ID: 1120974528

View in Genome Browser
Species Human (GRCh38)
Location 14:90237085-90237107
Sequence CTGGGGGGTGGAGGTGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120974528_1120974547 15 Left 1120974528 14:90237085-90237107 CCCCCACCACCTCCACCCCCCAG No data
Right 1120974547 14:90237123-90237145 AGAAGCTTCCTGCTTACTGTGGG No data
1120974528_1120974539 -9 Left 1120974528 14:90237085-90237107 CCCCCACCACCTCCACCCCCCAG No data
Right 1120974539 14:90237099-90237121 ACCCCCCAGGCAGTCAGGGGAGG No data
1120974528_1120974541 -8 Left 1120974528 14:90237085-90237107 CCCCCACCACCTCCACCCCCCAG No data
Right 1120974541 14:90237100-90237122 CCCCCCAGGCAGTCAGGGGAGGG No data
1120974528_1120974546 14 Left 1120974528 14:90237085-90237107 CCCCCACCACCTCCACCCCCCAG No data
Right 1120974546 14:90237122-90237144 GAGAAGCTTCCTGCTTACTGTGG No data
1120974528_1120974548 18 Left 1120974528 14:90237085-90237107 CCCCCACCACCTCCACCCCCCAG No data
Right 1120974548 14:90237126-90237148 AGCTTCCTGCTTACTGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120974528 Original CRISPR CTGGGGGGTGGAGGTGGTGG GGG (reversed) Intergenic
No off target data available for this crispr