ID: 1120977269

View in Genome Browser
Species Human (GRCh38)
Location 14:90260018-90260040
Sequence TACCACCTGAAAATAGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120977268_1120977269 -2 Left 1120977268 14:90259997-90260019 CCTAAAAGATAAGGAAAATTGTA 0: 1
1: 0
2: 4
3: 55
4: 674
Right 1120977269 14:90260018-90260040 TACCACCTGAAAATAGATGATGG 0: 1
1: 0
2: 2
3: 12
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120977269 Original CRISPR TACCACCTGAAAATAGATGA TGG Intronic
904707665 1:32403602-32403624 TGGCACCTTAAAATTGATGAAGG + Intergenic
908997256 1:70170097-70170119 TACCATCTGAAAATCAATTAAGG + Intronic
910419500 1:87042463-87042485 TACCAACTAAAAATGGATTAAGG - Intronic
912024114 1:105145352-105145374 TTTCACCTGAAAATAGTGGAAGG - Intergenic
912164132 1:107022240-107022262 GATCATCTGAAAATAGATCATGG - Intergenic
912233950 1:107828294-107828316 TACCACCTGAAAAAAGACCTAGG + Intronic
914867098 1:151440136-151440158 CACCACCTGAAGATAACTGATGG - Intronic
916332535 1:163633755-163633777 TACCACCTCCAAACAGAGGATGG - Intergenic
919249905 1:195040873-195040895 TACCACCTGACAACAGGTGAAGG - Intergenic
921247792 1:213263775-213263797 TACCACATGGAAATTGATAAAGG + Intronic
922449013 1:225721648-225721670 TACGAACTGAAAATGGGTGATGG + Intergenic
923306675 1:232694698-232694720 TTCCACCTGCAAAGGGATGAGGG + Intergenic
1062838100 10:649457-649479 TACTACCTGAAAATTCGTGAAGG - Intronic
1067205813 10:44212131-44212153 TATCACATGAAATAAGATGAGGG - Intergenic
1068458930 10:57300429-57300451 TACAAACTCAAAATAGATCAAGG + Intergenic
1069070615 10:63987634-63987656 TACCACTAGAATACAGATGAAGG + Intergenic
1071173189 10:82892918-82892940 CACCACCTCAAAATATATAAAGG + Intronic
1072537365 10:96373742-96373764 GACCACCTGGAAATGTATGACGG - Exonic
1076044477 10:127280332-127280354 TACAACATAAAAATATATGAAGG - Intronic
1076578886 10:131493689-131493711 TAACAACTAAAAATAGATGCTGG - Intergenic
1078912213 11:15743389-15743411 TCCCACCTGACAAATGATGAGGG - Intergenic
1079791755 11:24747921-24747943 TACCACCTGGAAATAGACTTAGG - Intronic
1080349066 11:31360800-31360822 TACCATCAGAAAAGAGTTGAGGG + Intronic
1081043643 11:38243665-38243687 TAACACATGATAAAAGATGATGG - Intergenic
1081515927 11:43829563-43829585 TTCCAACTGGAAATAGAAGAGGG + Intronic
1083169103 11:60911897-60911919 TACGACCTGAAAATCAAGGATGG + Intergenic
1085914495 11:80869025-80869047 CTCCAGTTGAAAATAGATGATGG + Intergenic
1087856655 11:103099952-103099974 TACCACATGAATATAGATGTTGG + Intergenic
1089418295 11:118312136-118312158 TACCACCTGAAAATGAAAAAAGG - Exonic
1093773493 12:23045201-23045223 TACCACTGGAAAAAATATGATGG + Intergenic
1094694162 12:32800188-32800210 TGCCACATGAACACAGATGAAGG - Intronic
1095962883 12:47846402-47846424 TCCCACCTGGAACTTGATGAGGG + Exonic
1098815833 12:75160624-75160646 TCCCATCTGTAAAAAGATGAAGG + Intronic
1099810830 12:87580174-87580196 TAGCAGCAGAAAATAGATGAAGG - Intergenic
1102154976 12:110717795-110717817 TATCACCTGAAATTAGTAGAAGG - Intergenic
1103642082 12:122359660-122359682 TTCTACCTGAACATAGAGGAAGG + Intronic
1105582167 13:21708558-21708580 TGCCATCTGGAGATAGATGAGGG + Intergenic
1106132262 13:26950414-26950436 TCCCACCTGGAAAAAGATCAAGG + Intergenic
