ID: 1120996538 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:90422256-90422278 |
| Sequence | GAATATTCTGTCTTCGCTCA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1120996538_1120996548 | 27 | Left | 1120996538 | 14:90422256-90422278 | CCTTGAGCGAAGACAGAATATTC | No data | ||
| Right | 1120996548 | 14:90422306-90422328 | GCAAACACAGTGTCTGAGCACGG | 0: 1 1: 0 2: 2 3: 17 4: 238 |
||||
| 1120996538_1120996541 | 3 | Left | 1120996538 | 14:90422256-90422278 | CCTTGAGCGAAGACAGAATATTC | No data | ||
| Right | 1120996541 | 14:90422282-90422304 | CCCACCCTCTGCCCATCCTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1120996538 | Original CRISPR | GAATATTCTGTCTTCGCTCA AGG (reversed) | Intergenic | ||