ID: 1120967367

View in Genome Browser
Species Human (GRCh38)
Location 14:90179606-90179628
Sequence GGCGAATGAGATTGGCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120967367_1120967374 15 Left 1120967367 14:90179606-90179628 CCTCCAAGCCAATCTCATTCGCC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1120967374 14:90179644-90179666 ACTCATCAGCTCCCAGACTCGGG 0: 1
1: 0
2: 1
3: 12
4: 220
1120967367_1120967373 14 Left 1120967367 14:90179606-90179628 CCTCCAAGCCAATCTCATTCGCC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1120967373 14:90179643-90179665 CACTCATCAGCTCCCAGACTCGG 0: 1
1: 0
2: 6
3: 375
4: 2497

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120967367 Original CRISPR GGCGAATGAGATTGGCTTGG AGG (reversed) Intronic
900436038 1:2631804-2631826 TCCGACTGAGATGGGCTTGGAGG - Intronic
900886357 1:5418229-5418251 GGTGAACGGGATTGGCTGGGAGG + Intergenic
901508721 1:9703290-9703312 GGCCATGGGGATTGGCTTGGAGG - Intronic
902630674 1:17702708-17702730 GGGGACTGAGATAGGGTTGGGGG - Intergenic
908706962 1:66968176-66968198 GCAGAATGAGATTGCTTTGGAGG + Intronic
910354890 1:86342525-86342547 GGCCTATGAGAGTTGCTTGGGGG - Intergenic
911151419 1:94600015-94600037 GGCATTTGAGCTTGGCTTGGAGG + Intergenic
915954363 1:160210144-160210166 GGGAACTGAGATTGGCATGGTGG - Intronic
917453328 1:175165471-175165493 GGCAATAGGGATTGGCTTGGAGG - Intronic
1070781412 10:79139580-79139602 GGCCGCTGAGATTAGCTTGGCGG + Intronic
1072014088 10:91328654-91328676 AGGGAATGAGATTTCCTTGGGGG + Intergenic
1072574572 10:96688195-96688217 GGGGAATGACATTGGCTGGGAGG - Intronic
1073195239 10:101685046-101685068 CGTGGAAGAGATTGGCTTGGTGG - Intronic
1092049955 12:5461569-5461591 GGAGATGGGGATTGGCTTGGGGG - Intronic
1095693469 12:45117520-45117542 GAGGAATGAGATTGGATTGGAGG - Intergenic
1101356198 12:103979620-103979642 GGGGAAGGAGAGTGGCATGGGGG + Intronic
1101725707 12:107386540-107386562 GGATAATGACATTGGCCTGGAGG + Intronic
1105489418 13:20873214-20873236 GGCAACTGAGCTGGGCTTGGAGG - Intronic
1108597111 13:51959101-51959123 GGGGAATGAGATTGGGCGGGAGG + Intronic
1113000227 13:105627108-105627130 GGCTAATTATATTGGTTTGGAGG + Intergenic
1118126433 14:62909628-62909650 GGTGATTGAGACTGACTTGGTGG - Intronic
1120967367 14:90179606-90179628 GGCGAATGAGATTGGCTTGGAGG - Intronic
1121690160 14:95872481-95872503 GGTGTATGATATTGGGTTGGGGG - Intergenic
1129626372 15:77204588-77204610 GCCCAAGGAGATTGGCCTGGTGG + Intronic
1135408845 16:22218122-22218144 GGCCACAGAGATTGGCTTAGAGG - Intronic
1135824459 16:25714261-25714283 GGCGAATGAGGTTGGCAGTGCGG - Intronic
1138929980 16:61641547-61641569 GGTGAATTACATTGGCATGGAGG + Intergenic