1107058255 13:36129983-36130005 TACCACATCTAAATAGATGCTGG + Intronic
1109851714 13:68074622-68074644 GACTACCTGGAAATTGATGAAGG - Intergenic
1110506050 13:76287547-76287569 TACCACCTAAAATGAGATTAAGG + Intergenic
1112018210 13:95349034-95349056 TTCCACATGAAAAGAGCTGAAGG + Intergenic
1112624095 13:101082806-101082828 TACCTCCAGAACAAAGATGAAGG + Exonic
1113618810 13:111699376-111699398 TGCCACCTGATCAGAGATGACGG + Intergenic
1113624339 13:111784637-111784659 TGCCACCTGATCAGAGATGACGG + Intergenic
1114639274 14:24208137-24208159 TACGACCTGAAAATGGCTGAGGG + Exonic
1115386435 14:32803372-32803394 TAACACCTGTAAATATTTGATGG - Intronic
1117286978 14:54295272-54295294 TATCACCTAGAAATAGATGCTGG - Intergenic
1118640327 14:67786228-67786250 GTCGACCTGGAAATAGATGAAGG + Exonic
1120528319 14:85603495-85603517 TAACTTCTGATAATAGATGATGG + Intronic
1120977269 14:90260018-90260040 TACCACCTGAAAATAGATGATGG + Intronic
1129226149 15:74171537-74171559 TCCCACCTCAAAACAGATGTGGG - Intergenic
1130144145 15:81260224-81260246 TATTAGCTGAAAATAGAAGATGG + Intronic
1132191518 15:99866421-99866443 TCTAACCTGAAAGTAGATGATGG - Intergenic
1135806068 16:25543833-25543855 TACCACCTAAGAATACTTGATGG - Intergenic
1140213817 16:72991765-72991787 AACACCCTGAAAAAAGATGATGG - Intronic
1141322307 16:83022996-83023018 TACCATCTAAAAATGGATAAGGG - Intronic
1144169080 17:12641326-12641348 TGCTAACTGAAAATAGATGGTGG - Intergenic
1149219609 17:54401366-54401388 TTCCACAAGAAAATAGAGGAAGG + Intergenic
1150507057 17:65709675-65709697 TTCCACCTGGAACCAGATGATGG - Intronic
1150694124 17:67389564-67389586 TGCCATTTAAAAATAGATGATGG + Intronic
1150904436 17:69322677-69322699 TACTAGCTGAAAATATTTGAAGG - Intronic
1152489775 17:80622477-80622499 TTTCTCCTGATAATAGATGAAGG + Intronic
1153170742 18:2313023-2313045 TCCCAACTGAGAATTGATGAAGG + Intergenic
1153243183 18:3049487-3049509 TACCATAAGAAAATAGATAATGG - Intergenic
1153722119 18:7915811-7915833 TGCCACCTGAAAATGGTTGTAGG + Intronic
1155201590 18:23522606-23522628 TACCACCGGAACAGAGCTGAAGG - Intronic
1156414092 18:36869230-36869252 AACCACCTGAAAATGGATTTTGG - Intronic
1157048323 18:44130000-44130022 TAACACCTTAAGATAGTTGATGG - Intergenic
1160284235 18:77525279-77525301 TAGCACCAGAAAATATAAGAGGG - Intergenic
1161144094 19:2666930-2666952 TCCATCCTGAAATTAGATGAGGG + Intronic
1162159994 19:8704907-8704929 TAACACCTGAACACAGGTGATGG - Intergenic
1163287914 19:16360268-16360290 TTCCACCAGAAAATAAATGAAGG + Intronic
1164806193 19:31118887-31118909 TTCCACCTTAAACTACATGATGG - Intergenic
1165667305 19:37643739-37643761 TACCTCATGAACATATATGATGG - Intronic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
927628498 2:24749463-24749485 AACCACCTGAAAAGATAAGAGGG + Intronic
928590369 2:32808451-32808473 TACCACCAGAAGAGAGAGGAGGG - Intronic
930042937 2:47142767-47142789 TACTACATGAAAAAAAATGAAGG - Intronic
930816554 2:55604482-55604504 TAATACCTGAAAATAGGTTAAGG + Intronic
931384987 2:61790734-61790756 TCCCACTGGAAAATAGATCATGG + Intergenic
934124828 2:88878172-88878194 TACCATCTGTAAACAGATGGTGG + Intergenic
935408405 2:102734258-102734280 TATCACCTGAATAAAGCTGATGG + Intronic
