ID: 1120996541

View in Genome Browser
Species Human (GRCh38)
Location 14:90422282-90422304
Sequence CCCACCCTCTGCCCATCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120996538_1120996541 3 Left 1120996538 14:90422256-90422278 CCTTGAGCGAAGACAGAATATTC No data
Right 1120996541 14:90422282-90422304 CCCACCCTCTGCCCATCCTCTGG No data
1120996536_1120996541 5 Left 1120996536 14:90422254-90422276 CCCCTTGAGCGAAGACAGAATAT No data
Right 1120996541 14:90422282-90422304 CCCACCCTCTGCCCATCCTCTGG No data
1120996535_1120996541 18 Left 1120996535 14:90422241-90422263 CCTTCGAAAGCTTCCCCTTGAGC No data
Right 1120996541 14:90422282-90422304 CCCACCCTCTGCCCATCCTCTGG No data
1120996537_1120996541 4 Left 1120996537 14:90422255-90422277 CCCTTGAGCGAAGACAGAATATT No data
Right 1120996541 14:90422282-90422304 CCCACCCTCTGCCCATCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120996541 Original CRISPR CCCACCCTCTGCCCATCCTC TGG Intergenic