ID: 1120996540

View in Genome Browser
Species Human (GRCh38)
Location 14:90422282-90422304
Sequence CCAGAGGATGGGCAGAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120996540_1120996548 1 Left 1120996540 14:90422282-90422304 CCCACCCTCTGCCCATCCTCTGG No data
Right 1120996548 14:90422306-90422328 GCAAACACAGTGTCTGAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120996540 Original CRISPR CCAGAGGATGGGCAGAGGGT GGG (reversed) Intergenic