939710683 2:145515695-145515717 TACAACCTGAAAGTAGAAAAAGG - Intergenic
939951908 2:148485430-148485452 TAAAATCTAAAAATAGATGAAGG + Intronic
941454559 2:165700053-165700075 TAGCACCTGAAAAAGGATGATGG - Intergenic
941634859 2:167925571-167925593 TATCACCTGAAAATACAGGCAGG + Intergenic
944012576 2:194991537-194991559 TATAACCTGAAAATAGAACAAGG + Intergenic
945697807 2:213130003-213130025 TACAGGCTGCAAATAGATGAAGG + Intronic
1168964082 20:1888500-1888522 TCTCATCTGAAAATAGGTGAGGG - Intergenic
1174708497 20:52681388-52681410 GACCATCTGAAAATAAAAGAAGG - Intergenic
1176898505 21:14412617-14412639 CACAACCTGAAAATACATGTAGG + Intergenic
1177230769 21:18317355-18317377 AAAAAGCTGAAAATAGATGATGG - Intronic
1177503134 21:21984833-21984855 AACCAACTGAAGATGGATGAGGG + Intergenic
1178714926 21:34955607-34955629 AACAACCTGAAAACAGATGAAGG + Intronic
1179221922 21:39415874-39415896 TACCAACTGAAAAAAGAAGAGGG - Intronic
1179529040 21:42005597-42005619 TACCACGTGGAAATATATTAGGG - Intronic
1181024420 22:20119845-20119867 TAACACATGAAAATAGGTGATGG + Intronic
1182101450 22:27660448-27660470 TACGACCTGGAAATTAATGAAGG + Intergenic
949851167 3:8421918-8421940 TTTCAGCTGAAAATAGATGTTGG - Intergenic
952100185 3:30002064-30002086 TGCCACATGAAAACAAATGATGG - Intronic
952459629 3:33510946-33510968 TAACAGCTGAAGCTAGATGATGG + Intronic
954936360 3:54330639-54330661 TACCAGCTGCACAGAGATGATGG + Intronic
957016431 3:75069667-75069689 TACCACCTGGAAACAGATGCAGG - Intergenic
959893374 3:111581293-111581315 TAACACCTCAAAATAGGTTAAGG - Intronic
959954789 3:112224023-112224045 TAGCACCTGAGAAGAGATGCTGG + Intronic
960338878 3:116450885-116450907 TACAATCTGAAAATAGACCAAGG + Intronic
964046905 3:152339489-152339511 TACTGCCTGAAAATAGAGGCGGG - Intronic
964757263 3:160099575-160099597 TACCTCCTGGAACTGGATGAAGG - Intergenic
966685950 3:182695708-182695730 TCCCACCTTAAAATAGAAAAAGG - Intergenic
967867029 3:194198613-194198635 AACCACCTTGAAATACATGAAGG + Intergenic
969189762 4:5507780-5507802 TATCCCCTGAAAAGATATGATGG + Intergenic
973076460 4:45933991-45934013 TACCACTTGAAAATAGAAGAGGG - Intergenic
978452613 4:108851685-108851707 TACCAACTAAAAATAGTAGAAGG - Intronic
980691821 4:136305205-136305227 TCATACCTGAAAATAGATTAAGG + Intergenic
981623596 4:146732172-146732194 TACTATTTGAAAATAGGTGATGG + Intronic
984631080 4:182061571-182061593 TACCACGTAAATATATATGAGGG - Intergenic
985125112 4:186685379-186685401 TAACACCATAAAATATATGAAGG + Intronic
985574480 5:667414-667436 AACTAACTCAAAATAGATGACGG + Intronic
987209390 5:15664179-15664201 TACTATCTGAAAGTAGATGGTGG - Intronic
987258710 5:16182114-16182136 TGCCAACTGAAAATGAATGAGGG + Intergenic
988369159 5:30345487-30345509 TATCACCAGAAAATTAATGATGG - Intergenic
989495940 5:42111864-42111886 TACCACTTGGCAATAGGTGACGG - Intergenic
991072961 5:62506370-62506392 TAAAACATGAAAATAAATGAGGG + Intronic
992159957 5:73991587-73991609 TACCACCCGTAAAGGGATGAGGG - Intergenic
993201854 5:84827228-84827250 TAGCATGTGAAAATATATGAAGG + Intergenic
993679951 5:90864523-90864545 TACTCTGTGAAAATAGATGAAGG + Intronic
994002607 5:94798230-94798252 TCCCACATGTAAATAAATGAGGG - Intronic
