ID: 1120970010

View in Genome Browser
Species Human (GRCh38)
Location 14:90199350-90199372
Sequence TAGCATACTACTGTTAGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120970010_1120970015 28 Left 1120970010 14:90199350-90199372 CCACCACTAACAGTAGTATGCTA No data
Right 1120970015 14:90199401-90199423 ATGCTCAAAGCAATCCTAAAGGG No data
1120970010_1120970014 27 Left 1120970010 14:90199350-90199372 CCACCACTAACAGTAGTATGCTA No data
Right 1120970014 14:90199400-90199422 AATGCTCAAAGCAATCCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120970010 Original CRISPR TAGCATACTACTGTTAGTGG TGG (reversed) Intergenic
No off target data available for this crispr