ID: 1120979921

View in Genome Browser
Species Human (GRCh38)
Location 14:90280354-90280376
Sequence GGACTCCTGCGTGTCCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 168}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120979913_1120979921 19 Left 1120979913 14:90280312-90280334 CCTCTGTGAGTGCCACGCACAGG 0: 1
1: 0
2: 1
3: 17
4: 158
Right 1120979921 14:90280354-90280376 GGACTCCTGCGTGTCCTCCCTGG 0: 1
1: 0
2: 0
3: 16
4: 168
1120979916_1120979921 7 Left 1120979916 14:90280324-90280346 CCACGCACAGGGCCAGCTGTGAG 0: 1
1: 0
2: 3
3: 25
4: 242
Right 1120979921 14:90280354-90280376 GGACTCCTGCGTGTCCTCCCTGG 0: 1
1: 0
2: 0
3: 16
4: 168
1120979910_1120979921 25 Left 1120979910 14:90280306-90280328 CCCCAGCCTCTGTGAGTGCCACG 0: 1
1: 0
2: 1
3: 21
4: 386
Right 1120979921 14:90280354-90280376 GGACTCCTGCGTGTCCTCCCTGG 0: 1
1: 0
2: 0
3: 16
4: 168
1120979911_1120979921 24 Left 1120979911 14:90280307-90280329 CCCAGCCTCTGTGAGTGCCACGC 0: 1
1: 0
2: 1
3: 15
4: 133
Right 1120979921 14:90280354-90280376 GGACTCCTGCGTGTCCTCCCTGG 0: 1
1: 0
2: 0
3: 16
4: 168
1120979912_1120979921 23 Left 1120979912 14:90280308-90280330 CCAGCCTCTGTGAGTGCCACGCA 0: 1
1: 0
2: 2
3: 15
4: 130
Right 1120979921 14:90280354-90280376 GGACTCCTGCGTGTCCTCCCTGG 0: 1
1: 0
2: 0
3: 16
4: 168
1120979920_1120979921 -5 Left 1120979920 14:90280336-90280358 CCAGCTGTGAGGCTCGGAGGACT 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1120979921 14:90280354-90280376 GGACTCCTGCGTGTCCTCCCTGG 0: 1
1: 0
2: 0
3: 16
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120979921 Original CRISPR GGACTCCTGCGTGTCCTCCC TGG Intronic
900244428 1:1630835-1630857 GGACTCCTGTGTCTGCCCCCGGG + Intergenic
900506981 1:3034635-3034657 AGACTCATGCGTGACCTTCCAGG + Intergenic
900523175 1:3115971-3115993 GGCCGCCTGGGAGTCCTCCCGGG - Intronic
900631593 1:3639312-3639334 TGCCTCCTGCGTGTGCTCGCTGG + Intronic
901839923 1:11947784-11947806 GGTCTCCTGAGTCTCCTCCAGGG - Intronic
902472387 1:16657846-16657868 GGAGTCCTTCGTGTCCCCCTGGG - Intergenic
902486417 1:16749600-16749622 GGAGTCCTTCGTGTCCCCCTGGG + Intronic
905906762 1:41623634-41623656 GGACTCCTGGGTTTCATTCCTGG + Intronic
907399804 1:54217990-54218012 GGAATGCTTCCTGTCCTCCCAGG + Intronic
908023834 1:59926893-59926915 AGACCGGTGCGTGTCCTCCCGGG - Intergenic
910728070 1:90359772-90359794 AGACTCCTGTGTGAGCTCCCCGG + Intergenic
911024443 1:93421979-93422001 GGACTCCTGTGTGATCTCCAGGG - Intergenic
913445215 1:118943818-118943840 GGCCTCCTGCTCGTGCTCCCTGG - Intronic
916908970 1:169323886-169323908 GCACTCCTGCCTGTCCTGCCTGG - Intronic
918306444 1:183251050-183251072 GGTCTCATGCGTGTCCTGCTTGG - Exonic
919776758 1:201199302-201199324 CGACTCCTTCCTCTCCTCCCTGG + Intronic
920728848 1:208463553-208463575 GGAGTGCTGTTTGTCCTCCCTGG - Intergenic
922422138 1:225467316-225467338 CGCCTCTTGCCTGTCCTCCCCGG - Intergenic
1062899473 10:1131524-1131546 GGACTCCTGCATGTCCTTGGGGG + Exonic