994214851 5:97126077-97126099 TGCCACCTGAAAATGGCTTAAGG - Intronic
994648599 5:102499239-102499261 AACAACCTGAAAATTGTTGAAGG + Intergenic
996820423 5:127620334-127620356 TGACATCTGAAAATAGATCATGG + Intergenic
997129382 5:131261958-131261980 TAGCAACTGAAATTAGATCATGG + Intronic
1004204930 6:13583690-13583712 AATCACCTGGAAATAGATGATGG + Intronic
1004230737 6:13830979-13831001 TACCATCTGCAAATAGATGATGG + Intergenic
1008461642 6:51781274-51781296 TTCCATCTGAAAATAAATGTAGG + Intronic
1009819189 6:68777772-68777794 TCCCAACTGAGAAGAGATGAAGG + Intronic
1010644919 6:78375301-78375323 TATCAACTGAAAATAAAGGATGG + Intergenic
1011077830 6:83456607-83456629 AAACAACTGAAAATAGATGATGG + Intergenic
1012849495 6:104429834-104429856 AAACACCTGAAATAAGATGAAGG + Intergenic
1013838250 6:114358748-114358770 TTCCTCCTTCAAATAGATGAAGG + Intergenic
1016480125 6:144471672-144471694 AACCAACTGAAAATATATAAGGG + Intronic
1020549282 7:9580246-9580268 TGCCAACTGAAAATAAATAATGG + Intergenic
1021131608 7:16919151-16919173 TACCACAATAAAAAAGATGATGG - Intergenic
1021477488 7:21079143-21079165 TACCTCATGAGAATAAATGAAGG - Intergenic
1021802525 7:24321545-24321567 TTCCACCTAACAATATATGATGG + Intergenic
1022961018 7:35426634-35426656 TACTACCTGAACATGGAGGAAGG - Intergenic
1023184318 7:37517036-37517058 TAACAGCAGAAAATAGATTAAGG - Intergenic
1023736313 7:43238972-43238994 TATCTCCTGAAAATTGATGTTGG + Intronic
1024447538 7:49498918-49498940 TAACACCTGAAAATAAATTTAGG - Intergenic
1024588663 7:50862406-50862428 TAGCTCCTGAACATAGTTGATGG + Intergenic
1029940086 7:104470859-104470881 TGCCCCCAGAAACTAGATGACGG - Intronic
1030196282 7:106856803-106856825 TAACACGTGAAATTAGATGTAGG + Intergenic
1032882623 7:136105254-136105276 TACCACCTTATTACAGATGAGGG - Intergenic
1034351782 7:150420578-150420600 TTCCCCCTGAACATTGATGATGG + Intergenic
1036394953 8:8361544-8361566 TACCCTCTGAAAACAGGTGAAGG - Intronic
1041675181 8:60531119-60531141 TATCAACTGTAAATAAATGAAGG - Intronic
1043428320 8:80170958-80170980 AACCACCTGAACTTAGAAGAAGG + Intronic
1046013783 8:108581660-108581682 TACCAACTGCAATTAGATGTGGG - Intergenic
1048068060 8:130991962-130991984 TAACAGCAGAACATAGATGACGG + Intronic
1048384355 8:133897793-133897815 GCCCACCTGTAAATAGCTGAAGG - Intergenic
1051447843 9:17160088-17160110 TTCCACCAGAAAATATAAGAAGG + Intronic
1051829193 9:21256852-21256874 TACCATCAGAACAGAGATGAAGG + Intergenic
1052540407 9:29804490-29804512 TTCCACCTGAAAAGGGATCAGGG - Intergenic
1052939107 9:34117998-34118020 TATCACTTGGAAATAGGTGATGG - Intronic
1054741839 9:68813980-68814002 TAAAACCTGTAAAAAGATGAGGG + Intronic
1057737917 9:97683120-97683142 TACCACCTGGAAATGGTTTAAGG + Intronic
1062202701 9:135314209-135314231 TATCACCTGAAAATAGAGACAGG - Intergenic
1186141182 X:6575803-6575825 TAACAGCTGATAATAAATGATGG + Intergenic
1188235488 X:27725494-27725516 GACCTGCTGAATATAGATGATGG + Intronic
1190035245 X:47017040-47017062 TAGTAACTGAAAATGGATGAGGG + Intronic
1190948777 X:55121907-55121929 TACCAGCAGAAGATACATGATGG - Intronic
1199815657 X:151394809-151394831 AACCACCAGAAAACAGAAGAGGG + Intergenic
1201538345 Y:15077311-15077333 TTCATCCTGCAAATAGATGATGG + Intergenic