ID: 1120996539

View in Genome Browser
Species Human (GRCh38)
Location 14:90422281-90422303
Sequence CAGAGGATGGGCAGAGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120996539_1120996548 2 Left 1120996539 14:90422281-90422303 CCCCACCCTCTGCCCATCCTCTG No data
Right 1120996548 14:90422306-90422328 GCAAACACAGTGTCTGAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120996539 Original CRISPR CAGAGGATGGGCAGAGGGTG GGG (reversed) Intergenic