGAACAGGGTGAAGGAGG - Intronic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039595129 8:38785059-38785081 AAGTGTCTACAGGGGGAAGCAGG - Intronic
1040520593 8:48172961-48172983 GAGGGTGGACAGGAGGAAGAGGG - Intergenic
1041793448 8:61721973-61721995 GAGTGGGGACAGGAGGAAGGAGG - Intergenic
1042439503 8:68809700-68809722 AAGTCTGAAGTGGAGGAAAAAGG - Intronic
1042743596 8:72077777-72077799 AAATGTAAACAGGAACAAGATGG + Intronic
1042855352 8:73261435-73261457 AAGAGGGAAAAGGAGGAACAGGG + Intergenic
1043084455 8:75810922-75810944 AAATATGAAGAGGAAGAAGAAGG - Intergenic
1043352959 8:79382755-79382777 ATGTTTGAAGAGGAGGAAGGAGG - Intergenic
1043795529 8:84533750-84533772 AAGTGGGAACATGATGAATAGGG + Intronic
1044847775 8:96398882-96398904 GAGAGTGAAAAGGAGGAGGAGGG - Intergenic
1045210866 8:100098178-100098200 GATTGTGAACTGGAGGAAAAGGG + Intronic
1045458166 8:102402584-102402606 AAGTGAGAAGTGGAGGAAGATGG - Intronic
1046184472 8:110694611-110694633 AAGTATGAAAAGGAGGAAGAAGG + Intergenic
1046957897 8:120080670-120080692 AAGTGTGAAGAAGAGAAAGAGGG + Intronic
1047682072 8:127264510-127264532 TGGTGGGAGCAGGAGGAAGAGGG + Intergenic
1047717592 8:127609993-127610015 AAGGGTGGTCAGGAGGGAGAAGG - Intergenic
1047724856 8:127675115-127675137 AAGTGTGAACACCAGGAGGGAGG + Intergenic
1047946557 8:129886749-129886771 AAGTGTGTTGAGGAGGATGAGGG - Intronic
1047953185 8:129952627-129952649 GAGTGTGAACAGGAGAAATATGG + Intronic
1048067504 8:130985031-130985053 AAGTGTTTGGAGGAGGAAGAGGG + Intronic
1048176081 8:132154011-132154033 AAGAGAGGACAGGAGGAAAAAGG - Intronic
1048357780 8:133667581-133667603 GAGTGGGAGGAGGAGGAAGAGGG - Intergenic
1048577378 8:135703825-135703847 AAGTGTGAACAGGAGAGATGAGG - Intergenic
1048840430 8:138561136-138561158 AGGTGTGAAGAGGAGAGAGAAGG - Intergenic
1050191255 9:3029007-3029029 AACTGTGAACCAAAGGAAGAAGG + Intergenic
1050206723 9:3204353-3204375 AAGTGGGGAAAGGAGAAAGAAGG - Intergenic
1050648939 9:7754397-7754419 CACTGTGCCCAGGAGGAAGAAGG + Intergenic
1050712601 9:8482746-8482768 AAGTGGCAAGAGAAGGAAGAAGG - Intronic
1050772383 9:9218326-9218348 AAGTGTGACAGGGAGAAAGAAGG - Intronic
1050803642 9:9646617-9646639 TAGTATAAAGAGGAGGAAGAAGG - Intronic
1051443709 9:17116830-17116852 ACGTGAGAGCAAGAGGAAGAGGG - Intergenic
1051447811 9:17159668-17159690 AACTGGGAACAGGAGGAAGAGGG + Intronic
1051500217 9:17768584-17768606 CAGAGTGAACAAGAGGGAGAAGG - Intronic
1051937993 9:22467587-22467609 AAATGAGAAGAGGAGAAAGAAGG + Intergenic
1052287402 9:26802039-26802061 AACCGGGAACAGGAGGAATAAGG + Intergenic
1052432984 9:28391567-28391589 AATTGTGAAAAGAAGGAAAAAGG - Intronic