1063570409 10:7210278-7210300 GGACACCTGAGTGTCTTCCTAGG + Intronic
1069897972 10:71690510-71690532 GGACTCCTGGCCGTACTCCCGGG - Intronic
1074523991 10:114248939-114248961 AGCCTCCTGCCTGGCCTCCCTGG + Intronic
1077539630 11:3140447-3140469 GGACCCCTGAGTGTCCACACAGG - Intronic
1083325785 11:61872315-61872337 GGACTCTTGCGGCTCTTCCCAGG - Intergenic
1084313658 11:68331399-68331421 GTTCTCCTGCCTGTGCTCCCGGG - Intronic
1084381553 11:68816153-68816175 GGACTCCTGCGTGGACACTCTGG - Intronic
1085284545 11:75351430-75351452 GGTCTCCTGTGTGGTCTCCCCGG - Intronic
1087701023 11:101436423-101436445 GGACTATTGTGTGTCCTCCCAGG + Intergenic
1089303337 11:117511894-117511916 GCACTCGTGCGTGTGCACCCTGG - Intronic
1090838538 11:130471017-130471039 GTACTCCGGCGTGTCTCCCCGGG + Exonic
1091663574 12:2402361-2402383 GGACACCTCCGTGTGCTTCCAGG + Intronic
1094041133 12:26122684-26122706 GGGCGCCGGCGAGTCCTCCCCGG + Exonic
1096021634 12:48330007-48330029 GGGCTCCTGCTTCTCTTCCCTGG - Exonic
1096464533 12:51841042-51841064 GGACTCCTGGGTGGGCTGCCTGG - Intergenic
1097777735 12:63668225-63668247 GGGCTCCTGGAGGTCCTCCCCGG - Exonic
1100357519 12:93845180-93845202 TGACTCCTGCCTCTCCTCCATGG + Intronic
1101961473 12:109253990-109254012 GAACTCCTGAGTGTGCTTCCCGG - Intronic
1103919411 12:124391558-124391580 GCACTCCTGCGTGTCTTGTCAGG + Intronic
1105717588 13:23082551-23082573 GCTCTCCTGAGTGTCTTCCCGGG + Intergenic
1118817538 14:69323743-69323765 GGACTCCTGCCTGTCTGACCTGG + Intronic
1119072184 14:71597758-71597780 AGGCTCCTGCCTGTCCTCCAGGG + Intronic
1119587542 14:75850651-75850673 TGAATCCTGCCTGTCATCCCAGG - Intronic
1119704317 14:76774481-76774503 TGACTTCTGTGTGTCCTCCTGGG - Intronic
1120979921 14:90280354-90280376 GGACTCCTGCGTGTCCTCCCTGG + Intronic
1122374829 14:101250782-101250804 GGCCTCCTTCGTGTGCTCCAAGG - Intergenic
1123055759 14:105568874-105568896 GGTGCACTGCGTGTCCTCCCTGG - Intergenic
1123080116 14:105688393-105688415 GGTGCACTGCGTGTCCTCCCTGG - Intergenic
1123080164 14:105688647-105688669 GGTGCACTGCGTGTCCTCCCTGG - Intergenic
1123415699 15:20093465-20093487 AGACTTCTGTCTGTCCTCCCTGG - Intergenic
1123525038 15:21100579-21100601 AGACTTCTGTCTGTCCTCCCTGG - Intergenic
1124137771 15:27049862-27049884 GGACACCTGTGTGCCCTCCCTGG + Intronic
1124791426 15:32730896-32730918 GGACTCCAGCACCTCCTCCCCGG - Exonic
1129818719 15:78580252-78580274 GGAGTCCTGCCTGGTCTCCCAGG - Intronic
1132885909 16:2181807-2181829 GATCTCCTGCAGGTCCTCCCAGG + Exonic
1136285184 16:29236532-29236554 GGACTCCTGGGTGCCGTCTCCGG - Intergenic
1138530391 16:57631432-57631454 GGCCTCCTCCATGGCCTCCCTGG - Intronic
1138559068 16:57789184-57789206 GGACTCCTGCGCAGCCTCCTTGG - Intronic
1139230838 16:65281087-65281109 GGCATCCTGCGAGTCCTCCCTGG - Intergenic
1140918985 16:79519633-79519655 GGACTCCTGCCAGGCCACCCGGG - Intergenic
1141556264 16:84838650-84838672 GATCTCCTCCTTGTCCTCCCTGG - Exonic
