ID: 1120969858

View in Genome Browser
Species Human (GRCh38)
Location 14:90198245-90198267
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120969858_1120969864 28 Left 1120969858 14:90198245-90198267 CCCACATAATAGGAGGCCTCCAG No data
Right 1120969864 14:90198296-90198318 TATTGAGACCTACTATGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120969858 Original CRISPR CTGGAGGCCTCCTATTATGT GGG (reversed) Intergenic
No off target data available for this crispr