ID: 1120970014

View in Genome Browser
Species Human (GRCh38)
Location 14:90199400-90199422
Sequence AATGCTCAAAGCAATCCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120970010_1120970014 27 Left 1120970010 14:90199350-90199372 CCACCACTAACAGTAGTATGCTA No data
Right 1120970014 14:90199400-90199422 AATGCTCAAAGCAATCCTAAAGG No data
1120970012_1120970014 2 Left 1120970012 14:90199375-90199397 CCCTTTTGTATATTTTATTTCGC No data
Right 1120970014 14:90199400-90199422 AATGCTCAAAGCAATCCTAAAGG No data
1120970013_1120970014 1 Left 1120970013 14:90199376-90199398 CCTTTTGTATATTTTATTTCGCT No data
Right 1120970014 14:90199400-90199422 AATGCTCAAAGCAATCCTAAAGG No data
1120970011_1120970014 24 Left 1120970011 14:90199353-90199375 CCACTAACAGTAGTATGCTAAAC No data
Right 1120970014 14:90199400-90199422 AATGCTCAAAGCAATCCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120970014 Original CRISPR AATGCTCAAAGCAATCCTAA AGG Intergenic
No off target data available for this crispr