1140559817 16:75965987-75966009 GGAGAATGAGATGTCCTTGGGGG - Intergenic
1142887905 17:2924623-2924645 AGCGAATGAGATGGGGCTGGTGG + Intronic
1143815768 17:9513211-9513233 GGCAAATGAGCTAGGCATGGTGG + Intronic
1143830746 17:9648543-9648565 GGAAAATGTGATTGGATTGGGGG + Intronic
1146782452 17:35687045-35687067 GGTGAACGAAATTGGCTTTGTGG - Intronic
1147369824 17:39984693-39984715 GGGAAATGAGTTTGGCTGGGAGG - Intronic
1150336868 17:64336703-64336725 GGCGAATTAGCTGGGCATGGTGG + Intronic
1151408306 17:73903577-73903599 GGTGAATGAATTTTGCTTGGAGG + Intergenic
1151462451 17:74262609-74262631 CCCAAATGAGATTGGCTTTGGGG + Intergenic
1165809169 19:38600325-38600347 GGAGAGTGAGACTGGCTTGCGGG - Intronic
1167006439 19:46779073-46779095 AGAGCATGAGATTGGCATGGGGG - Intronic
929202679 2:39253733-39253755 CATGACTGAGATTGGCTTGGGGG + Intronic
930188858 2:48437530-48437552 GGGGAATGAGATGGGCTTTAAGG - Intergenic
932620028 2:73259744-73259766 GGCGACTGAGAAGGGCCTGGAGG + Intronic
939130820 2:138234010-138234032 GGGGATTGAGATTGACTTGCTGG + Intergenic
939620529 2:144413520-144413542 GGAGAAAGAGATAGGTTTGGAGG - Intronic
942365558 2:175222610-175222632 GGCCACTGTGATTGGCTTGAAGG + Intergenic
942942011 2:181630188-181630210 GGGGAATTAGCTGGGCTTGGTGG - Intronic
944938790 2:204599481-204599503 GGCAAAAGAGATTGAATTGGAGG - Intronic
945072742 2:206007497-206007519 GTTGAATGAACTTGGCTTGGTGG - Intronic
947482704 2:230516153-230516175 AGGGATTGAGATTGGCTTTGTGG - Intronic
1169308362 20:4514491-4514513 GGCCAAGGAGATGGGTTTGGGGG - Intergenic
1170954075 20:20962431-20962453 GGGGGATCAGAGTGGCTTGGGGG + Intergenic
1173386620 20:42594240-42594262 GGCAAATGAGATTTGCATGGAGG - Intronic
1173620160 20:44430330-44430352 GGAGGATGAGGTTGGGTTGGAGG - Exonic
1176287754 21:5027730-5027752 GGCTACTGGGACTGGCTTGGGGG + Intronic
1178783700 21:35632652-35632674 TGAGAATGAGGTTTGCTTGGGGG + Intronic
1179294931 21:40053302-40053324 GGCGCCTGGGCTTGGCTTGGAGG + Intronic
1179869427 21:44235745-44235767 GGCTACTGGGACTGGCTTGGGGG - Intronic
1180155823 21:45977089-45977111 GGAGCATGAGGTGGGCTTGGTGG - Intergenic
1184050271 22:41998921-41998943 GACGAATGAGATAGACATGGCGG + Intronic
1184720486 22:46309662-46309684 GGCTCAGGAGATGGGCTTGGTGG - Intronic
954411964 3:50374755-50374777 GGTCACTGAGATTGGCTTGGAGG + Exonic
955024863 3:55157551-55157573 GGAGAAGGAGACTGTCTTGGTGG + Intergenic
960130469 3:114050651-114050673 GGGGAAGGAGACTGGCTTGACGG + Intronic
960495518 3:118368797-118368819 TCCGAATGAGATTGGGGTGGGGG + Intergenic
963565980 3:146931526-146931548 GAAGAATGAGTTTGGATTGGGGG + Intergenic
964042779 3:152283205-152283227 GGGGAATGAGCTTTACTTGGTGG + Intronic