1052513167 9:29447471-29447493 GAGTGAGAACAGGAAGAAGAGGG + Intergenic
1052938080 9:34110107-34110129 GAGTGGGAGCAGGGGGAAGAAGG + Intronic
1053049323 9:34945676-34945698 AAGTGAGTACAGGAGACAGAGGG - Intergenic
1053477943 9:38395696-38395718 CAGGGTGAACAGGTGGGAGAAGG - Intronic
1053676604 9:40436730-40436752 AAGTGTCCACAGGAGAAAGCAGG - Intergenic
1053719979 9:40935648-40935670 AGGTGTGAACGGGAGGCAGGAGG + Intergenic
1053730060 9:41044918-41044940 AAGTGGGAGCAGGAGTAACAGGG - Intergenic
1053926371 9:43062843-43062865 AAGTGTCCACAGGAGAAAGCAGG - Intergenic
1053946356 9:43312877-43312899 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1054287116 9:63188168-63188190 AAGTGTCCACAGGAGAAAGCAGG + Intergenic
1054289673 9:63272248-63272270 AAGTGTCCACAGGAGAAAGCAGG - Intergenic
1054387701 9:64576798-64576820 AAGTGTCCACAGGAGAAAGCAGG - Intergenic
1054408031 9:64778908-64778930 AAGTAGGAGGAGGAGGAAGAGGG + Intergenic
1054508017 9:65939564-65939586 AAGTGTCCACAGGAGAAAGCAGG + Intergenic
1054698437 9:68387148-68387170 AAGTGGGAGCAGGAGTAACAGGG + Intronic
1055218194 9:73893752-73893774 AAGTGTAAAACGGAGAAAGATGG + Intergenic
1055961444 9:81824370-81824392 AAGTGTGAACTGGAGTATGCTGG + Intergenic
1057022185 9:91707843-91707865 CAGTGTGGACAGGAGGATGGGGG + Intronic
1057167273 9:92938889-92938911 ATGAGTGAGCAAGAGGAAGAAGG - Intergenic
1057321046 9:94013099-94013121 AAGAGTGAGCAAGAGGGAGAAGG - Intergenic
1057825835 9:98371463-98371485 AAATGTGAAAATGAAGAAGAAGG - Exonic
1057923643 9:99122125-99122147 AGCTCTGAACTGGAGGAAGATGG + Intronic
1058205240 9:102097420-102097442 AGGGGTGTACAGGAGGATGATGG + Intergenic
1058337408 9:103848373-103848395 AAGTGTGAACACCAGGAGGTGGG - Intergenic
1058906122 9:109484028-109484050 CAGAGTGAAGAGGAGGAAGTTGG - Intronic
1059140283 9:111846826-111846848 AAGTGTGAGAAGGAAAAAGAAGG + Intergenic
1059732772 9:117073407-117073429 GAGGGTGGACAGTAGGAAGAGGG - Intronic
1061074452 9:128332651-128332673 AAGAGTGAACAGAAGGGAGTAGG - Intronic
1061231263 9:129317180-129317202 AAGTGTGCAGAGAAGGAACAAGG - Intergenic
1061777644 9:132976349-132976371 AAGTGAGAACATGAGGAAACTGG + Intronic
1062054327 9:134463184-134463206 AAGTTTGAAAAGGAGAAAGGAGG + Intergenic
1062074738 9:134579769-134579791 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074755 9:134579811-134579833 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074773 9:134579854-134579876 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062101415 9:134730553-134730575 AGGTGAGAACTGGAGTAAGAAGG - Intronic
1203589486 Un_KI270747v1:41435-41457 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1186047145 X:5548779-5548801 ATGGATGAAGAGGAGGAAGAAGG - Intergenic