1141602737 16:85136423-85136445 AGAGTCCTGCATTTCCTCCCTGG + Intergenic
1142026688 16:87818199-87818221 GCTCTCCTGTTTGTCCTCCCAGG - Intergenic
1142090247 16:88206156-88206178 GGACTCCTGGGTGCCGTCTCCGG - Intergenic
1144738293 17:17567081-17567103 GGACCCAAGCGTGTCTTCCCTGG - Intronic
1144751552 17:17652333-17652355 GCACTACTCTGTGTCCTCCCTGG - Intergenic
1144780441 17:17805635-17805657 AGAGTCCTCTGTGTCCTCCCTGG - Intronic
1151328631 17:73393963-73393985 GGCATCCAGCGTGGCCTCCCGGG + Intronic
1151937236 17:77270060-77270082 GGAATCCTGAGAGTCATCCCTGG + Intergenic
1152114749 17:78378720-78378742 GGCCTCCTGCCTGGCCGCCCAGG + Exonic
1152124479 17:78438128-78438150 TGAGTCCTTTGTGTCCTCCCTGG + Intronic
1152611244 17:81315848-81315870 GGACCCCAGCCTGTGCTCCCAGG - Intronic
1152715225 17:81896549-81896571 GGAGTTCTTCTTGTCCTCCCTGG - Intronic
1154202147 18:12307557-12307579 GGACTCTGGCGCGCCCTCCCAGG + Intergenic
1154216476 18:12420164-12420186 GGAGTCCCGCGAGCCCTCCCCGG - Intronic
1156391314 18:36652876-36652898 GGACTCCTCCCTGTCCACCAAGG + Exonic
1160083681 18:75754267-75754289 GGGCTCCTGCTTGCCCTCCTGGG - Intergenic
1160090884 18:75825634-75825656 TGACTCCTGTGTGTCTGCCCTGG - Intergenic
1160566137 18:79787920-79787942 GGACCCCGGCGTCTCCTCCCTGG - Intergenic
1160860127 19:1234164-1234186 GGGCCCCTGCGTGTCCCCCATGG - Intronic
1161043526 19:2122456-2122478 GGACTACTGCGTTTTCTCCGTGG - Intronic
1163026793 19:14517630-14517652 TGCCTCCTGCGTGCCCTGCCGGG + Intronic
1163400945 19:17092015-17092037 AGACTGCTCCGTGTCCTCCAGGG - Intronic
1163848916 19:19652697-19652719 GGCCTCCCGCTTGACCTCCCGGG + Exonic
1164695475 19:30240530-30240552 GCACTCCTGGGCCTCCTCCCAGG - Intronic
1164938122 19:32230644-32230666 GGGCTCCTGCCTCTCCTCACGGG + Intergenic
1167463387 19:49638127-49638149 GGCCTCCAGCGTCTCCTCCCAGG + Intronic
1167506220 19:49872535-49872557 TAACTCCTGCTTGGCCTCCCAGG + Intronic
1167768451 19:51499573-51499595 GGGGGCCTCCGTGTCCTCCCTGG - Exonic
1168170757 19:54587132-54587154 GGACTCCTGTATGTCCACCCAGG - Intronic
1168187920 19:54713019-54713041 GGACCCCTGGATGTCCACCCAGG - Intergenic
925168174 2:1732235-1732257 GGTCTGCTGCCTGGCCTCCCCGG - Intronic
925893579 2:8455257-8455279 GGACTCCGGCGGGCCTTCCCTGG - Intergenic
929484051 2:42339230-42339252 GGTTTCCTGAGTGCCCTCCCTGG - Intronic
931646316 2:64424943-64424965 AGACTCCTGAGTATGCTCCCTGG + Intergenic
932354181 2:71055255-71055277 GAACTGCAGCCTGTCCTCCCTGG + Intergenic
933161276 2:79027090-79027112 GGGATCCTTCGTGTCCTCCCTGG + Exonic
933174236 2:79158385-79158407 GGGATCCTTCGTGTCCTCCCTGG - Exonic
938263008 2:129908656-129908678 GGCCTCCTCCCTGGCCTCCCAGG - Intergenic
938689557 2:133775073-133775095 GGAATCCTGGATGTCTTCCCTGG + Intergenic
941698982 2:168583537-168583559 GGCCTCTTGGGTGGCCTCCCTGG + Intronic
942240946 2:173964158-173964180 GGGCCCCAGCGTGCCCTCCCGGG - Intronic
947593230 2:231396402-231396424 GGAGCCCTCCGTTTCCTCCCCGG + Intronic