965737079 3:171832168-171832190 CGTGAATGAAATTTGCTTGGAGG + Intergenic
969334534 4:6499886-6499908 GAGGAAGGAGAGTGGCTTGGTGG - Intronic
986814713 5:11396025-11396047 GGTGAAAGAGATGGGCTCGGGGG + Intronic
987622927 5:20359216-20359238 GGCCAATAAGATGGGCATGGTGG - Intronic
989030151 5:37110558-37110580 GGAGAATGAGGCTGGCTAGGTGG - Intronic
991224552 5:64254986-64255008 GGAGAATGTGATTTGCTTGTGGG - Intronic
992708270 5:79420801-79420823 GGTGAATAAGATTGCCTTCGAGG - Intronic
993016187 5:82536948-82536970 GGCGATGGAGATTGGGCTGGTGG + Intergenic
997368513 5:133341056-133341078 TGCGAATGAGAGTGGGCTGGCGG - Intronic
998640251 5:144002236-144002258 GGCAAAAGAGAGAGGCTTGGAGG - Intergenic
999343326 5:150792685-150792707 TGCTAATTAGATTGGCATGGTGG - Intronic
999391935 5:151199552-151199574 GGACAATGAGAATGGCTGGGAGG - Intronic
1002491109 5:179578044-179578066 GAGGAATGAGATTGACATGGAGG - Intronic
1016580735 6:145627282-145627304 GGTGAAAGTGGTTGGCTTGGGGG + Exonic
1017280405 6:152617877-152617899 TGAGACTGAGATTGGCTTGAAGG + Intronic
1021585506 7:22203286-22203308 GGCGAGTGAGATTTGCGGGGAGG - Intronic
1024943008 7:54781675-54781697 AGTGAATGAGAGTGGATTGGAGG + Intergenic
1031003738 7:116448145-116448167 GGTGAAAGGGTTTGGCTTGGAGG - Intronic
1034453295 7:151149444-151149466 TGCGAATGAGATGGGGGTGGTGG - Intronic
1040850765 8:51898840-51898862 GGCGACTGGGATGCGCTTGGAGG - Intronic
1042059682 8:64803051-64803073 AATGAATGAGATGGGCTTGGTGG + Intergenic
1042158157 8:65866323-65866345 GGCCTATGAGAGTTGCTTGGGGG - Intergenic
1042395423 8:68286161-68286183 GGCGAATGAGAGTGGCCAGTGGG - Intergenic
1042797578 8:72681148-72681170 ATTGAATGAGTTTGGCTTGGGGG + Intronic
1043467910 8:80531337-80531359 GGCGAATGACTTGGGCTTGAGGG - Intergenic
1044790104 8:95838461-95838483 GTCAAATGAGACTGGCATGGAGG - Intergenic
1049288725 8:141790634-141790656 GGCCAATGAGACAGGCCTGGTGG + Intergenic
1053226021 9:36358362-36358384 TGGGAATAAGATTGGCTAGGCGG - Intronic
1059217415 9:112577944-112577966 GGAGGATTAGTTTGGCTTGGAGG + Intronic
1059506434 9:114803654-114803676 GGTCAATGGGATTGGATTGGAGG + Intronic
1062218938 9:135403982-135404004 GGGGATTGACATTGGCTTTGAGG + Intergenic
1062732528 9:138118097-138118119 GGCTAGTGAGACTGGGTTGGGGG + Intronic
1186023755 X:5285960-5285982 GGCAAATCAGATTGACTTTGGGG - Intergenic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic
1189806334 X:44738996-44739018 TGCAAATGAGTTGGGCTTGGTGG - Intergenic
1197227140 X:123965461-123965483 AGTGAATGGGATGGGCTTGGGGG + Intronic
1198126804 X:133652979-133653001 GGAGAATGTGAATGGCTTGGTGG - Intronic
1198929928 X:141844309-141844331 GGCGTATGAGTTTAGCTTGGTGG + Intronic