ID: 1120996542

View in Genome Browser
Species Human (GRCh38)
Location 14:90422283-90422305
Sequence ACCAGAGGATGGGCAGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120996542_1120996548 0 Left 1120996542 14:90422283-90422305 CCACCCTCTGCCCATCCTCTGGT No data
Right 1120996548 14:90422306-90422328 GCAAACACAGTGTCTGAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120996542 Original CRISPR ACCAGAGGATGGGCAGAGGG TGG (reversed) Intergenic