ID: 1120996538

View in Genome Browser
Species Human (GRCh38)
Location 14:90422256-90422278
Sequence GAATATTCTGTCTTCGCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120996538_1120996548 27 Left 1120996538 14:90422256-90422278 CCTTGAGCGAAGACAGAATATTC No data
Right 1120996548 14:90422306-90422328 GCAAACACAGTGTCTGAGCACGG No data
1120996538_1120996541 3 Left 1120996538 14:90422256-90422278 CCTTGAGCGAAGACAGAATATTC No data
Right 1120996541 14:90422282-90422304 CCCACCCTCTGCCCATCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120996538 Original CRISPR GAATATTCTGTCTTCGCTCA AGG (reversed) Intergenic