947634718 2:231674167-231674189 GGCCTCCTGCGGCTGCTCCCAGG + Intergenic
947874643 2:233460216-233460238 GCACTTCTGCTTGTCTTCCCAGG - Exonic
947932410 2:233974639-233974661 GGAGGCCTGTGTGACCTCCCAGG - Intronic
948738376 2:240025627-240025649 CGACTTCTGCGTCTCGTCCCAGG + Intergenic
948961517 2:241342299-241342321 AGACTCCTGCCTGTTCTCCAGGG + Intronic
1169193689 20:3672536-3672558 GGACTGCTGCGTGCGCTGCCTGG - Exonic
1169422512 20:5471566-5471588 GGACTCCTCCCTGTCCCCCAGGG + Intergenic
1174487916 20:50872792-50872814 TGTCTCCAGCGTGTCCTCCAAGG + Intronic
1175871144 20:62210091-62210113 GGACCCCTGTGTGTCCTCAAAGG + Intergenic
1176168995 20:63688728-63688750 GGGCTCCTGCGTTTCCTTCCTGG + Intronic
1176413557 21:6461784-6461806 GGACAGTGGCGTGTCCTCCCAGG - Intergenic
1178273954 21:31219177-31219199 GGACTCCAGAAAGTCCTCCCAGG + Intronic
1178589300 21:33895972-33895994 GGCCTCCTGGGTGTGCTGCCTGG - Exonic
1178675285 21:34626241-34626263 GGGCTCCTGGGTTTCTTCCCCGG - Intergenic
1179689055 21:43070107-43070129 GGACAGTGGCGTGTCCTCCCAGG - Intronic
1180044080 21:45294825-45294847 GGGCTGCTGGGTTTCCTCCCTGG + Intergenic
1180129772 21:45820041-45820063 GGACTGTTGCGGGTCTTCCCTGG + Intronic
1180786460 22:18550439-18550461 TCACTCCTGCGTCTCCTCCAGGG - Intergenic
1181131741 22:20736162-20736184 TCACTCCTGCGTCTCCTCCAGGG - Intronic
1181243381 22:21489992-21490014 TCACTCCTGCGTCTCCTCCAGGG - Intergenic
1181803588 22:25362122-25362144 GGTCTCCTGAGTGCCCTACCAGG + Exonic
1182257862 22:29050901-29050923 GGACTCCTGAGTGTCCTGGAGGG - Exonic
1182544387 22:31066014-31066036 AGACTTCTGTCTGTCCTCCCTGG + Intronic
1185215898 22:49599876-49599898 GGCCTCCTGCCGGCCCTCCCAGG - Intronic
1185215909 22:49599927-49599949 GGCCTCCTGCCGGCCCTCCCAGG - Intronic
1203295914 22_KI270736v1_random:43073-43095 GGACTCCTACACGTACTCCCAGG - Intergenic
950614438 3:14147811-14147833 GGCCGCCTCCGTGTGCTCCCAGG - Intronic
953533911 3:43762656-43762678 GGAATCCAGCGTGGCTTCCCTGG + Intergenic
961798685 3:129428011-129428033 TTACTCCTGGGTGTCATCCCTGG + Intronic
962922631 3:139964701-139964723 TGACTCCTGTGTCTTCTCCCAGG + Intronic
963647381 3:147932391-147932413 GGAGTCCTGCTGGGCCTCCCTGG - Intergenic
967875289 3:194264834-194264856 GGACTGCAGTGTGTGCTCCCCGG + Intergenic
967875336 3:194265029-194265051 GGACTGCAGTGTGTGCTCCCTGG + Intergenic
968669773 4:1842925-1842947 GATCTCCTGCGTGTCTTGCCTGG + Intronic
969442614 4:7226361-7226383 GGACCTCTGCGTGTCCTTCCAGG + Intronic
973957687 4:56079111-56079133 GGAGTCCAGCGTGTCCTGCCAGG + Intergenic
976186079 4:82443908-82443930 GTACTCCAGCCTGTACTCCCTGG - Intronic
978641895 4:110880860-110880882 GGTCTCTTGCCTGTCCACCCAGG - Intergenic
985929277 5:3043518-3043540 GGACTCCTTAATGTCCACCCCGG + Intergenic
987108317 5:14662502-14662524 GGATTCCTAAGTGTCCCCCCAGG - Intergenic
989581123 5:43034195-43034217 GGGCTCCTGCGGATCCTCCTGGG - Intergenic