1186732510 X:12425208-12425230 AAGACTAAACAGGAGGAAGGTGG - Intronic
1187007614 X:15247870-15247892 CAGTGAGAGTAGGAGGAAGAAGG + Intronic
1187030186 X:15478777-15478799 AAGTGTGAGCAGAAGGCAGAGGG - Intronic
1187238629 X:17492248-17492270 AAATGTGCACAGGAGAAAGGAGG - Intronic
1187356192 X:18574079-18574101 CAGTGTGAGAAGGAGGAAAATGG - Intronic
1187377118 X:18764980-18765002 AAGATTGAACAGGAGGAGGTGGG + Intronic
1187675319 X:21710735-21710757 AACTGTGAAGAGGGGGAAGCTGG + Intronic
1188988232 X:36787135-36787157 AAATTTGAACAGGAAAAAGAGGG + Intergenic
1188999976 X:36933552-36933574 GAGTGAAAACAGGAGGAAAAAGG - Intergenic
1189243011 X:39540329-39540351 AAGTGGGAAGAGGAAGAAGCTGG + Intergenic
1189510726 X:41658620-41658642 CAGTGTGAAGAGGTGGGAGAGGG + Intronic
1190070723 X:47277080-47277102 GAGTGAGAAAAGCAGGAAGAAGG + Intergenic
1190446728 X:50533216-50533238 AAGAGTGTACAGGAAAAAGAGGG + Intergenic
1191006218 X:55714100-55714122 AAGAGGAAAAAGGAGGAAGAGGG - Intergenic
1191044244 X:56119241-56119263 AAGTGGGAAAAGGAGGAAGAGGG + Intergenic
1191055571 X:56236453-56236475 AAATGAGAAAATGAGGAAGAGGG - Intronic
1191612674 X:63133818-63133840 AAGAAAAAACAGGAGGAAGAAGG + Intergenic
1191623623 X:63245108-63245130 AAGAAAAAACAGGAGGAAGAAGG - Intergenic
1193005397 X:76612797-76612819 AAGGGTAAAGGGGAGGAAGACGG + Intergenic
1193618813 X:83725497-83725519 AAGTGTGAAAACGTGAAAGAAGG + Intergenic
1194411282 X:93561746-93561768 GAGTGGGAAAAAGAGGAAGAAGG - Intergenic
1194456987 X:94116775-94116797 AAGAGTGAAGAGGAAGAAAATGG + Intergenic
1194846552 X:98816484-98816506 AAGTGGGAACAGGAAAGAGAGGG + Intergenic
1194957148 X:100194379-100194401 CAGTATGAACAGGTGCAAGAAGG - Intergenic
1195403705 X:104489813-104489835 AACAGAGAACAGGATGAAGAAGG + Intergenic
1195964091 X:110414396-110414418 AAGGGTGAAGTGGAGGAAAAAGG + Intronic
1196299152 X:114035090-114035112 AAATGTTAACAGGAGGAAAAGGG + Intergenic
1197168295 X:123403522-123403544 AAGTGTGAACAGAAGGTAGGTGG + Intronic
1197730368 X:129804695-129804717 TAGTGTGAACAGGATCAGGAAGG - Exonic
1198269472 X:135041701-135041723 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1198806346 X:140499251-140499273 CAGTGAGAACAGGTAGAAGAAGG + Intergenic
1199001758 X:142647234-142647256 ATGTGTGTACAGCAGGGAGAAGG - Intergenic
1199737446 X:150696883-150696905 AAGTGGGAGCAGGTGGAGGAAGG + Intronic
1199807616 X:151316078-151316100 AATGGTGAACAGGAGGTAGGAGG - Intergenic
1199991398 X:152989577-152989599 AAGGAGGAGCAGGAGGAAGAGGG - Exonic
1200838072 Y:7752475-7752497 AAGTGTGAACACCAGGAGGTAGG - Intergenic
1202081627 Y:21089629-21089651 AATTGTTAACATGGGGAAGAGGG - Intergenic