997306433 5:132840449-132840471 GGACGCCTATGTCTCCTCCCTGG - Intergenic
997892081 5:137686251-137686273 GGATTCCTGTGTCTCCTGCCTGG + Intronic
998140511 5:139697210-139697232 GGTCTCTAGCGTGGCCTCCCTGG + Intergenic
1002001086 5:176196595-176196617 GCACTCCTGCCTGGCATCCCAGG + Intergenic
1002253249 5:177942377-177942399 GCACTCCTGCCTGGCATCCCAGG - Intergenic
1002347793 5:178560062-178560084 GGTCTCCTGGGTGTCCTCAGGGG - Intronic
1002785342 6:395862-395884 GGACATCTGCGGGTCCTCCAGGG - Exonic
1004460882 6:15834774-15834796 GGACTACAGTGTGTTCTCCCAGG - Intergenic
1007326193 6:41061807-41061829 GTTCTCCTGAATGTCCTCCCAGG - Exonic
1008294647 6:49760917-49760939 GGCCTCCTGCTCCTCCTCCCTGG + Intergenic
1012951567 6:105523279-105523301 GGACTCCTACCACTCCTCCCAGG - Intergenic
1016184861 6:141185399-141185421 AGACTCCTGGGACTCCTCCCTGG + Intergenic
1017819718 6:158040606-158040628 GGATGACTGCGTGTCCTCCCAGG + Intronic
1018035887 6:159880623-159880645 GGACTTATGCTTGTTCTCCCAGG - Intergenic
1019020192 6:168911634-168911656 GGAATCCTCTCTGTCCTCCCGGG + Intergenic
1019095194 6:169574123-169574145 GCACACCTGGGTGTCCTGCCAGG - Intronic
1019366406 7:635600-635622 GGACTCCTCCGCTGCCTCCCAGG + Intronic
1020643002 7:10779563-10779585 GGACTCCTCCGTGGCGACCCAGG - Intergenic
1026979888 7:74519947-74519969 GGACGCCTGCGAGGACTCCCTGG + Intronic
1032076174 7:128837211-128837233 GGCCTGCTGCATGGCCTCCCGGG - Exonic
1032586757 7:133153943-133153965 TGACTCATGCCTGTCATCCCAGG - Intergenic
1035231797 7:157469903-157469925 GGACTCCTGAGTGGGCGCCCAGG + Intergenic
1044221052 8:89669985-89670007 TGACTCCTGCCTCTCCTCCAGGG + Intergenic
1045295594 8:100869474-100869496 GGACTCCTGCTTCTCCTTCCAGG + Intergenic
1047296793 8:123577345-123577367 GGCCTCCTCCATGTCCTCTCTGG + Intergenic
1049465649 8:142750190-142750212 GGACTCCTGAGTCTCCTTTCTGG - Exonic
1056549056 9:87636235-87636257 GGACTCCTGGATGTCCTGGCTGG + Intronic
1057172204 9:92969673-92969695 GGACTCCCGCACGGCCTCCCGGG + Intronic
1060374035 9:123102652-123102674 GAACTCCTGAGGGTCCTTCCTGG - Intronic
1061398503 9:130356013-130356035 GGTTTCCTGCTTGTCCTGCCTGG + Intronic
1061924296 9:133798382-133798404 GGCTTCCTGGGCGTCCTCCCAGG - Intronic
1062568845 9:137175263-137175285 CGACTCCGGCATGGCCTCCCAGG - Exonic
1062607833 9:137355938-137355960 GGACTCCAGCCACTCCTCCCAGG - Intronic
1062681758 9:137785821-137785843 GGACGCCTGGGTGCCCTCCCCGG + Intronic
1189236261 X:39489556-39489578 GGGCTTCTGCCTGTCCTTCCAGG + Intergenic
1190053898 X:47171027-47171049 GGATTCCTACGAGGCCTCCCCGG + Exonic
1190685245 X:52867687-52867709 AGACTCCTCCGTGTCGACCCGGG - Intronic
1190781897 X:53604765-53604787 GGACTCCATCCTCTCCTCCCTGG - Exonic
1193240821 X:79167037-79167059 GAAATCCTGCCTGTCCTCCAAGG - Intergenic
1200108094 X:153725415-153725437 GGCCTCCTGCGTGGGCTCCCCGG - Exonic
1202181347 Y:22142516-22142538 GGACTCTTGCTTGTCTTCTCTGG - Intergenic
1202210013 Y:22443884-22443906 GGACTCTTGCTTGTCTTCTCTGG + Intergenic